Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology

Monique Marylin Alves de Almeida; Yves De Repentigny; Sabrina Gagnon; Emma R Sutton; Rashmi Kothary

doi:10.7554/eLife.99141

. 2025 Feb 20;13:RP99141. doi: 10.7554/eLife.99141

Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology

Monique Marylin Alves de Almeida ^1,², Yves De Repentigny ¹, Sabrina Gagnon ¹, Emma R Sutton ^1,², Rashmi Kothary ^1,^2,^3,^4,^✉

Editors: Pramod K Mistry⁵, Pramod K Mistry⁶

PMCID: PMC11841985 PMID: 39976226

Abstract

Spinal muscular atrophy (SMA) is caused by mutations in the Survival Motor Neuron 1 (SMN1) gene. While traditionally viewed as a motor neuron disorder, there is involvement of various peripheral organs in SMA. Notably, fatty liver has been observed in SMA mouse models and SMA patients. Nevertheless, it remains unclear whether intrinsic depletion of SMN protein in the liver contributes to pathology in the peripheral or central nervous systems. To address this, we developed a mouse model with a liver-specific depletion of SMN by utilizing an Alb-Cre transgene together with one Smn^2B allele and one Smn1 exon 7 allele flanked by loxP sites. Initially, we evaluated phenotypic changes in these mice at postnatal day 19 (P19), when the severe model of SMA, the Smn^2B/- mice, exhibit many symptoms of the disease. The liver-specific SMN depletion does not induce motor neuron death, neuromuscular pathology or muscle atrophy, characteristics typically observed in the Smn^2B/- mouse at P19. However, mild liver steatosis was observed, although no changes in liver function were detected. Notably, pancreatic alterations resembled that of Smn^2B/-mice, with a decrease in insulin-producing β-cells and an increase in glucagon-producingα-cells, accompanied by a reduction in blood glucose and an increase in plasma glucagon and glucagon-like peptide (GLP-1). These changes were transient, as mice at P60 exhibited recovery of liver and pancreatic function. While the mosaic pattern of the Cre-mediated excision precludes definitive conclusions regarding the contribution of liver-specific SMN depletion to overall tissue pathology, our findings highlight an intricate connection between liver function and pancreatic abnormalities in SMA.

Research organism: Mouse

Introduction

Insufficient levels of Survival Motor Neuron (SMN) protein, primarily arising from mutations or deletions in the SMN1 gene, are the root cause of spinal muscular atrophy (SMA), a hereditary neuromuscular disorder widely acknowledged as one of the leading genetic causes of infant mortality (Lefebvre et al., 1995; Lefebvre et al., 1997; Crawford and Pardo, 1996). Characterized by the loss of motor neurons, SMA presents as a progressive weakening of muscle strength, primarily impacting proximal muscles. If left untreated, this deterioration culminates in respiratory failure and premature mortality (Finkel et al., 2016).

The diverse phenotypes observed in SMA patients can be attributed to the genetic variations within the SMN genes (Lefebvre et al., 1995). Humans harbor two copies of the SMN gene, SMN1 and SMN2, which share a nearly identical sequence except for a critical C to T substitution at position 6 of exon 7 in SMN2 (Lorson et al., 1999). This single nucleotide change disrupts splicing of the gene, resulting in the predominant production of an unstable protein lacking exon 7, known as SMNΔ7 (Lorson et al., 1999). Despite this, approximately 10% of functional full-length (FL) SMN protein is still produced by the SMN2 gene (Lefebvre et al., 1997). Consequently, the SMN2 gene serves as a modifier of disease phenotype, with a higher copy number correlating with milder disease severity (Feldkötter et al., 2002). In contrast, mice possess a single copy of the Smn1 gene (Lefebvre et al., 1997). Notably, while homozygous deletion of both SMN genes has not been observed in humans, the homozygous deletion of the Smn1 gene in mice induces morphological alterations and degenerative changes in embryos post-morula stage, ultimately resulting in death at preimplantation stage (Schrank et al., 1997). This underscores the pivotal role of the SMN gene in early embryonic development (Vitte et al., 2004).

Recent research has unveiled the extensive impact of SMN depletion beyond motor neurons, implicating additional tissues such as the liver and pancreas in both SMA patients and mouse models of SMA (Bowerman et al., 2014; Bowerman et al., 2012a; Bowerman et al., 2012b; Deguise et al., 2019a). Despite major therapeutic advancements focusing on restoring SMN levels, which have notably enhanced both lifespan and quality of life in SMA patients, complete phenotypic rescue remains elusive (Finkel et al., 2016; Chiriboga, 2017; McMillan et al., 2022). Additionally, existing therapies primarily target postnatal treatment, potentially overlooking crucial developmental changes stemming from SMN depletion. This underscores the likelihood of a broader role for the SMN gene in multiple non-neuronal cell types, necessitating further exploration.

Attention has been increasingly drawn to the liver as a critical area of investigation in SMA research. Both clinical studies and preclinical mouse models have unveiled disruptions in fatty acid metabolism, leading to an increased susceptibility among SMA patients to dyslipidemia and liver steatosis (Deguise et al., 2019a; Crawford et al., 1999; Deguise et al., 2021a; Deguise et al., 2019b; Deguise et al., 2021b). Given its multifaceted role in regulating numerous biological functions, including the storage and regulation of lipids, carbohydrates, amino acids, and iron, as well as the synthesis of essential growth factors and the clearance of toxic metabolites, any disruptions in liver function may have deleterious effects on other tissues (Trefts et al., 2017).

To explore the role of SMN in the liver, prior studies have utilized a transgenic mouse model featuring the Cre recombinase transgene driven by the α-fetoprotein promoter (Alfp-Cre). This approach led to near-total depletion of SMN protein specifically in the liver, resulting in severe impairment of liver development and late embryonic lethality (Vitte et al., 2004). In our study, to better represent the level of SMN depletion in the liver observed in SMA and elucidate the intricate interplay between SMN deficiency in the liver and its systemic impact in SMA-like pathology, we utilized a mouse model employing Alb-Cre, where the albumin promoter drives expression of Cre recombinase in a liver-specific manner. This model also harbors one Smn^2B allele and one Smn1 exon 7 allele flanked by loxP sites (F7). The Smn^2B allele contains a 3-base pair substitution in the mouse Smn1 gene, resulting in aberrant splicing of exon 7 (DiDonato et al., 2001; Hammond et al., 2010). Consequently, this genetic approach results in the production of approximately 30% full-length functional SMN protein production in the liver.

Our findings reveal that our novel liver-specific SMN depleted (herein referred to as Alb^Cre/+;Smn^2B/F7) mouse model induces mild liver steatosis and disrupts pancreatic function at postnatal day 19 (P19), characterized by decreased insulin-positive and increased glucagon-positive cells, alongside reduced blood glucose levels. However, both liver and pancreatic defects were rescued by P60. Remarkably, this mouse model does not exhibit an overt SMA phenotype, demonstrating normal lifespan and motor function. Nevertheless, our data suggests an intricate relationship between hepatic function and pancreatic abnormalities in SMA, thereby enhancing our comprehension of the disease’s pathophysiology.

Results

Generation of liver-specific SMN-depleted mice

To elucidate the impact of liver-specific SMN depletion on both CNS and peripheral tissue pathology, we utilized mice expressing Cre recombinase under the control of the mouse albumin promoter, referred to as Alb^Cre. This strain is commonly employed for liver-specific gene knockout using the Cre/loxP system (Postic et al., 1999). We generated the Smn^2B/F7 genotype by crossing Smn^F7/F7 with Smn^2B/2B mice (Figure 1A). The Smn^2B/F7 genotype carries one allele harboring a three nucleotide switch in the exon splicing enhancer within exon 7 of the mouse Smn1 gene (known as Smn^2B allele), mimicking the SMN2 gene in humans (Hammond et al., 2010), while the other allele features exon 7 flanked by loxP sites (Frugier et al., 2000). Additionally, crosses between Alb^Cre and Smn^F7/F7 yielded Alb^Cre/+;Smn^F7/+ offspring.

Figure 1. — (A) Schematic representation of the breeding scheme to generate liver-specific SMN depletion. In these mice, the *Smn1* gene carries one *Smn^2B* allele that harbors a three-nucleotide switch in exon 7, and one *Smn1* allele whose exon 7 is floxed by loxP sites (*Smn^F7*). The *Alb-Cre* transgene has also been crossed into this background to provide liver-specific expression of the Cre recombinase. (B) Littermate controls do not harbor Cre recombinase but do carry one *Smn^2B* allele and are thus used as heterozygous controls. (C) Upon crossing *Alb^Cre/+;Smn^F7/+* with *Smn^2B/F7* animals, Cre recombination will induce specific excision of exon 7 in the liver, leading to reduced SMN protein production only in the liver. (**D–H**) Immunoblots were performed to assess SMN protein levels in various tissues from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. Membranes were probed for SMN and then reprobed for α-tubulin (loading control). (**D’-H’**) Bar graphs show quantification of SMN protein levels in the liver (D’), brain (E’), muscle (F’), spinal cord (G’) and pancreas (H’), normalized to α-tubulin. n ≥ 3, mean ± SEM. Statistical significance indicated by *p < 0.05, **p < 0.01 or p values, following Brown-Forsythe and Welch ANOVA.

Figure 1—source data 1. PDF file containing original western blots for Figure 1D–H, indicating the relevant bands and treatments.

elife-99141-fig1-data1.pdf^{(1.5MB, pdf)}

Figure 1—source data 2. Original files for western blot analysis displayed in Figure 1D–H.

elife-99141-fig1-data2.zip^{(1.1MB, zip)}

Figure 1—source data 3. Raw data for SMN protein levels plotted in Figure 1D’–H’.

elife-99141-fig1-data3.xlsx^{(10.6KB, xlsx)}

Figure 1—figure supplement 1. — (A) Schematic representation of the breeding scheme to generate liver-specific SMN depletion. In these mice, the *Smn1* gene carries one *Smn^2B* allele that harbors a three-nucleotide switch in exon 7, and one *Smn1* allele whose exon 7 is floxed by loxP sites (*Smn^F7*). The *Alb-Cre* transgene has also been crossed into this background to provide liver-specific expression of the Cre recombinase. (B) Littermate controls do not harbor Cre recombinase but do carry one *Smn^2B* allele and are thus used as heterozygous controls. (C) Upon crossing *Alb^Cre/+;Smn^F7/+* with *Smn^2B/F7* animals, Cre recombination will induce specific excision of exon 7 in the liver, leading to reduced SMN protein production only in the liver. (**D–H**) Immunoblots were performed to assess SMN protein levels in various tissues from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. Membranes were probed for SMN and then reprobed for α-tubulin (loading control). (**D’-H’**) Bar graphs show quantification of SMN protein levels in the liver (D’), brain (E’), muscle (F’), spinal cord (G’) and pancreas (H’), normalized to α-tubulin. n ≥ 3, mean ± SEM. Statistical significance indicated by *p < 0.05, **p < 0.01 or p values, following Brown-Forsythe and Welch ANOVA.

Figure 1—source data 1. PDF file containing original western blots for Figure 1D–H, indicating the relevant bands and treatments.

elife-99141-fig1-data1.pdf^{(1.5MB, pdf)}

Figure 1—source data 2. Original files for western blot analysis displayed in Figure 1D–H.

elife-99141-fig1-data2.zip^{(1.1MB, zip)}

Figure 1—source data 3. Raw data for SMN protein levels plotted in Figure 1D’–H’.

elife-99141-fig1-data3.xlsx^{(10.6KB, xlsx)}

The liver-specific mouse line was subsequentially established through further genetic crosses between Alb^Cre/+;Smn^F7/+ and Smn^2B/F7, resulting in various genotypes, including +/+;Smn^2B/F7 (Figure 1B), and Alb^Cre/+;Smn^2B/F7 (Figure 1C). As +/+;Smn^2B/F7 mice lack Cre recombinase, they were used as heterozygous controls. In contrast, recombination occurs in Alb^Cre/+;Smn^2B/F7 animals resulting in the specific deletion of one allele of exon 7 in the liver, while the Smn^2B allele remains unaffected.

Smn^2B/- mice, the severe mouse model of SMA, express approximately 15% residual full-length SMN (FLSMN) compared to Smn^2B/+ heterozygous mice (Eshraghi et al., 2016). Therefore, both genotypes were included in this study as additional controls. Tissues were collected at postnatal day 19 (P19), corresponding to the symptomatic phase of the Smn^2B/- mouse model. At this stage, Smn^2B/- mice show increased liver steatosis and metabolic defects, ultimately culminating in multiple system defects and mortality, typically occurring around P25 (Reilly et al., 2024). In contrast, Smn^2B/+ mice have slightly reduced levels of FLSMN and no overt phenotypical changes compared to wild-type mice (Bowerman et al., 2012a).

We first assessed SMN protein levels in the liver and across CNS and peripheral tissues. Our findings confirmed a reduction in SMN protein levels across various tissues in Smn^2B/- mice (Figure 1D–H). However, in Alb^Cre/+;Smn^2B/F7, there was a~70% decrease in FLSMN protein expression in the liver (Figure 1D and D’) compared to littermate control counterparts (+/+;Smn^2B/F7). Conversely, SMN protein levels in the brain (Figure 1E and E’), muscle (Figure 1F and F’), spinal cord (Figure 1G and G’) and pancreas (Figure 1H and H’) remained unaltered, indicating that deletion of Smn exon 7 was restricted to the liver in Alb^Cre/+;Smn^2B/^F7mice. We validated these findings by assessing Cre expression in liver, pancreas, and spinal cord tissues (Figure 1—figure supplement 1A). Cre expression was exclusively observed in the liver, where it exhibited variable expression across hepatocytes, with some cells showing detectable expression while others showed no expression, confirming the stochastic nature of Cre activity in our model. No Cre signal was detected in either the pancreas or spinal cord tissues.

Alb^Cre/+;Smn^2B/F7 mice show mild yet important liver steatosis

We previously showed that Smn^2B/- mice exhibit defects in fatty acid metabolism and lipid accumulation in the liver (Deguise et al., 2019a; Deguise et al., 2021a; Deguise et al., 2019b; Deguise et al., 2021b). Additionally, SMA patients face an elevated risk of dyslipidemia and steatosis (Deguise et al., 2019a). Hence, we explored whether the intrinsic decrease in SMN levels restricted to the liver would lead to increased lipid accumulation. Histology from Alb^Cre/+;Smn^2B/F7 mice (Figure 2A) qualitatively indicates some level of hepatic microvesicular steatosis and lipid accumulation. However, there was a noticeable variation in cell morphology and Oil Red-O retention among hepatocytes, suggesting incomplete recombination.

Figure 2. — (A) Representative images of H&E (top row, scale bar 100 μm) and Oil Red-O (bottom row, scale bar 50 μm) stained liver sections from *Smn^2B/+, Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. (B) Bar graph shows quantification of liver triglycerides. (**C–E**) Immunoblots were performed to assess heme oxygenase (HO, (**C-C’**)), transferrin (**D-D’**) and P62 (**E-E’**) protein levels in the liver. α-tubulin was used as a loading control. (**C’-E’**) Bar graphs show quantification of HO (C’), transferrin (D’), and P62 (E’) levels. (F) Bar graph depicts quantification of liver IGF-1. n ≥ 3, mean ± SEM. Statistical significance indicated by *p < 0.05, **p < 0.01, ***p < 0.001, following Brown-Forsythe and Welch ANOVA.

Figure 2—source data 1. PDF file containing original western blots for Figure 2C–E, indicating the relevant bands and treatments.

elife-99141-fig2-data1.pdf^{(756.2KB, pdf)}

Figure 2—source data 2. Riginal files for western blot analysis displayed in Figure 2C–E.

elife-99141-fig2-data2.zip^{(456.3KB, zip)}

Figure 2—source data 3. Raw data for plots in Figure 2B, C’, D’, E’ and F.

elife-99141-fig2-data3.xlsx^{(10.7KB, xlsx)}

Consistent with the histological findings, Alb^Cre/+;Smn^2B/F7 mice showed variable triglycerides levels (n1=45.95, n2=10.10; n3=75.72; n4=21.91 μg/mg, mean ± SEM 38.44±14.48) (Figure 2B), and yet higher than those observed in +/+;Smn^2B/F7 controls (n1=2.60, n2=0.15; n3=0.66; n4=1.44 μg/mg, mean ± SEM 1.213±0.5332), although this difference did not reach statistical significance (p=0.0824). As expected, Smn^2B/- controls exhibited increased lipid accumulation and triglyceride levels. Taken together, the data suggest an intrinsic role of SMN in regulating fat liver metabolism.

We next sought to identify whether Alb^Cre/+;Smn^2B/F7 mice display disturbed liver homeostatic function. Specifically, we evaluated parameters associated with iron metabolism (Figure 2C, C’, D and D’), endoplasmic reticulum stress (Figure 2E and E’), and insulin-like growth factor-1 (IGF-1; Figure 2F) levels, all of which have previously been identified as altered in Smn^2B/- mice (Deguise et al., 2021b) and were further confirmed in our study. Our analysis revealed no significant differences in the protein levels of heme oxygenase, transferrin, P62, and IGF-1 between the Alb^Cre/+;Smn^2B/F7 and +/+;Smn^2B/F7 control groups. These findings suggest that liver-specific SMN depletion may not play a significant role in these pathways or that the mosaic nature of Cre-mediated excision led to a subtle effect that is difficult to detect.

Liver-specific SMN-depleted mice display pancreatic defects

We have demonstrated pancreatic and glucose abnormalities in the Smn^2B/- mouse model of SMA and type I SMA patients (Bowerman et al., 2012b; Reilly et al., 2022). Therefore, we conducted immunohistochemistry to investigate the cellular profile of the pancreas, aiming to ascertain whether the targeted depletion of SMN in the liver contributes to pancreatic dysfunction. Surprisingly, double-labeling of insulin-producing β cells and glucagon-producing α cells revealed a significant decrease in the proportion of β cells and a notable increase in α cells in the pancreas of Alb^Cre/+;Smn^2B/F7 mice compared to +/+;Smn^2B/F7 and Smn^2B/+ heterozygous controls (Figure 3A, B and F). This loss of β cells and rise in α cells could suggest a functional impairment in glucose metabolism. Consequently, we evaluated non-fasting glucose levels in these mice (Figure 3C), revealing reduced blood glucose levels in Alb^Cre/+;Smn^2B/F7 mice relative to +/+;Smn^2B/F7 and Smn^2B/+. However, blood glucose levels remained higher than those observed in Smn^2B/- mice. Overall, these findings indicate imbalances in α and β cell fate within pancreatic islets in Alb^Cre/+;Smn^2B/F7 mice, resembling those observed in Smn^2B/- mice.

Figure 3. — (A) Representative immunofluorescent images of pancreatic islets stained for glucagon (red) and insulin (green) from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. Scale bar 50 μm. (B) Bar graph shows quantification of insulin-positive cells relative to the total number of DAPI-positive cells within the pancreatic islet. (C) Bar graph depicts non-fasting blood glucose levels across different genotypes. (**D, E**) Bar graphs illustrate non-fasting plasma levels of insulin (D) and C-peptide (E). (F) Bar graph shows quantification of glucagon-positive cells relative to the total number of DAPI-positive cells within the pancreatic islet. (**G–J**) Bar graphs depict non-fasting plasma levels of glucagon (G), active GLP-1 (H), pancreatic polypeptide (I) and active amylin (J). n ≥ 3, mean ± SEM. Statistical significance indicated by *p < 0.05, **p < 0.01, ***p < 0.001, following Brown-Forsythe and Welch ANOVA.

Figure 3—source data 1. Raw data for plots in Figure 3B–J.

elife-99141-fig3-data1.xlsx^{(11.7KB, xlsx)}

In previous work, we demonstrated that Smn^2B/- mice exhibit a normoinsulinemic plasma state, despite persistent hypoglycemia and reduced C-peptide levels at P19 (Deguise et al., 2021a), findings that were recapitulated in this study (Figure 3C–E). Similarly, Alb^Cre/+;Smn^2B/F7 mice showed no significant changes in plasma insulin levels. However, surprisingly, C-peptide levels in these mice were comparable to those observed in +/+;Smn^2B/F7 and Smn^2B/+ heterozygous controls (Figure 3E). Additionally, we observed a marked increase in plasma glucagon levels (Figure 3G) as well as elevated glucagon-like peptide (GLP-1) levels, a product of proglucagon processing (Figure 3H), reaching levels similar to those seen in Smn^2B/- mice. These changes likely reflect an increase in pancreatic α-cell numbers, although they were not accompanied by dysregulation of plasma pancreatic polypeptide (PP, Figure 3I) or amylin (Figure 3J) hormone production. Furthermore, the maintenance of SMN protein expression at levels comparable to those of heterozygous controls in the pancreas (Figure 1H and H’) suggests that selective SMN depletion in the liver may be implicated in the dysfunction of the pancreas-liver axis.

Motor neurons, neuromuscular junction (NMJ) or motor fibers are unaffected in liver-specific SMN-depleted mice

The hallmark features of SMA include the degeneration of lower spinal motor neurons, neuromuscular junction (NMJ) pathology, and muscle atrophy (Bowerman et al., 2012a; Reilly et al., 2024; Deguise et al., 2016; Deguise et al., 2020; Gavrilina et al., 2008; Murray et al., 2013; Murray et al., 2015; Shababi et al., 2014; Lorson et al., 2010). While the exact mechanisms linking these changes in the motor unit to the clinical manifestations of SMA remain unclear, diminished levels of SMN protein are recognized as a pivotal factor (Lefebvre et al., 1995; Lefebvre et al., 1997; Reilly et al., 2024; Lorson et al., 2010; Hua et al., 2011; Mercuri et al., 2022). Thus, we investigated the impact of liver-specific SMN depletion on these SMA-like features. Our findings show no significant differences in motor neuron cell body counts (Figure 4A and B), neurofilament accumulation at NMJs (Figure 5A and B), NMJ endplate occupancy (Figure 5A and C), muscle fiber size (Figure 6A and B), or muscle fiber frequency distribution (Figure 6C) among Alb^Cre/+;Smn^2B/F7 and +/+;Smn^2B/F7 and Smn^2B/+ heterozygous controls. However, as anticipated, Smn^2B/- mice exhibited motor neuron loss, NMJ defects, and muscle atrophy.

Figure 4. — (A) Representative images of lumbar spinal cord anterior horns stained for ChAT (red) and DAPI (blue) from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. (B) Bar graph shows quantification of motor neuron cell body numbers. n ≥ 3, mean ± SEM. Statistical significance indicated by **p < 0.01, ***p < 0.001, following Brown-Forsythe and Welch ANOVA. Scale bar = 50 μm.

Figure 4—source data 1. Raw data for motor neuron counts in the plots in Figure 4B.

elife-99141-fig4-data1.xlsx^{(9.7KB, xlsx)}

Figure 5. — (A) Representative images of *transversus abdominis* (TVA) muscle stained with bungarotoxin (red), neurofilament (NF) (green) and synaptic vesicle protein 2 (green) from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. *Depicts occupied endplate, whereas **depicts normal neurofilament distribution; arrowheads show NF accumulation and arrows show unoccupied endplate/denervation. (**B, C**) Bar graphs show quantification of neurofilament accumulation (B) and endplate occupancy (C). n = 3, mean ± SEM. Statistical significance indicated by **p < 0.01, ***p < 0.001, following Brown-Forsythe and Welch ANOVA. Scale bar = 50 μm.

Figure 5—source data 1. Raw data for plots in Figure 5B and C.

elife-99141-fig5-data1.xlsx^{(9.9KB, xlsx)}

Figure 6. — (A) Representative images of H&E-stained *tibialis anterior* muscle sections from *Smn^2B/+*, *Smn^2B/-*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P19. (B) Bar graph shows quantification of muscle fiber cross-sectional area. C. Graph demonstrating frequency of muscle fiber size across different genotypes. n ≥ 3, mean ± SEM. Statistical significance indicated by **p < 0.01, following Brown-Forsythe and Welch ANOVA. Scale bar = 20 μm.

Figure 6—source data 1. Raw data for plots in Figure 6B and C.

elife-99141-fig6-data1.xlsx^{(23.5KB, xlsx)}

Liver-specific SMN-depleted mice show transitory liver and pancreatic pathology

We next assessed Alb^Cre/+;Smn^2B/F7 mice at P60 to determine whether liver and pancreatic dysfunction persisted or improved during early adulthood. Histological analysis revealed no significant changes in hepatocyte morphology (as assessed by H&E staining) or lipid accumulation (evaluated with Oil Red O staining) in Alb^Cre/+;Smn^2B/F7 mice at this time point (Figure 7A). These findings suggest that proliferating non-recombined cells may help restore liver homeostasis over time. Notably, the expression of Cre recombinase was also observed at P60 (Figure 1—figure supplement 1B), indicating stable Cre activity across postnatal development.

Figure 7. — (A) Representative images of H&E (top row) and Oil Red-O (bottom row) stained liver sections from *Smn^2B/+*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7* mice at P60. Scale bar 100 μm. (B) Representative immunofluorescent images of pancreatic islets stained for glucagon (red) and insulin (green) from *Smn^2B/+*, *+/+;Smn^2B/F7*, and *Alb^Cre/+;Smn^2B/F7*mice at P60. Scale bar 50 μm. (C) Bar graph shows the quantification of insulin-positive cells relative to the total number of DAPI-positive cells within the pancreatic islet. (D) Bar graph depicts non-fasting blood glucose levels from P60 mice across different genotypes. (**E, F**) Bar graphs illustrate non-fasting plasma levels of insulin (E) and C-peptide (F). (G) Bar graph shows quantification of glucagon-positive cells relative to the total number of DAPI-positive cells within the pancreatic islet. (**H–K**) Bar graphs depict non-fasting plasma levels of glucagon (H), active GLP-1 (I), pancreatic polypeptide (J) and active amylin (K). n ≥ 3, mean ± SEM. Samples were analyzed using Brown-Forsythe and Welch ANOVA, and no statistically significant differences were observed.

Figure 7—source data 1. Raw data for plots in Figure 7C–K.

elife-99141-fig7-data1.xlsx^{(11.6KB, xlsx)}

Further examination of pancreatic tissue at P60 showed no significant differences in insulin-producing β cells or glucagon-producing α cells in Alb^Cre/+;Smn^2B/F7 mice compared to +/+;Smn^2B/F7 and Smn^2B/+ heterozygous controls (Figure 7B, C and G). Additionally, non-fasting plasma glucose, insulin, and C-peptide levels in Alb^Cre/+;Smn^2B/F7 mice were similar to those in the control groups (Figure 7D–F). Moreover, no significant changes in plasma glucagon (Figure 7H), GLP-1 (Figure 7I), pancreatic polypeptide (Figure 7J), or amylin hormone production were observed. Collectively, these results suggest that the liver and pancreatic defects observed in Alb^Cre/+;Smn^2B/F7 mice may be transient, potentially linked to the stochastic nature of Cre recombinase activity in our model and the highly proliferative properties of hepatocytes. In addition, these findings suggest that liver-specific SMN may play a role in regulating pancreatic function, a mechanism that warrants further investigation.

Liver-specific SMN depletion does not affect major adipocyte and gastrointestinal hormones

Gastrointestinal (GI) hormones play a key role in regulating hepatic lipid metabolism and pancreatic function (Mells and Anania, 2013). Thus, to assess whether adipocytes and GI hormones contribute to liver and pancreatic dysfunction in liver-specific SMN-depleted mice, we measured plasma levels of major adipocyte hormones (leptin and resistin) and GI hormones (ghrelin, gastric inhibitory polypeptide (GIP), peptide YY (PYY) and secretin) at P19 and P60 (Mells and Anania, 2013; Chen et al., 2021). Our data revealed no significant changes in adipocyte hormones at either time point (Figure 8A–B and G–H) across all genotypes. Moreover, few alterations in GI hormones (Figure 8C–F, I–L) were observed exclusively in Smn^2B/- mice at P19, including a marked reduction of ghrelin (Figure 8C) – a hormone involved in glucose homeostasis in pancreatic islet and liver (Dong and Brubaker, 2012) – and secretin (Figure 8F), which regulates secretory activity in organs such as the liver and pancreas (Afroze et al., 2013). Notably, no such changes were observed in Alb^Cre/+;Smn^2B/F at any time point. Altogether, these results suggest that the pancreatic and liver changes at P19 are likely independent of major adipocyte and GI hormone alterations, pointing to a more direct disruption of the liver-pancreas axis in liver-specific SMN-depleted mice.

Panels A-B and G-H show bar graphs depicting non-fasting plasma levels of adipocyte-secreted hormones leptin (**A, G**) and resistin (**B, H**) in P19 (**A–B**) and P60 (**G–H**) mice across different genotypes. Panels C-F and I-L illustrate non-fasting plasma levels of gastrointestinal-secreted hormones, including ghrelin (**C, I**), gastric inhibitory polypeptide (**D, J**), peptide YY (**E, K**), and secretin (**F, L**) in P19 (**C–F**) and P60 (**I–L**) mice. n ≥ 3, mean ± SEM. Statistical significance is indicated by *p < 0.05, **p < 0.01, following Brown-Forsythe and Welch ANOVA.

Figure 8—source data 1. Raw data for plots in Figure 8.

elife-99141-fig8-data1.xlsx^{(12.1KB, xlsx)}

Liver-specific SMN-depleted mice have normal survival rates and motor function

We also conducted a comprehensive assessment of survival, weight, and motor function in Alb^Cre/+;Smn^2B/F7 and +/+;Smn^2B/F7 mice up to postnatal day 60 (Figure 9A). While the Smn^2B/− mice typically have a mean survival of 25 days (Reilly et al., 2024), both Alb^Cre/+;Smn^2B/F7 and +/+;Smn^2B/F7 mice in our study survived up to 60 days (Figure 9B), after which they were euthanized for tissue collection. Moreover, throughout the observation period, mice from both groups exhibited similar weight gain trends (Figure 9C). When weight gain at P60 was normalized to the basal weight at P7, no statistically significant differences were observed (Figure 9D).

Figure 9. — (A) Schematic representation of experimental design. The righting reflex test was conducted from P7 to P13, the inverted mesh grip test from P13 to P25, and the pen test from P19 to P25. Assessments were performed every 2 days. Weight was measured every 2 days until day 30, and then weekly until day 60. Animal welfare was monitored throughout the 60-day period during weight measurements. (B) Kaplan–Meier survival curve comparing *Alb^Cre/+;Smn^2B/F7* and *+/+;Smn^2B/F7* mice up to 60 days. (**C, E-G**) Graphs show weight (C), righting reflex (E), inverted mesh grip (F) and pen test (G). n=5 per genotype, mean ± SEM. (B) Kaplan–Meier survival analysis; (**C, E-G**) two-way ANOVA, followed by Šídák’s method. (D) Percentage weight gain at P60, normalized to basal weight at P7. n=5 per genotype, mean ± SEM, two-tailed unpaired Student’s t-test.

Figure 9—source data 1. Raw data for plots in Figure 9B–G.

elife-99141-fig9-data1.xlsx^{(12.2KB, xlsx)}

To further evaluate motor function at different stages, we implemented several age-specific behavioral tests commonly used to assess motor function (Chehade et al., 2022; Figure 9E–G). We previously showed Smn^2B/- mice have reduced motor function scores, as seen through increased time to right, prolonged balancing time and diminished muscle strength (Reilly et al., 2022). Here, we found no alterations in Alb^Cre/+;Smn^2B/F7 compared to +/+;Smn^2B/F7 mice in time to right, as assessed by the righting reflex (Figure 9E), nor in distal muscle strength measured through the inverted mesh grip test (Figure 9F), or motor balance and coordination evaluated by the pen test (Figure 9G). Overall, these findings collectively demonstrate that liver-specific SMN depletion does not impact survival, weight gain, or motor function.

Discussion

The liver is pivotal in regulating numerous biological functions in the body. These encompass, among others, the storage and balance of lipids, carbohydrates, and iron, as well as the synthesis of vital growth factors and the clearance of non-essential or harmful metabolites (Trefts et al., 2017). Given its multifaceted role, any alterations in liver function can potentially have cascading effects on other organs within the body. Hence, aside from elucidating the impact of liver-specific SMN depletion on hepatic function, it is imperative to explore its effects on other tissues, as alterations in these tissues have been documented in various mouse models of SMA (Bowerman et al., 2012b; Deguise et al., 2021b; Hua et al., 2011; Hua et al., 2015).

Previous work on conditional knockout of Smn1 in the livers of mice resulted in severe impairment of liver development characterized by iron overload and subsequent liver atrophy, ultimately leading to late embryonic lethality (Vitte et al., 2004). In our study, we generated a novel mouse model where instead of a complete knockout of Smn1 in the liver, we created a scenario where SMN protein was depleted to 30% of full-length SMN production specifically within the liver, while SMN protein levels in other tissues remain comparable to those of heterozygous controls. Notably, this mouse line did not exhibit any signs of developmental delays, liver atrophy, or reduced lifespan. Nonetheless, within 19 days after birth, Alb^Cre/+;Smn^2B/F7 mice showed a mild yet rapid onset of fatty liver disease and trends towards an increase in lipid levels when maintained on a normal chow diet, underscoring the importance of SMN in lipid metabolism. Interestingly, these changes were transient, as by P60, liver-specific SMN-depleted mice displayed no lipid accumulation or hepatocyte morphological changes, likely due to the compensatory proliferation of non-recombined cells.

A recent study found that 75% of pediatric and adult SMA patients showed ultrasonic evidence of mild to moderate hepatic steatosis, independent of disease severity or SMA subtype (Leow et al., 2024). In an in vitro model using SMA patient-derived induced pluripotent stem cell-derived hepatocyte-like cells (iHeps), a 10-fold increase in lipid accumulation was observed, correlating with reduced SMN protein expression. Proteomic and transcriptomic analyses revealed dysregulation in mitochondrial and lipid metabolism pathways, including downregulation of key genes involved in oxidative phosphorylation and fatty acid oxidation, alongside increased lipid biosynthesis. Notably, repletion of SMN in SMA iHeps restored metabolic and hepatic functions, rescuing steatosis and mitochondrial defects (Leow et al., 2024). Excitingly, our current work further supports these findings, demonstrating that treatment with an adeno-associated viral vector carrying a liver-specific albumin promoter in Smn^2B/- mice resulted in partial restoration of liver SMN levels, improving survival, alleviating liver pathology, and restoring muscle size and pancreatic cell balance (Sutton et al., 2024). Additionally, a recent study found that 60.8% of adult SMA type 3 patients (23 patients) exhibited at least one lipid abnormality (Miletić et al., 2024), further supporting the hypothesis that hepatocyte-specific SMN deficiency contributes to liver pathology.

Mild liver steatosis may be accompanied by disruptions in crucial liver function markers, notably those implicated in iron metabolism, autophagy, and growth factor regulation, such as IGF-1 (Deguise et al., 2021a). Accordingly, we initially investigated the expression of HO-1, an enzyme responsible for heme degradation into iron, carbon monoxide, and biliverdin; and transferrin, a liver-synthesized glycoprotein involved in iron transport across tissues (reviewed in Muckenthaler et al., 2017). Prior studies have documented alterations in these proteins in Smn^2B/- mouse livers (Deguise et al., 2021b). While our current analysis did not reveal significant differences in Alb^Cre/+;Smn^2B/F7 mice, the observed upward trend in transferrin and HO levels suggests ongoing changes in iron metabolism, which may not be fully manifested at P19. In addition, incomplete Cre-mediated excision of Smn^F7 allele may be hindering a comprehensive understanding of SMN’s role in liver function.

Furthermore, no alterations were observed for P62 levels, a multifunctional scaffold protein implicated in autophagy, formation of hepatic inclusion bodies, and hepatocyte cell death (reviewed in Manley et al., 2013) despite its increased presence in mouse models of SMA (Deguise et al., 2021b). Similarly, there were no changes detected in IGF-1 protein levels, whose deficiency has been linked to liver pathology and non-alcoholic fatty liver disease (NAFLD; Hribal et al., 2013; Ichikawa et al., 2007), and its decrease is evident in Smn^2B/- mice (Deguise et al., 2021b). NAFLD involves the accumulation of fatty acids in more than 5% of liver cells, occurring in the absence of alcohol consumption. This condition presents with varying degrees of severity, with simple steatosis being the most common manifestation. Simple steatosis is characterized by the accumulation of fat in the liver with minimal impact on liver function (Loomba and Sanyal, 2013; Tandra et al., 2011). Consequently, our model holds promise as a valuable resource for investigating microvesicular steatohepatitis and NAFLD during the early postnatal period. Additionally, unlike the well-studied Smn^2B/- model of SMA, this liver-specific SMN depletion enables the study of hepatic SMN function without the confounding effects of systemic SMN depletion or the severe phenotype observed in the Smn^2B/- mice.

Previously, our research unveiled metabolic abnormalities in SMA-like mice, including glucose intolerance, insulin hypersensitivity, and hyperglucagonemia, accompanied by changes in pancreatic islet composition characterized by an increase in glucagon-producing α-cells at the expense of insulin-producing β-cells (Bowerman et al., 2012b). Histopathological examination of pancreatic tissue from infants and children with SMA type I corroborated these findings, revealing a predominant presence of glucagon-producing α-cells within pancreatic islets (Bowerman et al., 2012b). Furthermore, one-year-old Smn1^+/- +/- producing approximately 50% of SMN protein, when exposed to a high-fat diet, exhibited dysregulation in the proportion of glucagon-producing α-cells within pancreatic islets and heightened hepatic insulin and glucagon sensitivity (Bowerman et al., 2014).

Here, we uncovered a novel intrinsic role of liver-specific SMN in pancreatic function, distinct from IGF-1 signaling, pancreatic SMN levels (which remained stable), or canonical SMA pathology. Although the precise role of SMN in the liver-pancreas axis remains unclear, we speculate that altered amino acid metabolism may contribute to the disrupted communication between these two organs. The liver plays a central role in amino acid metabolism, and disturbances in this process can affect the liver-α cell axis, a well-documented feedback loop in which circulating amino acids stimulate glucagon secretion, which in turn regulates hepatic amino acid uptake and metabolism (Richter et al., 2022). In the context of metabolic diseases such as NAFLD and SMA, liver dysfunction, including impaired lipid metabolism, may disrupt this axis, leading to abnormal glucagon secretion (Richter et al., 2022; Deng et al., 2024). It is possible that dysregulated amino acid pathways may directly influence this feedback loop.

Further evidence for this hypothesis comes from a recent study in individuals with type 2 diabetes (T2D) and NAFLD, which found hyperglucagonaemia and altered amino acid profiles. In T2D-NAFLD patients, plasma glucagon levels were significantly higher than in individuals without NAFLD, with a positive correlation between plasma glucagon concentrations and liver fat content. This study also showed increased plasma levels of isoleucine and glutamate, and decreased levels of glycine and serine in individuals with NAFLD (Rix et al., 2024). These findings suggest that metabolic dysregulation in the liver, including alterations in amino acid metabolism, may exacerbate glucagon secretion. Interestingly, such changes in amino acid metabolism are consistent with clinical observations in SMA patients, where an ‘amino acid diet’ — low in fats and rich in specific amino acids — has been shown to provide some clinical benefit (O’Connor et al., 2023). Given this, it is plausible that impaired liver metabolism in SMN-depleted mice alters the liver-α cell axis, leading to dysregulated glucagon and GLP-1 secretion. While this proposed link between liver steatosis, amino acid metabolism, and pancreatic dysfunction is speculative, we are actively investigating the mechanisms underlying this liver-pancreas interplay in mouse models of SMA.

In addition, while the hallmark pathological features of SMA include motor neuron loss, NMJ pathology, muscle atrophy, and consequent motor function alterations, these were not evident in the Alb^Cre/+;Smn^2B/F7 mouse model at P19. However, given that glucose metabolism defects are observed in various neurodegenerative and neuromuscular disorders, subsequent work is required to clarify the impact of liver-specific SMN depletion on pancreatic function. Although hepatic and pancreatic abnormalities likely occur independently of disease onset, given that SMN depletion in motor neurons and muscle alone is sufficient to induce an SMA-like phenotype (Frugier et al., 2000; Cifuentes-Diaz et al., 2001; Cifuentes-Diaz et al., 2002), the potential influence of these anomalies on SMA progression warrants careful consideration.

Overall, our findings suggest that alterations in SMN production solely within the liver may suffice to induce pathological hepatic and pancreatic function, shedding light on a novel role of SMN in liver physiology.

Materials and methods

Mouse models

The Smn^2B mouse, which harbors the Smn^2B mutation resulting from the substitution of three nucleotides within the exon splicing enhancer of exon 7, was developed and maintained on a C57BL/6 background in our laboratory (Bowerman et al., 2012a; Eshraghi et al., 2016). The FVB.129(B6)-Smn1^tm1Jme (Smn^F7/F7) (RRID:IMSR_JAX:006138) and B6.Cg-Speer6-ps1^{Tg(Alb-Cre)21Mgn}/J (Alb^Cre) (RRID:IMSR_JAX:003574) mice were acquired from The Jackson Laboratory. Liver-specific SMN-depleted mice were obtained through successive crosses between Alb^Cre/+;Smn^F7/+ and Smn^2B/F7 mice (see Figure 1). Line validation was conducted via genotyping of DNA extracted from mouse ear biopsies using PCR (see Table 1 for list of primers used). Both male and female mice were included in the studies. All mice were bred and housed in the University of Ottawa Animal Facility under protocol OHRI-3343, adhering to guidelines established by the Canadian Council on Animal Care. Additionally, we employed Smn^2B/- mice (a severe SMA mouse model) and asymptomatic heterozygous Smn^2B/+ mice as controls in our experiments.

Table 1. List of primers used for genotyping.

Name	Sequence (5'–3')
Alb-Cre	TGCAAACATCACATGCACAC
	TTGGCCCCTTACCATAACTG
	GAAGCAGAAGCTTAGGAAGATGG
SmnF7	AGAAGGAAAGTGCTCACATACAAATT
SmnF7	TGTCTATAATCCTCATGCTATGGAG
Smn2B	GGTTTCAGACAAAATAAAAAAGAATTTAAG
Smn2B	TTTGGCAGACTTTAGCAGGGC

Open in a new tab

Tissue harvesting and processing

Following euthanasia, liver, and tibialis anterior (TA) muscles underwent fixation in a 1:10 dilution of buffered formalin for 48 hr at 4 °C, followed by transfer to 70% ethanol at the same temperature until processing. The pancreas was fixed in 4% paraformaldehyde (PFA) for 48 hr at 4 °C, then similarly moved to 70% ethanol for processing. For the lumbar spinal cord (SC) and liver (for Oil Red-O staining), fixation was performed overnight at 4 °C in 4% PFA, followed by immersion in 30% sucrose in PBS. Subsequently, the liver and spinal cord were flash-frozen in optimal cutting temperature (OCT) embedding medium. Cryosections of the lumbar spinal cord were cut at a thickness of 16 μm, while liver sections were cut at 10 μm and stored at –80 °C until immunohistochemical analysis. Cre immunostaining of cryosectioned liver and spinal cord was performed as described in section 4.4.1, with the exception that the antigen retrieval step was not performed.

The abdominal musculature was dissected and fixed in 4% PFA for 15 min at room temperature, followed by 3 washes in 1 X PBS, after which the transversus abdominis (TVA) muscle was dissected from the abdominal musculature. TA, liver, and pancreas samples were handled at the University of Ottawa Department of Pathology and Laboratory Medicine. Paraffin blocks containing tissues were sectioned at 4 μm thickness using a microtome. Sections of TA and liver were stained with hematoxylin and eosin (H&E) using an XL CV5030 autostainer from Leica. Liver cryosections were stained with Oil Red-O and counterstained with hematoxylin using established protocols. Images of H&E and Oil Red-O-stained samples were scanned with a MIRAX MIDI digital slide scanner manufactured by Zeiss. Image acquisition was performed using Panoramic Viewer 1.15.4 software.

Immunoblotting

Total protein was extracted by homogenizing flash-frozen samples of spinal cord, brain, liver, pancreas and hindlimb muscles using RIPA lysis buffer (Cell Signaling), supplemented with phenylmethylsulfonyl fluoride (PMSF, Cell Signaling). The concentrations of the extracted proteins were determined using the Pierce BCA Protein Assay kit (ThermoFisher).

For liver, brain, and spinal cord tissues, 20 μg of protein per sample were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), while 30 μg were used for pancreas and muscle samples. Following electrophoresis, the proteins were transferred onto a PVDF membrane (Immobilon-P, Millipore) and blocked for 30 min at room temperature using intercept blocking buffer (LI-COR). Subsequently, the membranes were incubated overnight at 4 °C with primary antibodies.

After incubation, the membranes were rinsed with tris-buffered saline containing 0.1% Tween-20 (TBS-T) and then incubated for 1 hr at room temperature with IRDye 680 R or 800CW (LI-COR) secondary antibody. Fluorescent signals were detected using the Odyssey Infrared Imaging System (LI-COR). Total raw values were normalized to α-tubulin (housekeeping protein) obtained from the same blot.

Immunohistochemistry

Pancreas

Pancreatic sections underwent deparaffinization using three washes of Histo-Clear (National Diagnostics, Atlanta, GA) for 5 min each, followed by two washes of a 50/50 mixture of absolute ethanol and Histo-Clear for 3 min each. Subsequently, the slides were gradually rehydrated in two washes of 100% (v/v) ethanol (3 min each), followed by one wash of 95% (v/v), 70% (v/v), 50% (v/v), and 0% (v/v) ethanol for 3 min each. The slides were then incubated in 0.5% Triton-X-100 (Millipore Sigma, Burlington, MA) in PBS for 5 min, followed by three washes with PBS. Afterward, the slides were blocked in a solution containing 20% goat serum and 0.3% Triton-X-100 in TBS for 2 hr.

Primary antibodies targeting insulin, glucagon or Cre (Table 2) were applied to the slides in a solution containing 2% goat serum and 0.3% Triton-X-100 in TBS overnight at 4 °C. The slides were then washed three times with PBS and subsequently incubated with secondary antibodies in a solution containing 2% goat serum and 0.3% Triton-X-100 for 1 hr. Following this, the solution was removed, and DAPI (1:1000) in PBS was added for 5 min at room temperature. The slides were washed three times with PBS and mounted in Fluoromount-G Mounting Medium (Invitrogen).

Table 2. List of antibodies used.

Application	Antibody	Species	Dilution	Company (Catalog #)
Western Blot	SMN	Mouse	1:2 500	BD Transduction (610647)
Western Blot	Alpha-tubulin	Rabbit	1:10 000	Abcam (ab4074)
Western Blot	Alpha-tubulin	Mouse	1:10 000	Sigma-Aldrich (CP06)
Western Blot	Heme oxygenase-1 (HO)	Rabbit	1:10 000	Abcam (ab68477)
Western Blot	P62	Mouse	1:1 000	Abcam (ab56416)
Western Blot	Transferrin	Rabbit	1:1 000	Abcam (ab82411)
Western Blot	Goat anti-mouse IR Dye 800 CW		1:5 000	LI-COR (925–32210)
Western Blot	Goat anti-mouse IR Dye 680 R		1:5 000	LI-COR (926–68070)
Western Blot	Goat anti-rabbit IR Dye 800 CW		1:5 000	LI-COR (925–32211)
Western Blot	Goat anti-rabbit IR Dye 680 R		1:5 000	LI-COR (926–68071)
IHC	ChAT	Goat	1:100	Millipore (AB144P)
IHC	Donkey anti-goat Alexa Fluor 555		1:200	Invitrogen (A21432)
IHC	TRITC conjugated bungarotoxin	N/A	1:1 000	Invitrogen (T1175)
IHC	Neurofilament (NF-M)	Mouse	1:100	(Developmental Studies Hybridoma Bank, P12839)
IHC	Synaptic vesicle glycoprotein 2 A (SV2A)	Mouse	1:250	(Developmental Studies Hybridoma Bank, Q7L0J3)
IHC	Goat anti-mouse Alexa Fluor 488		1:250	Invitrogen (A11001)
IHC	Glucagon	Mouse	1:200	Abcam (ab10988)
IHC (Parafin) IHC (Frozen)	Cre Recombinase (D7L7L)	Rabbit	1:500 1:200	Cell Signaling (15036)
IHC	Insulin	Rabbit	1:50	Abcam (ab181547)
IHC	Goat anti-mouse Alexa Fluor 555		1:500	Invitrogen (A21422)
IHC	Goat anti-rabbit Alexa Fluor 488		1:500	Invitrogen (A11034)

Open in a new tab

Images were taken using an Axio Imager M2 microscope (Zeiss) and captured with a 40 X objective. The number of glucagon and insulin-positive cells per islet was counted for each mouse. Analysis was blinded where possible.

Motor neurons

Lumbar spinal cord sections were prepared for choline acetyltransferase (ChAT) staining of motor neurons. The slides were air-dried at room temperature for 30 min and then rinsed in TBS-T for 5 min. Samples were permeabilized in 0.3% Triton X-100 in PBS for 30 min, followed by blocking in 1 x Power Block (BioGenex, Fremont, CA) for 20 min at room temperature. Subsequently, the samples were incubated with a goat anti-ChAT (details in Table 2) antibody at a dilution of 1:100 in 1% BSA and 0.3% Triton X-100 in PBS for 3 nights at 4 °C.

After the initial antibody incubation, slides were washed twice for 10 min with TBS-T at room temperature. Following the washes, samples were then incubated with Alexa Fluor 555 donkey anti-goat IgG at a dilution of 1:200 in 10% donkey serum and 0.3% Triton X-100 in PBS for 2 hr at room temperature in a humid chamber. Nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI) at a dilution of 1:1000 in PBS for 5 min.

Finally, the slides were rinsed 3 X for 10 min with TBS-T and mounted with Fluoromount-G Mounting Medium (Invitrogen). Spinal cord sections were examined under fluorescence using an Axio Imager M2 microscope (Zeiss) and imaged at ×20 magnification for quantification, and at ×63 for representative pictures. The number of ChAT-positive motor neurons with a diameter of ≥20 μm per ventral horn was recorded for 7–10 different sections per animal, each separated by at least 100 μm to prevent re-counting of the same motor neuron. An average number of motor neuron cell bodies per section was determined. Analysis was blinded where possible.

Neuromuscular junction (NMJ)

To evaluate neuromuscular innervation, we performed immunohistochemistry using established protocols (Reilly et al., 2022). After euthanasia, the TVA muscles were promptly dissected and fixed in 4% paraformaldehyde (Electron Microscopy Science) in PBS for 15 min. Post-synaptic acetylcholine receptors (AChRs) were labeled for 10 min with alpha-bungarotoxin (aBTX) conjugated to Alexa Fluor 488. Subsequently, the muscles were blocked in 4% bovine serum albumin (BSA) and 1% Triton-X-100 in PBS for 30 min.

Following blocking, the muscles underwent overnight incubation with primary antibodies for neurofilament and synaptic vesicle protein 2 (refer to Table 2). Visualization of the labeled structures was achieved using DyLight-conjugated secondary antibodies. The muscles were then whole-mounted in Dako Fluorescent mounting media and imaged with a 20 x objective on a Zeiss Axio Imager M1 microscope.

A minimum of three fields of view (FOV) were quantified per muscle. For each FOV, the percentage of fully occupied endplates was noted. Fully occupied endplates were defined as motor endplates completely covered by the presynaptic terminal labeled with synaptic vesicle protein 2 (SV2) and neurofilament (NF). Analysis was blinded where possible.

Muscle fiber analysis

Muscle fiber analysis was performed using ImageJ software (version 2.9.0/1.53t). A total of one hundred fibers were evaluated per animal, covering various regions of the muscle section to ensure good representation. The area of each fiber was measured in square micrometers (μm²) to compute both the average and distribution of fiber sizes for each animal.

Glucose levels

Non-fasting blood glucose concentrations were assessed using a OneTouch Ultra2 Blood Glucose Test Strips (LifeScan Europe GmbH, Zug, Switzerland) immediately following blood collection. Approximately 2 μL of blood was applied to the test strip for glucose concentration measurement.

ELISA for insulin-like growth factor I (IGF-1)

The concentration of IGF-1 in the liver was quantified using the Mouse/Rat IGF-I/IGF1 Quantikine ELISA Kit (MG100, R&D Systems, Inc, Minneapolis, MN, USA). Liver protein lysates were diluted at a ratio of 1:6 in calibrator diluent and the assay was performed following the manufacturer’s instructions.

Triglycerides quantification

Liver tissues from P19 mice were promptly dissected and flash frozen. Subsequently, triglyceride analysis was conducted at the Vanderbilt Mouse Metabolic Phenotyping Center, employing established protocols previously utilized by our team (Deguise et al., 2021b).

Mouse metabolic hormone assay

Blood was collected from the mice immediately after decapitation using a Microcuvette CB 300 K2E coated with K2 EDTA (16.444.100) for capillary sampling. All samples were taken randomly without a fasting period. The blood was centrifuged at 5000 × g for 5 min at room temperature to separate the plasma. For plasma volumes less than 50 µL, genotypes were pooled to achieve a minimum volume of 50 µL as needed. The multiplexing analysis was performed using the Luminex 200 system (Luminex, Austin, TX, USA) by Eve Technologies Corp. (Calgary, Alberta). Twelve markers were simultaneously measured in the samples using Eve Technologies' Mouse Metabolic Hormone 12-Plex Discovery Assay (MilliporeSigma, Burlington, Massachusetts, USA) according to the manufacturer’s protocol. The 12-plex consisted of Amylin(active), C-Peptide 2, Ghrelin, GIP(total), GLP-1(active), Glucagon, Insulin, Leptin, PP, PYY, Resistin and Secretin. Assay sensitivities of these markers range from 1.4 to 91.8 pg/mL for the 12-plex. Individual analyte sensitivity values are available in the MilliporeSigma MILLIPLEX MAP protocol. If analyte levels were too low to be detected and fell outside the dynamic range, they were recorded as 0 in the graphs.

Motor function, weight, and survival assessments

Motor function, weight, and survival were assessed according to established protocols (Chehade et al., 2022). Spinal reflexes were evaluated using the righting reflex test, while motor balance and coordination were evaluated with the pen test. Additionally, muscle strength was measured using the inverted mesh grip test (see Figure 9A). The righting reflex test was conducted from P7 to P13, the inverted mesh grip test from P13 to P25, and the pen test from P19 to P25. Assessments were performed every 2 days. A maximum duration of 30 s for the pen test and 60 s for the inverted mesh grip represented the established threshold. Three consecutive measurements were obtained, and their average was recorded for subsequent analysis. Weight was measured every 2 days starting at day 7 until day 30, and then weekly until day 60. Animal welfare was monitored throughout the 60-day period during weight measurements.

Statistical analysis

Survival data were visualized using Kaplan-Meier survival curves, and intergroup differences were evaluated using the Mantel-Cox test. Brown-Forsythe and Welch ANOVA were employed to compare three or more sets of unpaired measurements, given the mosaic-like outcome observed in the Alb^Cre/+;Smn^2B/F7 model, where assumptions of equal variances were not tenable. Two-way ANOVA, followed by Šídák’s method for multiple comparisons, was utilized to assess the influence of two factors on a response. Pairwise comparisons were performed using a two-tailed Student’s t-test. Statistical analyses were conducted using GraphPad Prism V.10.2.1 (GraphPad Prism Software, San Diego, CA), with significance set at p<0.05. Data were presented as mean ± standard error of the mean. Sample sizes (n) are provided in figure legends, indicating the number of biological replicates analyzed, with each data point corresponding to an individual mouse from at least two different litters. Detailed statistical information is outlined in the respective figure legends, where statistical significance is indicated by *, p<0.05; **, p<0.01; ***, p<0.001.

Data sharing

All authors had access to the study data and reviewed and approved the final manuscript. All data associated with this study are available in the main text or supplementary materials. Imaging data used in this manuscript have been deposited at the BioImage Archive repository under Accession S-BIAD1633.

Acknowledgements

This work was supported by Muscular Dystrophy Association (USA) [grant number 963652 to RK]; the Canadian Institutes of Health Research [grant number PJT-186300 to RK]; and the University of Ottawa Brain and Mind Institute TRIMS Award to MMAA.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Rashmi Kothary, Email: rkothary@ohri.ca.

Pramod K Mistry, Yale University, United States.

Funding Information

This paper was supported by the following grants:

Muscular Dystrophy Association 10.55762/pc.gr.157042 to Rashmi Kothary.
Canadian Institutes of Health Research PJT-186300 to Rashmi Kothary.
University of Ottawa Brain and Mind Institute TRIMS Award to Monique Marylin Alves de Almeida.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing.

Investigation, Methodology.

Formal analysis, Investigation, Visualization, Methodology.

Conceptualization, Supervision, Funding acquisition, Project administration, Writing – review and editing.

Ethics

All mice were bred and housed in the University of Ottawa Animal Facility under protocol OHRI-3343, adhering to guidelines established by the Canadian Council on Animal Care.

Additional files

MDAR checklist

elife-99141-mdarchecklist1.pdf^{(208.3KB, pdf)}

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files; source data files have been provided for Figures 1 and 2 (both are for the immunoblots). Note that this study did not have any numerical source data. Figure 1—source data 1 and Figure 2—source data 1 contain the original blots data used to generate the western blot images in the figures. In addition, source data for Figures 1—9 in the form of Excel files have been provided. These contain the raw data used to generate the plots/graphs in the manuscript. All images used to generate the figures (Figures 2—7) have been deposited at the BioImage Archive repository under accession S-BIAD1633.

The following dataset was generated:

Kothary R. 2025. Image data accompanying the paper "Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology". BioImage Archive.

References

Afroze S, Meng F, Jensen K, McDaniel K, Rahal K, Onori P, Gaudio E, Alpini G, Glaser SS. The physiological roles of secretin and its receptor. Annals of Translational Medicine. 2013;1:29. doi: 10.3978/j.issn.2305-5839.2012.12.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bowerman M, Murray LM, Beauvais A, Pinheiro B, Kothary R. A critical smn threshold in mice dictates onset of an intermediate spinal muscular atrophy phenotype associated with A distinct neuromuscular junction pathology. Neuromuscular Disorders. 2012a;22:263–276. doi: 10.1016/j.nmd.2011.09.007. [DOI] [PubMed] [Google Scholar]
Bowerman M, Swoboda KJ, Michalski JP, Wang GS, Reeks C, Beauvais A, Murphy K, Woulfe J, Screaton RA, Scott FW, Kothary R. Glucose metabolism and pancreatic defects in spinal muscular atrophy. Annals of Neurology. 2012b;72:256–268. doi: 10.1002/ana.23582. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bowerman M, Michalski JP, Beauvais A, Murray LM, DeRepentigny Y, Kothary R. Defects in pancreatic development and glucose metabolism in SMN-depleted mice independent of canonical spinal muscular atrophy neuromuscular pathology. Human Molecular Genetics. 2014;23:3432–3444. doi: 10.1093/hmg/ddu052. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chehade L, Deguise MO, De Repentigny Y, Yaworski R, Beauvais A, Gagnon S, Hensel N, Kothary R. Suppression of the necroptotic cell death pathways improves survival in Smn2B/− mice. Frontiers in Cellular Neuroscience. 2022;16:972029. doi: 10.3389/fncel.2022.972029. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen L, Wu N, Kennedy L, Francis H, Ceci L, Zhou T, Samala N, Kyritsi K, Wu C, Sybenga A, Ekser B, Dar W, Atkins C, Meadows V, Glaser S, Alpini G. Inhibition of secretin/secretin receptor axis ameliorates NAFLD phenotypes. Hepatology. 2021;74:1845–1863. doi: 10.1002/hep.31871. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chiriboga CA. Nusinersen for the treatment of spinal muscular atrophy. Expert Review of Neurotherapeutics. 2017;17:955–962. doi: 10.1080/14737175.2017.1364159. [DOI] [PubMed] [Google Scholar]
Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacène E, Roblot N, Joshi V, Moreau MH, Melki J. Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. The Journal of Cell Biology. 2001;152:1107–1114. doi: 10.1083/jcb.152.5.1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cifuentes-Diaz C, Nicole S, Velasco ME, Borra-Cebrian C, Panozzo C, Frugier T, Millet G, Roblot N, Joshi V, Melki J. Neurofilament accumulation at the motor endplate and lack of axonal sprouting in a spinal muscular atrophy mouse model. Human Molecular Genetics. 2002;11:1439–1447. doi: 10.1093/hmg/11.12.1439. [DOI] [PubMed] [Google Scholar]
Crawford TO, Pardo CA. The neurobiology of childhood spinal muscular atrophy. Neurobiology of Disease. 1996;3:97–110. doi: 10.1006/nbdi.1996.0010. [DOI] [PubMed] [Google Scholar]
Crawford TO, Sladky JT, Hurko O, Besner-Johnston A, Kelley RI. Abnormal fatty acid metabolism in childhood spinal muscular atrophy. Annals of Neurology. 1999;45:337–343. doi: 10.1002/1531-8249(199903)45:3<337::aid-ana9>3.0.co;2-u. [DOI] [PubMed] [Google Scholar]
Deguise MO, Boyer JG, McFall ER, Yazdani A, De Repentigny Y, Kothary R. Differential induction of muscle atrophy pathways in two mouse models of spinal muscular atrophy. Scientific Reports. 2016;6:e28846. doi: 10.1038/srep28846. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deguise MO, Baranello G, Mastella C, Beauvais A, Michaud J, Leone A, De Amicis R, Battezzati A, Dunham C, Selby K, Warman Chardon J, McMillan HJ, Huang YT, Courtney NL, Mole AJ, Kubinski S, Claus P, Murray LM, Bowerman M, Gillingwater TH, Bertoli S, Parson SH, Kothary R. Abnormal fatty acid metabolism is a core component of spinal muscular atrophy. Annals of Clinical and Translational Neurology. 2019a;6:1519–1532. doi: 10.1002/acn3.50855. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deguise MO, Chehade L, Tierney A, Beauvais A, Kothary R. Low fat diets increase survival of a mouse model of spinal muscular atrophy. Annals of Clinical and Translational Neurology. 2019b;6:2340–2346. doi: 10.1002/acn3.50920. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deguise MO, De Repentigny Y, Tierney A, Beauvais A, Michaud J, Chehade L, Thabet M, Paul B, Reilly A, Gagnon S, Renaud JM, Kothary R. Motor transmission defects with sex differences in a new mouse model of mild spinal muscular atrophy. EBioMedicine. 2020;55:102750. doi: 10.1016/j.ebiom.2020.102750. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deguise MO, Chehade L, Kothary R. Metabolic dysfunction in spinal muscular atrophy. International Journal of Molecular Sciences. 2021a;22:5913. doi: 10.3390/ijms22115913. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deguise MO, Pileggi C, De Repentigny Y, Beauvais A, Tierney A, Chehade L, Michaud J, Llavero-Hurtado M, Lamont D, Atrih A, Wishart TM, Gillingwater TH, Schneider BL, Harper ME, Parson SH, Kothary R. SMN depleted mice offer a robust and rapid onset model of nonalcoholic fatty liver disease. Cellular and Molecular Gastroenterology and Hepatology. 2021b;12:354–377. doi: 10.1016/j.jcmgh.2021.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deng Y, Hu M, Huang S, Fu N. Molecular mechanism and therapeutic significance of essential amino acids in metabolically associated fatty liver disease. The Journal of Nutritional Biochemistry. 2024;126:109581. doi: 10.1016/j.jnutbio.2024.109581. [DOI] [PubMed] [Google Scholar]
DiDonato CJ, Lorson CL, De Repentigny Y, Simard L, Chartrand C, Androphy EJ, Kothary R. Regulation of murine survival motor neuron (Smn) protein levels by modifying Smn exon 7 splicing. Human Molecular Genetics. 2001;10:2727–2736. doi: 10.1093/hmg/10.23.2727. [DOI] [PubMed] [Google Scholar]
Dong CX, Brubaker PL. Ghrelin, the proglucagon-derived peptides and peptide YY in nutrient homeostasis. Nature Reviews. Gastroenterology & Hepatology. 2012;9:705–715. doi: 10.1038/nrgastro.2012.185. [DOI] [PubMed] [Google Scholar]
Eshraghi M, McFall E, Gibeault S, Kothary R. Effect of genetic background on the phenotype of the Smn2B/- mouse model of spinal muscular atrophy. Human Molecular Genetics. 2016;25:4494–4506. doi: 10.1093/hmg/ddw278. [DOI] [PMC free article] [PubMed] [Google Scholar]
Feldkötter M, Schwarzer V, Wirth R, Wienker TF, Wirth B. Quantitative analyses of SMN1 and SMN2 based on real-time lightCycler PCR: fast and highly reliable carrier testing and prediction of severity of spinal muscular atrophy. American Journal of Human Genetics. 2002;70:358–368. doi: 10.1086/338627. [DOI] [PMC free article] [PubMed] [Google Scholar]
Finkel RS, Chiriboga CA, Vajsar J, Day JW, Montes J, De Vivo DC, Yamashita M, Rigo F, Hung G, Schneider E, Norris DA, Xia S, Bennett CF, Bishop KM. Treatment of infantile-onset spinal muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet. 2016;388:3017–3026. doi: 10.1016/S0140-6736(16)31408-8. [DOI] [PubMed] [Google Scholar]
Frugier T, Tiziano FD, Cifuentes-Diaz C, Miniou P, Roblot N, Dierich A, Le Meur M, Melki J. Nuclear targeting defect of SMN lacking the C-terminus in a mouse model of spinal muscular atrophy. Human Molecular Genetics. 2000;9:849–858. doi: 10.1093/hmg/9.5.849. [DOI] [PubMed] [Google Scholar]
Gavrilina TO, McGovern VL, Workman E, Crawford TO, Gogliotti RG, DiDonato CJ, Monani UR, Morris GE, Burghes AHM. Neuronal SMN expression corrects spinal muscular atrophy in severe SMA mice while muscle-specific SMN expression has no phenotypic effect. Human Molecular Genetics. 2008;17:1063–1075. doi: 10.1093/hmg/ddm379. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hammond SM, Gogliotti RG, Rao V, Beauvais A, Kothary R, DiDonato CJ. Mouse survival motor neuron alleles that mimic SMN2 splicing and are inducible rescue embryonic lethality early in development but not late. PLOS ONE. 2010;5:e15887. doi: 10.1371/journal.pone.0015887. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hribal ML, Procopio T, Petta S, Sciacqua A, Grimaudo S, Pipitone RM, Perticone F, Sesti G. Insulin-like growth factor-I, inflammatory proteins, and fibrosis in subjects with nonalcoholic fatty liver disease. The Journal of Clinical Endocrinology and Metabolism. 2013;98:E304–E308. doi: 10.1210/jc.2012-3290. [DOI] [PubMed] [Google Scholar]
Hua Y, Sahashi K, Rigo F, Hung G, Horev G, Bennett CF, Krainer AR. Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model. Nature. 2011;478:123–126. doi: 10.1038/nature10485. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hua Y, Liu YH, Sahashi K, Rigo F, Bennett CF, Krainer AR. Motor neuron cell-nonautonomous rescue of spinal muscular atrophy phenotypes in mild and severe transgenic mouse models. Genes & Development. 2015;29:288–297. doi: 10.1101/gad.256644.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ichikawa T, Nakao K, Hamasaki K, Furukawa R, Tsuruta S, Ueda Y, Taura N, Shibata H, Fujimoto M, Toriyama K, Eguchi K. Role of growth hormone, insulin-like growth factor 1 and insulin-like growth factor-binding protein 3 in development of non-alcoholic fatty liver disease. Hepatology International. 2007;1:287–294. doi: 10.1007/s12072-007-9007-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lefebvre S, Bürglen L, Reboullet S, Clermont O, Burlet P, Viollet L, Benichou B, Cruaud C, Millasseau P, Zeviani M. Identification and characterization of a spinal muscular atrophy-determining gene. Cell. 1995;80:155–165. doi: 10.1016/0092-8674(95)90460-3. [DOI] [PubMed] [Google Scholar]
Lefebvre S, Burlet P, Liu Q, Bertrandy S, Clermont O, Munnich A, Dreyfuss G, Melki J. Correlation between severity and SMN protein level in spinal muscular atrophy. Nature Genetics. 1997;16:265–269. doi: 10.1038/ng0797-265. [DOI] [PubMed] [Google Scholar]
Leow DMK, Ng YK, Wang LC, Koh HW, Zhao T, Khong ZJ, Tabaglio T, Narayanan G, Giadone RM, Sobota RM, Ng SY, Teo AK, Parson SH, Rubin LL, Ong WY, Darras BT, Yeo CJ. Hepatocyte-intrinsic SMN deficiency drives metabolic dysfunction and liver steatosis in spinal muscular atrophy. The Journal of Clinical Investigation. 2024;134:e173702. doi: 10.1172/JCI173702. [DOI] [PMC free article] [PubMed] [Google Scholar]
Loomba R, Sanyal AJ. The global NAFLD epidemic. Nature Reviews. Gastroenterology & Hepatology. 2013;10:686–690. doi: 10.1038/nrgastro.2013.171. [DOI] [PubMed] [Google Scholar]
Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. PNAS. 1999;96:6307–6311. doi: 10.1073/pnas.96.11.6307. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lorson CL, Rindt H, Shababi M. Spinal muscular atrophy: mechanisms and therapeutic strategies. Human Molecular Genetics. 2010;19:R111–R118. doi: 10.1093/hmg/ddq147. [DOI] [PMC free article] [PubMed] [Google Scholar]
Manley S, Williams JA, Ding WX. Role of p62/SQSTM1 in liver physiology and pathogenesis. Experimental Biology and Medicine. 2013;238:525–538. doi: 10.1177/1535370213489446. [DOI] [PMC free article] [PubMed] [Google Scholar]
McMillan HJ, Proud CM, Farrar MA, Alexander IE, Muntoni F, Servais L. Onasemnogene abeparvovec for the treatment of spinal muscular atrophy. Expert Opinion on Biological Therapy. 2022;22:1075–1090. doi: 10.1080/14712598.2022.2066471. [DOI] [PubMed] [Google Scholar]
Mells JE, Anania FA. The role of gastrointestinal hormones in hepatic lipid metabolism. Seminars in Liver Disease. 2013;33:343–357. doi: 10.1055/s-0033-1358527. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mercuri E, Sumner CJ, Muntoni F, Darras BT, Finkel RS. Spinal muscular atrophy. Nature Reviews. Disease Primers. 2022;8:52. doi: 10.1038/s41572-022-00380-8. [DOI] [PubMed] [Google Scholar]
Miletić M, Stević Z, Vujović S, Rakočević J, Tomić A, Tančić Gajić M, Stojanović M, Palibrk A, Žarković M. Glucose and lipid metabolism disorders in adults with spinal muscular atrophy type 3. Diagnostics. 2024;14:2078. doi: 10.3390/diagnostics14182078. [DOI] [PMC free article] [PubMed] [Google Scholar]
Muckenthaler MU, Rivella S, Hentze MW, Galy B. A red carpet for iron metabolism. Cell. 2017;168:344–361. doi: 10.1016/j.cell.2016.12.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
Murray LM, Beauvais A, Bhanot K, Kothary R. Defects in neuromuscular junction remodelling in the Smn(2B/-) mouse model of spinal muscular atrophy. Neurobiology of Disease. 2013;49:57–67. doi: 10.1016/j.nbd.2012.08.019. [DOI] [PubMed] [Google Scholar]
Murray LM, Beauvais A, Gibeault S, Courtney NL, Kothary R. Transcriptional profiling of differentially vulnerable motor neurons at pre-symptomatic stage in the Smn (2b/-) mouse model of spinal muscular atrophy. Acta Neuropathologica Communications. 2015;3:55. doi: 10.1186/s40478-015-0231-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
O’Connor G, Edel L, Raquq S, Bowerman M, Szmurlo A, Simpson Z, Hardy I, Fewtrell M, Baranello G. Open-labelled study to monitor the effect of an amino acid formula on symptom management in children with spinal muscular atrophy type I: The SMAAF pilot study. Nutrition in Clinical Practice. 2023;38:871–880. doi: 10.1002/ncp.10940. [DOI] [PubMed] [Google Scholar]
Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, Shelton KD, Lindner J, Cherrington AD, Magnuson MA. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. The Journal of Biological Chemistry. 1999;274:305–315. doi: 10.1074/jbc.274.1.305. [DOI] [PubMed] [Google Scholar]
Reilly A, Deguise MO, Beauvais A, Yaworski R, Thebault S, Tessier DR, Tabard-Cossa V, Hensel N, Schneider BL, Kothary R. Central and peripheral delivered AAV9-SMN are both efficient but target different pathomechanisms in a mouse model of spinal muscular atrophy. Gene Therapy. 2022;29:544–554. doi: 10.1038/s41434-022-00338-1. [DOI] [PubMed] [Google Scholar]
Reilly A, Yaworski R, Beauvais A, Schneider BL, Kothary R. Long term peripheral AAV9-SMN gene therapy promotes survival in a mouse model of spinal muscular atrophy. Human Molecular Genetics. 2024;33:510–519. doi: 10.1093/hmg/ddad202. [DOI] [PMC free article] [PubMed] [Google Scholar]
Richter MM, Galsgaard KD, Elmelund E, Knop FK, Suppli MP, Holst JJ, Winther-Sørensen M, Kjeldsen SAS, Wewer Albrechtsen NJ. The liver-α-cell axis in health and in disease. Diabetes. 2022;71:1852–1861. doi: 10.2337/dbi22-0004. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rix I, Johansen ML, Lund A, Suppli MP, Chabanova E, van Hall G, Holst JJ, Wewer Albrechtsen NJ, Kistorp C, Knop FK. Hyperglucagonaemia and amino acid alterations in individuals with type 2 diabetes and non-alcoholic fatty liver disease. Endocrine Connections. 2024;13:e230161. doi: 10.1530/EC-23-0161. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schrank B, Götz R, Gunnersen JM, Ure JM, Toyka KV, Smith AG, Sendtner M. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. PNAS. 1997;94:9920–9925. doi: 10.1073/pnas.94.18.9920. [DOI] [PMC free article] [PubMed] [Google Scholar]
Shababi M, Lorson CL, Rudnik-Schöneborn SS. Spinal muscular atrophy: a motor neuron disorder or a multi-organ disease? Journal of Anatomy. 2014;224:15–28. doi: 10.1111/joa.12083. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sutton ER, Beauvais A, Yaworski R, De Repentigny Y, Reilly A, Alves de Almeida MM, Deguise MO, Poulin KL, Parks RJ, Schneider BL, Kothary R. Liver SMN restoration rescues the SMN2B/- mouse model of spinal muscular atrophy. EBioMedicine. 2024;110:e105444. doi: 10.1016/j.ebiom.2024.105444. [DOI] [PMC free article] [PubMed] [Google Scholar]
Tandra S, Yeh MM, Brunt EM, Vuppalanchi R, Cummings OW, Ünalp-Arida A, Wilson LA, Chalasani N. Presence and significance of microvesicular steatosis in nonalcoholic fatty liver disease. Journal of Hepatology. 2011;55:654–659. doi: 10.1016/j.jhep.2010.11.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
Trefts E, Gannon M, Wasserman DH. The liver. Current Biology. 2017;27:R1147–R1151. doi: 10.1016/j.cub.2017.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
Vitte JM, Davoult B, Roblot N, Mayer M, Joshi V, Courageot S, Tronche F, Vadrot J, Moreau MH, Kemeny F, Melki J. Deletion of murine Smn exon 7 directed to liver leads to severe defect of liver development associated with iron overload. The American Journal of Pathology. 2004;165:1731–1741. doi: 10.1016/S0002-9440(10)63428-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife. doi: 10.7554/eLife.99141.3.sa0

eLife Assessment

Pramod K Mistry ¹

This work presents an important mouse model for a liver-specific depletion of the Survival Motor Neuron (SMN) protein, where the liver retains 30% of functional full-length SMN protein. The authors provide a profile of phenotypic changes in liver-specific SMN depleted mice with convincing evidence supporting their claims.

eLife. doi: 10.7554/eLife.99141.3.sa1

Reviewer #1 (Public review):

Anonymous

Summary:

This manuscript presents a comprehensive exploration of the role of liver-specific Survival Motor Neuron (SMN) depletion in peripheral and central nervous system tissue pathology through a well-constructed mouse model. This study is pioneering in its approach, focusing on the broader physiological implications of SMN, which has traditionally been associated predominantly with spinal muscular atrophy (SMA).

Strengths:

(1) Novelty and Relevance: The study addresses a significant gap in understanding the role of liver-specific SMN depletion in the context of SMA. This is a novel approach that adds valuable insights into the multi-organ impact of SMN deficiency.

(2) Comprehensive Methodology: The use of a well-characterized mouse model with liver-specific SMN depletion is a strength. The study employs a robust set of techniques, including genetic engineering, histological analysis, and various biochemical assays.

(3) Detailed Analysis: The manuscript provides a thorough analysis of liver pathology and its potential systemic effects, particularly on the pancreas and glucose metabolism.

(4) Clear Presentation: The manuscript is well written. The results are presented clearly with well-designed figures and detailed legends.

Weaknesses:

(1) Limited Time Points: The study primarily focuses on a single time point (P19). This limits the understanding of the temporal progression of liver and pancreatic pathology in the context of SMN depletion. Longitudinal studies would provide a better understanding of disease progression.

(2) Incomplete Recombination: The mosaic pattern of Cre-mediated excision leads to variability in SMN depletion, which complicates the interpretation of some results. Ensuring more consistent recombination across samples would strengthen the conclusions.

After the revision, the authors addressed the reviewers' questions by extending their analyses to include P60 mice, conducting both liver and pancreatic analyses, and adding a comprehensive panel of metabolic hormones related to glucose metabolism in animals at P19 and P60. They also corrected all errors identified during the initial review process and expanded the discussion to clarify raised issues. All my questions have now been addressed.

eLife. doi: 10.7554/eLife.99141.3.sa2

Reviewer #2 (Public review):

Anonymous

Summary:

Marylin Alves de Almeida et al. developed a novel mouse cross via conditionally depleting functional SMN protein in the liver (AlbCre/+;Smn2B/F7). This mouse model retains a proportion of SMN in the liver, which better recapitulates SMN deficiency observed in SMA patients and allows further investigation into liver-specific SMN deficiency and its systemic impact. They show that AlbCre/+;Smn2B/F7 mice do not develop an apparent SMA phenotype as mice did not develop motor neuron death, neuromuscular pathology or muscle atrophy, which is observed in the Smn2B/- controls. Nonetheless, at P19 and P60, these mice develop mild liver steatosis, and interestingly, this conditional depletion of SMN in the liver impacts cells in the pancreas.

Strengths:

The current model has clearly delineated the apparent metabolic perturbations which involve a significantly increased lipid accumulation in the liver and pancreatic cell defects in AlbCre/+;Smn2B/F7 mice at P19 and P60. Standard methods like H&E and Oil Red-O staining show that in AlbCre/+;Smn2B/F7 mice, their livers closely mimic the livers of Smn2B/- mice, which have the full body knockout of SMN protein. Unlike previous work, this liver-specific conditional depletion of SMN is superior in that it is not lethal to the mouse, which allows an opportunity to investigate the long-term effects of liver-specific SMN on the pathology of SMA.

Weaknesses:

Given that SMA often involves fatty liver, dyslipidemia and insulin resistance, using the current mouse model, the authors could have explored the long-term effects of liver-specific depletion of SMN on metabolic phenotypes beyond P19, as well as systemic effects like glucose homeostasis. Given that the authors also report pancreatic cell defects, the long-term effect on insulin secretion and resistance could be further explored. This has been addressed in the revised manuscript. The mechanistic link between a liver-specific SMN depletion and apparent pancreatic cell defects has been made clearer.

Discussion:

This current work explores a novel mouse cross in order to specifically deplete liver SMN using an Albumin-Cre driver line. This provides insight into the contribution of liver-specific SMN protein to the pathology of SMA, which is relevant for understanding metabolic perturbations in SMA patients. Nonetheless, given that SMA in patients involve a systemic deletion or mutation of the SMN gene, the authors could emphasize the utility of this liver-specific mouse model, as opposed to using in vitro models, which have been recently reported (Leow et al, 2024, JCI).

Comments on current version:

No further suggestions. Previous recommendations have been addressed by the authors.

eLife. 2025 Feb 20;13:RP99141. doi: 10.7554/eLife.99141.3.sa3

Author response

Monique Marylin de Almeida ¹, Yves De Repentigny ², Sabrina Gagnon ³, Emma R Sutton ⁴, Rashmi Kothary ⁵

The following is the authors’ response to the original reviews.

Public Reviews:

Reviewer #1 (Public review):

Summary:

This manuscript presents a comprehensive exploration of the role of liver-specific Survival Motor Neuron (SMN) depletion in peripheral and central nervous system tissue pathology through a well-constructed mouse model. This study is pioneering in its approach, focusing on the broader physiological implications of SMN, which has traditionally been associated predominantly with spinal muscular atrophy (SMA).

Strengths:

(1) Novelty and Relevance: The study addresses a significant gap in understanding the role of liver-specific SMN depletion in the context of SMA. This is a novel approach that adds valuable insights into the multi-organ impact of SMN deficiency.

(2) Comprehensive Methodology: The use of a well-characterized mouse model with liver-specific SMN depletion is a strength. The study employs a robust set of techniques, including genetic engineering, histological analysis, and various biochemical assays.

(3) Detailed Analysis: The manuscript provides a thorough analysis of liver pathology and its potential systemic effects, particularly on the pancreas and glucose metabolism.

(4) Clear Presentation: The manuscript is well written. The results are presented clearly with well-designed figures and detailed legends.

We thank the reviewer for their positive comments. They had some concerns for us to consider (see below). We provide a point-by-point response to their comments.

Weaknesses:

(1) Limited Time Points: The study primarily focuses on a single time point (P19). This limits the understanding of the temporal progression of liver and pancreatic pathology in the context of SMN depletion. Longitudinal studies would provide a better understanding of disease progression.

We thank the reviewer for the suggestion. We extended our analysis to include P60 mice and performed both liver and pancreatic analyses at this time point to address this suggestion.

(2) Incomplete Recombination: The mosaic pattern of Cre-mediated excision leads to variability in SMN depletion, which complicates the interpretation of some results. Ensuring more consistent recombination across samples would strengthen the conclusions.

The variability in Cre-mediated excision is inherently stochastic, influenced by factors such as Cre expression levels, timing of recombination, and the accessibility of the target locus in individual cells. Achieving complete consistency across samples is particularly challenging, especially given the complexity of our breeding scheme, which occasionally results in litters without any animals of the desired genotype. Importantly, our study not only demonstrates that liver-specific SMN depletion results in liver alterations and pancreatic dysfunction but also highlights the limitations and challenges associated with this mouse model. By doing so, we aim to provide valuable insights for other researchers considering similar approaches in future studies.

Reviewer #2 (Public review):

Summary:

Marylin Alves de Almeida et al. developed a novel mouse cross via conditionally depleting functional SMN protein in the liver (AlbCre/+;Smn2B/F7). This mouse model retains a proportion of SMN in the liver, which better recapitulates SMN deficiency observed in SMA patients and allows further investigation into liver-specific SMN deficiency and its systemic impact. They show that AlbCre/+;Smn2B/F7 mice do not develop an apparent SMA phenotype as mice did not develop motor neuron death, neuromuscular pathology or muscle atrophy, which is observed in the Smn2B/- controls. Nonetheless, at P19, these mice develop mild liver steatosis, and interestingly, this conditional depletion of SMN in the liver impacts cells in the pancreas.

Strengths:

The current model has clearly delineated the apparent metabolic perturbations which involve a significantly increased lipid accumulation in the liver and pancreatic cell defects in AlbCre/+;Smn2B/F7 mice at P19. Standard methods like H&E and Oil Red-O staining show that in AlbCre/+;Smn2B/F7 mice, their livers closely mimic the livers of Smn2B/- mice, which have the full body knockout of SMN protein. Unlike previous work, this liver-specific conditional depletion of SMN is superior in that it is not lethal to the mouse, which allows an opportunity to investigate the long-term effects of liver-specific SMN on the pathology of SMA.

We thank the reviewer for their positive comments. They had some concerns for us to consider (see below). We provide a point-by-point response to their comments (review comments in black, our response in red).

Weaknesses:

Given that SMA often involves fatty liver, dyslipidemia and insulin resistance, using the current mouse model, the authors could have explored the long-term effects of liver-specific depletion of SMN on metabolic phenotypes beyond P19, as well as systemic effects like glucose homeostasis. Given that the authors also report pancreatic cell defects, the long-term effect on insulin secretion and resistance could be further explored. The mechanistic link between a liver-specific SMN depletion and apparent pancreatic cell defects is also unclear.

We extended our analysis to include P60 mice and performed both liver and pancreatic analyses at this time point to address this suggestion. In addition, we discussed the liver-pancreas axis in the Discussion.

Discussion:

This current work explores a novel mouse cross in order to specifically deplete liver SMN using an Albumin-Cre driver line. This provides insight into the contribution of liver-specific SMN protein to the pathology of SMA, which is relevant for understanding metabolic perturbations in SMA patients. Nonetheless, given that SMA in patients involve a systemic deletion or mutation of the SMN gene, the authors could emphasize the utility of this liver-specific mouse model, as opposed to using in vitro models, which have been recently reported (Leow et al, 2024, JCI). Authors should also discuss why a mild metabolic phenotype is observed in this current mouse model, as opposed to other SMA mouse models described in literature.

We appreciate the reviewer’s insightful comment. We have thoroughly addressed this suggestion in the Discussion section, particularly in lines 284-298; 309-322 and 334-359.

Recommendations for the authors:

Reviewer #1 (Recommendations for the authors):

(1) Longitudinal Studies: Conducting studies at maybe one more time points postnatally to provide a clearer picture of how liver-specific SMN depletion affects tissue pathology over time.

We extended our analysis to include P60 mice and performed both liver and pancreatic analyses at this time point to address this suggestion.

(2) Functional Assays: Incorporate glucose tolerance tests, insulin sensitivity tests, and more detailed metabolic profiling to better understand the physiological consequences of liver-specific SMN depletion on glucose metabolism and pancreatic function.

We sincerely thank the reviewer for this suggestion. We have included a full panel of metabolic hormones associated with glucose metabolism from animals at P19 and P60. These new data, along with additional figures, have now been provided in our revised manuscript.

(3) Mechanism: Discuss the molecular pathways affected by SMN depletion in the liver and pancreas. Mechanistic studies including transcriptomic or proteomic analyses to identify dysregulated pathways will help.

We appreciate the reviewer’s insightful comment. We have thoroughly addressed this suggestion in the Discussion section, particularly in lines 284-298 and 334-359.

(4) Typos in the abstract: beta cells secret insulin and alpha cells produce gulcagon.

Thank you for catching this error. It has been corrected to reflect that insulin is produced by beta cells and glucagon by alpha cells.

(5) Efficiency and specificity of the Alb-Cre: if possible, cross the Alb-Cre with the Rosa26 reporter line to test the efficiency and specificity of the Alb-Cre.

We agree that this would provide valuable insights. However, initiating a new breeding program to generate the required genotypes would take over a year and is beyond the scope of this study. To address this in part, we performed Cre immunostaining of the liver, pancreas, and spinal cord at P19, as well as the liver at P60. These results, now included in Supplemental Figure 1, demonstrate liver-specific expression and variability across hepatocytes.

Reviewer #2 (Recommendations for the authors):

The title of this manuscript is potentially misleading. The manuscript largely investigates the involvement of SMN protein on peripheral organs such as the liver, muscles, neuromuscular junction, and the pancreas. Yet, the title could be interpreted that the peripheral nervous system or central nervous system is the main focus. The title should be edited to indicate key terms such as "motor neuron and peripheral tissue pathology".

Thank you for pointing this out. We have revised the title to better represent the study’s focus. It is now “Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology”.

Suggestions:

Please clarify and explain clearly the various mouse lines (Smn2B/+, Smn2B/- and +/+; Smn2B/F7) used as controls as the nomenclature used is confusing. In addition, authors could consider the use of a wild-type mouse line to be used as a control to validate changes in AlbCre/+; Smn2B/F7 mice.

We have now provided clarification on mouse line nomenclature in the Results section (lines 104–124). Full-body heterozygous mice (_Smn_2B/+) are used as controls due to their slightly reduced SMN protein levels and absence of phenotypic changes compared to wild-type mice.

Given that the main phenotype implicated by the liver-specific depletion of SMN protein in AlbCre/+;Smn2B/F7 mice is pancreatic abnormalities (changes in alpha- and beta- cell numbers and blood glucose levels), authors should expand further on the pancreatic phenotype.

We added a full panel of metabolic hormones related to glucose metabolism in animals at P19 and P60. Furthermore, this has been discussed in detail in lines 284-298 and 334-344 of the Discussion.

A pancreas-specific depletion of SMN would provide this current manuscript with a better understanding of the role of SMN in regulating SMA pathology and provide more definitive conclusions on the contribution of liver-specific SMN depletion on normal pancreatic function.

We agree that this would be very informative. However, to do this would require initiation of a new breeding program that will take more than a year to arrive at the right genotypes. Although valuable, it is beyond the scope of the present study.

The authors should also delineate the role of hepatic SMN in pancreatic function, and how the intrinsic liver-specific loss of SMN directly impacts the pancreas. Currently, literature demonstrates that the fatty liver phenotype in SMA patients is a primary SMN-dependent hepatocyte-intrinsic liver defect associated with mitochondrial and other hepatic metabolism implications (see Leow et al, 2024 J Clin Invest). Given that the authors describe that SMN protein levels are not altered in the pancreas of AlbCre/+;Smn2B/F7 mice at P19, the authors ought to clarify how pancreas development and function is impacted in this mouse model, whether in-utero or postnatally. This could potentially underscore the cross-talk between liver SMN and pancreas function.

We have discussed the relationship between hepatic SMN and pancreatic function in the Discussion at lines 284-298 and 334-359.

Authors should also perform some metabolic tolerance tests to both oral glucose and insulin at an older age (e.g. P60) to study their homeostasis in these mice. These would help to substantiate the authors' conclusion and provide the paper with a greater level of novelty.

We thank the reviewer for this suggestion. A full panel of metabolic hormones related to glucose metabolism at P19 and P60 has been included, supported by additional figures that enhance the manuscript's novelty and depth.

Authors mentioned in the Discussion in lines 238 to 240: "Altogether, our findings underscore the necessity of conducting further investigations at later time points to unveil potential modifications in other pathways and their repercussions on liver physiology". Please elucidate the effects of longer term liver-specific depletion of SMN beyond P19, such as the onset of NAFLD or a diabetic phenotype due to pancreatic dysfunctions.

We extended our data to include P60 mice and performed liver and pancreatic analyses at these time points. The observed effects were transient, possibly due to the stochastic nature of Cre expression.

In addition, while AlbCre/+;Smn2B/F7 mice had similar weight gain trends as controls, it does appear that AlbCre/+;Smn2B/F7 mice weigh more than their controls by P60 (Figure 9C). This data would provide more convincing evidence of the metabolic defects observed in these mice.

As per the reviewer’s suggestion, we included new data (Figure 9D) showing % weight gain at P60 normalized to basal weight at P7. However, no statistically significant differences were detected.

Other than protein quantification, authors should perform immunohistochemistry or in-situ hybridization of SMN and imaging of AlbCre/+;Smn2B/F7 organs to validate the loss of liver-specific SMN. It is unclear from western blots that the expression of SMN is only in hepatocytes.

We thank the reviewer for the suggestion. Unfortunately, SMN antibodies have not produced reliable tissue immunostaining. To address this, we performed Cre immunostaining of the liver, pancreas, and spinal cord at P19, and the liver at P60, which demonstrated liver-specific expression. These results are now included in Supplemental Figure 1.

Authors should consider re-wording lines 228 through 231: "While our current analysis did not reveal significant differences in AlbCre/+;Smn2B/F7 mice, the observed upward trend in transferrin and HO levels suggests ongoing changes in iron metabolism, which may not be fully manifested at P19". Alternatively, a higher number of mouse samples would allow them to qualify this statement. Authors should also consider comparing levels of liver biomarkers such as ALT and AST, to check for liver homeostatic function.

We have removed speculative statements to avoid unsupported claims.

Recommendations:

The methods and additional details to generate the AlbCre/+;Smn2B/F7 should be explained better in section 2.1 of the Results. It is potentially confusing as to why these mice had to carry both 2B and F7 alleles. Additionally, the role of the F7 allele is not deliberately clear in the Introduction.

Additional details are now included in the Introduction (lines 87-90) and the Results section (lines 104-124).

Authors should refer to Leow et al 2024 (J Clin Invest) and discuss how their current findings compare with their hepatocyte-intrinsic SMN deficiency IPSCs model.

We note a previous publication (Deguise et al 2021 Cell Mol Gastroenterol Hepatol) by the authors which characterized the Smn2B/- mouse model and its NAFLD/NASH features. From our understanding, the Smn2B/- mouse model appears to recapitulate SMA phenotype well, such as the early onset of hepatic steatosis and neurological conditions. As a follow-up to this publication, authors should discuss why this current study of a liver-specific SMN depletion is important and relevant to the study of SMA pathology.

We thank the reviewer for the insightful suggestions. We have included a discussion of these findings and their relevance to the study of SMA pathology in lines 284-298 and 309-322.

Minor corrections:

Abstract (line 32) reads: "a decrease in insulin producing alpha-cells and an increase in glucagon producing beta-cells". The authors should clarify and correct as insulin producing beta-cells and glucagon producing alpha-cells.

Thank you for catching the error. We corrected the description of insulin- and glucagon-producing cells.

Please clarify the number and gender of mice used for weight tracking and motor function experiments up to P60 (Figure 9C). It would be inappropriate if male and female mice were plotted together. If so, authors should stratify data by gender.

We thank the reviewer for the suggestion. Unfortunately, we did not stratify the animals by sex due to the unequal and insufficient number of males and females in our study. To address this, we normalized weight gain to each animal’s starting weight, and no significant differences were observed (now shown in Figure 9D).

The number of figures should be reduced. We recommend merging Figures 1 and 2 (generation of AlbCre/+;Smn2B/F7 mouse line and validation) and Figures 3 and 4 (liver function). Figures 5 through 9 may be supplemental figures instead.

We thank the reviewer for the suggestions. We merged Figures 1 and 2, and Figures 3 and 4, as requested. However, we would prefer to keep the other figures within the main results as they assess the impact of liver-specific depletion of SMN on other pathologies within the mouse model.

Standardize the use of asterisks and reporting p-values in Figure 2. All other figures in the manuscript utilize asterisks, but Figures 2C', 2D' and 2E' use p-values across comparisons.

P-values were included only when they approached statistical significance, providing additional clarity to the results.

It is unclear what the white arrow in Figure 7A indicates.

It is meant to point out the absence of an innervating axon. Please see Figure 5 legend, lines 801-802.

Note spelling errors in Figures 8B and 8C: 'Muscle flber'.

Thank you for catching this. We have corrected the typo to indicate muscle fiber instead.

Please clarify if muscle fiber size should be indicated as µm2 instead of µ2 in Figures 8B and 8C, as written in Materials and Methods under line 394.

Thank you for catching this. We corrected the typo to indicate µm2 instead.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

Kothary R. 2025. Image data accompanying the paper "Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology". BioImage Archive. [DOI] [PMC free article] [PubMed]

Supplementary Materials

Figure 1—source data 1. PDF file containing original western blots for Figure 1D–H, indicating the relevant bands and treatments.

elife-99141-fig1-data1.pdf^{(1.5MB, pdf)}

Figure 1—source data 2. Original files for western blot analysis displayed in Figure 1D–H.

elife-99141-fig1-data2.zip^{(1.1MB, zip)}

Figure 1—source data 3. Raw data for SMN protein levels plotted in Figure 1D’–H’.

elife-99141-fig1-data3.xlsx^{(10.6KB, xlsx)}

Figure 2—source data 1. PDF file containing original western blots for Figure 2C–E, indicating the relevant bands and treatments.

elife-99141-fig2-data1.pdf^{(756.2KB, pdf)}

Figure 2—source data 2. Riginal files for western blot analysis displayed in Figure 2C–E.

elife-99141-fig2-data2.zip^{(456.3KB, zip)}

Figure 2—source data 3. Raw data for plots in Figure 2B, C’, D’, E’ and F.

elife-99141-fig2-data3.xlsx^{(10.7KB, xlsx)}

Figure 3—source data 1. Raw data for plots in Figure 3B–J.

elife-99141-fig3-data1.xlsx^{(11.7KB, xlsx)}

Figure 4—source data 1. Raw data for motor neuron counts in the plots in Figure 4B.

elife-99141-fig4-data1.xlsx^{(9.7KB, xlsx)}

Figure 5—source data 1. Raw data for plots in Figure 5B and C.

elife-99141-fig5-data1.xlsx^{(9.9KB, xlsx)}

Figure 6—source data 1. Raw data for plots in Figure 6B and C.

elife-99141-fig6-data1.xlsx^{(23.5KB, xlsx)}

Figure 7—source data 1. Raw data for plots in Figure 7C–K.

elife-99141-fig7-data1.xlsx^{(11.6KB, xlsx)}

Figure 8—source data 1. Raw data for plots in Figure 8.

elife-99141-fig8-data1.xlsx^{(12.1KB, xlsx)}

Figure 9—source data 1. Raw data for plots in Figure 9B–G.

elife-99141-fig9-data1.xlsx^{(12.2KB, xlsx)}

MDAR checklist

elife-99141-mdarchecklist1.pdf^{(208.3KB, pdf)}

Data Availability Statement

The following dataset was generated:

Kothary R. 2025. Image data accompanying the paper "Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology". BioImage Archive.

[bib1] Afroze S, Meng F, Jensen K, McDaniel K, Rahal K, Onori P, Gaudio E, Alpini G, Glaser SS. The physiological roles of secretin and its receptor. Annals of Translational Medicine. 2013;1:29. doi: 10.3978/j.issn.2305-5839.2012.12.01. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] Bowerman M, Murray LM, Beauvais A, Pinheiro B, Kothary R. A critical smn threshold in mice dictates onset of an intermediate spinal muscular atrophy phenotype associated with A distinct neuromuscular junction pathology. Neuromuscular Disorders. 2012a;22:263–276. doi: 10.1016/j.nmd.2011.09.007. [DOI] [PubMed] [Google Scholar]

[bib3] Bowerman M, Swoboda KJ, Michalski JP, Wang GS, Reeks C, Beauvais A, Murphy K, Woulfe J, Screaton RA, Scott FW, Kothary R. Glucose metabolism and pancreatic defects in spinal muscular atrophy. Annals of Neurology. 2012b;72:256–268. doi: 10.1002/ana.23582. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib4] Bowerman M, Michalski JP, Beauvais A, Murray LM, DeRepentigny Y, Kothary R. Defects in pancreatic development and glucose metabolism in SMN-depleted mice independent of canonical spinal muscular atrophy neuromuscular pathology. Human Molecular Genetics. 2014;23:3432–3444. doi: 10.1093/hmg/ddu052. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] Chehade L, Deguise MO, De Repentigny Y, Yaworski R, Beauvais A, Gagnon S, Hensel N, Kothary R. Suppression of the necroptotic cell death pathways improves survival in Smn2B/− mice. Frontiers in Cellular Neuroscience. 2022;16:972029. doi: 10.3389/fncel.2022.972029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] Chen L, Wu N, Kennedy L, Francis H, Ceci L, Zhou T, Samala N, Kyritsi K, Wu C, Sybenga A, Ekser B, Dar W, Atkins C, Meadows V, Glaser S, Alpini G. Inhibition of secretin/secretin receptor axis ameliorates NAFLD phenotypes. Hepatology. 2021;74:1845–1863. doi: 10.1002/hep.31871. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] Chiriboga CA. Nusinersen for the treatment of spinal muscular atrophy. Expert Review of Neurotherapeutics. 2017;17:955–962. doi: 10.1080/14737175.2017.1364159. [DOI] [PubMed] [Google Scholar]

[bib8] Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacène E, Roblot N, Joshi V, Moreau MH, Melki J. Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. The Journal of Cell Biology. 2001;152:1107–1114. doi: 10.1083/jcb.152.5.1107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] Cifuentes-Diaz C, Nicole S, Velasco ME, Borra-Cebrian C, Panozzo C, Frugier T, Millet G, Roblot N, Joshi V, Melki J. Neurofilament accumulation at the motor endplate and lack of axonal sprouting in a spinal muscular atrophy mouse model. Human Molecular Genetics. 2002;11:1439–1447. doi: 10.1093/hmg/11.12.1439. [DOI] [PubMed] [Google Scholar]

[bib10] Crawford TO, Pardo CA. The neurobiology of childhood spinal muscular atrophy. Neurobiology of Disease. 1996;3:97–110. doi: 10.1006/nbdi.1996.0010. [DOI] [PubMed] [Google Scholar]

[bib11] Crawford TO, Sladky JT, Hurko O, Besner-Johnston A, Kelley RI. Abnormal fatty acid metabolism in childhood spinal muscular atrophy. Annals of Neurology. 1999;45:337–343. doi: 10.1002/1531-8249(199903)45:3<337::aid-ana9>3.0.co;2-u. [DOI] [PubMed] [Google Scholar]

[bib12] Deguise MO, Boyer JG, McFall ER, Yazdani A, De Repentigny Y, Kothary R. Differential induction of muscle atrophy pathways in two mouse models of spinal muscular atrophy. Scientific Reports. 2016;6:e28846. doi: 10.1038/srep28846. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] Deguise MO, Baranello G, Mastella C, Beauvais A, Michaud J, Leone A, De Amicis R, Battezzati A, Dunham C, Selby K, Warman Chardon J, McMillan HJ, Huang YT, Courtney NL, Mole AJ, Kubinski S, Claus P, Murray LM, Bowerman M, Gillingwater TH, Bertoli S, Parson SH, Kothary R. Abnormal fatty acid metabolism is a core component of spinal muscular atrophy. Annals of Clinical and Translational Neurology. 2019a;6:1519–1532. doi: 10.1002/acn3.50855. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] Deguise MO, Chehade L, Tierney A, Beauvais A, Kothary R. Low fat diets increase survival of a mouse model of spinal muscular atrophy. Annals of Clinical and Translational Neurology. 2019b;6:2340–2346. doi: 10.1002/acn3.50920. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] Deguise MO, De Repentigny Y, Tierney A, Beauvais A, Michaud J, Chehade L, Thabet M, Paul B, Reilly A, Gagnon S, Renaud JM, Kothary R. Motor transmission defects with sex differences in a new mouse model of mild spinal muscular atrophy. EBioMedicine. 2020;55:102750. doi: 10.1016/j.ebiom.2020.102750. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] Deguise MO, Chehade L, Kothary R. Metabolic dysfunction in spinal muscular atrophy. International Journal of Molecular Sciences. 2021a;22:5913. doi: 10.3390/ijms22115913. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] Deguise MO, Pileggi C, De Repentigny Y, Beauvais A, Tierney A, Chehade L, Michaud J, Llavero-Hurtado M, Lamont D, Atrih A, Wishart TM, Gillingwater TH, Schneider BL, Harper ME, Parson SH, Kothary R. SMN depleted mice offer a robust and rapid onset model of nonalcoholic fatty liver disease. Cellular and Molecular Gastroenterology and Hepatology. 2021b;12:354–377. doi: 10.1016/j.jcmgh.2021.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] Deng Y, Hu M, Huang S, Fu N. Molecular mechanism and therapeutic significance of essential amino acids in metabolically associated fatty liver disease. The Journal of Nutritional Biochemistry. 2024;126:109581. doi: 10.1016/j.jnutbio.2024.109581. [DOI] [PubMed] [Google Scholar]

[bib19] DiDonato CJ, Lorson CL, De Repentigny Y, Simard L, Chartrand C, Androphy EJ, Kothary R. Regulation of murine survival motor neuron (Smn) protein levels by modifying Smn exon 7 splicing. Human Molecular Genetics. 2001;10:2727–2736. doi: 10.1093/hmg/10.23.2727. [DOI] [PubMed] [Google Scholar]

[bib20] Dong CX, Brubaker PL. Ghrelin, the proglucagon-derived peptides and peptide YY in nutrient homeostasis. Nature Reviews. Gastroenterology & Hepatology. 2012;9:705–715. doi: 10.1038/nrgastro.2012.185. [DOI] [PubMed] [Google Scholar]

[bib21] Eshraghi M, McFall E, Gibeault S, Kothary R. Effect of genetic background on the phenotype of the Smn2B/- mouse model of spinal muscular atrophy. Human Molecular Genetics. 2016;25:4494–4506. doi: 10.1093/hmg/ddw278. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib22] Feldkötter M, Schwarzer V, Wirth R, Wienker TF, Wirth B. Quantitative analyses of SMN1 and SMN2 based on real-time lightCycler PCR: fast and highly reliable carrier testing and prediction of severity of spinal muscular atrophy. American Journal of Human Genetics. 2002;70:358–368. doi: 10.1086/338627. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] Finkel RS, Chiriboga CA, Vajsar J, Day JW, Montes J, De Vivo DC, Yamashita M, Rigo F, Hung G, Schneider E, Norris DA, Xia S, Bennett CF, Bishop KM. Treatment of infantile-onset spinal muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet. 2016;388:3017–3026. doi: 10.1016/S0140-6736(16)31408-8. [DOI] [PubMed] [Google Scholar]

[bib24] Frugier T, Tiziano FD, Cifuentes-Diaz C, Miniou P, Roblot N, Dierich A, Le Meur M, Melki J. Nuclear targeting defect of SMN lacking the C-terminus in a mouse model of spinal muscular atrophy. Human Molecular Genetics. 2000;9:849–858. doi: 10.1093/hmg/9.5.849. [DOI] [PubMed] [Google Scholar]

[bib25] Gavrilina TO, McGovern VL, Workman E, Crawford TO, Gogliotti RG, DiDonato CJ, Monani UR, Morris GE, Burghes AHM. Neuronal SMN expression corrects spinal muscular atrophy in severe SMA mice while muscle-specific SMN expression has no phenotypic effect. Human Molecular Genetics. 2008;17:1063–1075. doi: 10.1093/hmg/ddm379. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] Hammond SM, Gogliotti RG, Rao V, Beauvais A, Kothary R, DiDonato CJ. Mouse survival motor neuron alleles that mimic SMN2 splicing and are inducible rescue embryonic lethality early in development but not late. PLOS ONE. 2010;5:e15887. doi: 10.1371/journal.pone.0015887. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib27] Hribal ML, Procopio T, Petta S, Sciacqua A, Grimaudo S, Pipitone RM, Perticone F, Sesti G. Insulin-like growth factor-I, inflammatory proteins, and fibrosis in subjects with nonalcoholic fatty liver disease. The Journal of Clinical Endocrinology and Metabolism. 2013;98:E304–E308. doi: 10.1210/jc.2012-3290. [DOI] [PubMed] [Google Scholar]

[bib28] Hua Y, Sahashi K, Rigo F, Hung G, Horev G, Bennett CF, Krainer AR. Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model. Nature. 2011;478:123–126. doi: 10.1038/nature10485. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib29] Hua Y, Liu YH, Sahashi K, Rigo F, Bennett CF, Krainer AR. Motor neuron cell-nonautonomous rescue of spinal muscular atrophy phenotypes in mild and severe transgenic mouse models. Genes & Development. 2015;29:288–297. doi: 10.1101/gad.256644.114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] Ichikawa T, Nakao K, Hamasaki K, Furukawa R, Tsuruta S, Ueda Y, Taura N, Shibata H, Fujimoto M, Toriyama K, Eguchi K. Role of growth hormone, insulin-like growth factor 1 and insulin-like growth factor-binding protein 3 in development of non-alcoholic fatty liver disease. Hepatology International. 2007;1:287–294. doi: 10.1007/s12072-007-9007-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] Lefebvre S, Bürglen L, Reboullet S, Clermont O, Burlet P, Viollet L, Benichou B, Cruaud C, Millasseau P, Zeviani M. Identification and characterization of a spinal muscular atrophy-determining gene. Cell. 1995;80:155–165. doi: 10.1016/0092-8674(95)90460-3. [DOI] [PubMed] [Google Scholar]

[bib32] Lefebvre S, Burlet P, Liu Q, Bertrandy S, Clermont O, Munnich A, Dreyfuss G, Melki J. Correlation between severity and SMN protein level in spinal muscular atrophy. Nature Genetics. 1997;16:265–269. doi: 10.1038/ng0797-265. [DOI] [PubMed] [Google Scholar]

[bib33] Leow DMK, Ng YK, Wang LC, Koh HW, Zhao T, Khong ZJ, Tabaglio T, Narayanan G, Giadone RM, Sobota RM, Ng SY, Teo AK, Parson SH, Rubin LL, Ong WY, Darras BT, Yeo CJ. Hepatocyte-intrinsic SMN deficiency drives metabolic dysfunction and liver steatosis in spinal muscular atrophy. The Journal of Clinical Investigation. 2024;134:e173702. doi: 10.1172/JCI173702. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] Loomba R, Sanyal AJ. The global NAFLD epidemic. Nature Reviews. Gastroenterology & Hepatology. 2013;10:686–690. doi: 10.1038/nrgastro.2013.171. [DOI] [PubMed] [Google Scholar]

[bib35] Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. PNAS. 1999;96:6307–6311. doi: 10.1073/pnas.96.11.6307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] Lorson CL, Rindt H, Shababi M. Spinal muscular atrophy: mechanisms and therapeutic strategies. Human Molecular Genetics. 2010;19:R111–R118. doi: 10.1093/hmg/ddq147. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] Manley S, Williams JA, Ding WX. Role of p62/SQSTM1 in liver physiology and pathogenesis. Experimental Biology and Medicine. 2013;238:525–538. doi: 10.1177/1535370213489446. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] McMillan HJ, Proud CM, Farrar MA, Alexander IE, Muntoni F, Servais L. Onasemnogene abeparvovec for the treatment of spinal muscular atrophy. Expert Opinion on Biological Therapy. 2022;22:1075–1090. doi: 10.1080/14712598.2022.2066471. [DOI] [PubMed] [Google Scholar]

[bib39] Mells JE, Anania FA. The role of gastrointestinal hormones in hepatic lipid metabolism. Seminars in Liver Disease. 2013;33:343–357. doi: 10.1055/s-0033-1358527. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] Mercuri E, Sumner CJ, Muntoni F, Darras BT, Finkel RS. Spinal muscular atrophy. Nature Reviews. Disease Primers. 2022;8:52. doi: 10.1038/s41572-022-00380-8. [DOI] [PubMed] [Google Scholar]

[bib41] Miletić M, Stević Z, Vujović S, Rakočević J, Tomić A, Tančić Gajić M, Stojanović M, Palibrk A, Žarković M. Glucose and lipid metabolism disorders in adults with spinal muscular atrophy type 3. Diagnostics. 2024;14:2078. doi: 10.3390/diagnostics14182078. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] Muckenthaler MU, Rivella S, Hentze MW, Galy B. A red carpet for iron metabolism. Cell. 2017;168:344–361. doi: 10.1016/j.cell.2016.12.034. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib43] Murray LM, Beauvais A, Bhanot K, Kothary R. Defects in neuromuscular junction remodelling in the Smn(2B/-) mouse model of spinal muscular atrophy. Neurobiology of Disease. 2013;49:57–67. doi: 10.1016/j.nbd.2012.08.019. [DOI] [PubMed] [Google Scholar]

[bib44] Murray LM, Beauvais A, Gibeault S, Courtney NL, Kothary R. Transcriptional profiling of differentially vulnerable motor neurons at pre-symptomatic stage in the Smn (2b/-) mouse model of spinal muscular atrophy. Acta Neuropathologica Communications. 2015;3:55. doi: 10.1186/s40478-015-0231-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib45] O’Connor G, Edel L, Raquq S, Bowerman M, Szmurlo A, Simpson Z, Hardy I, Fewtrell M, Baranello G. Open-labelled study to monitor the effect of an amino acid formula on symptom management in children with spinal muscular atrophy type I: The SMAAF pilot study. Nutrition in Clinical Practice. 2023;38:871–880. doi: 10.1002/ncp.10940. [DOI] [PubMed] [Google Scholar]

[bib46] Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, Shelton KD, Lindner J, Cherrington AD, Magnuson MA. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. The Journal of Biological Chemistry. 1999;274:305–315. doi: 10.1074/jbc.274.1.305. [DOI] [PubMed] [Google Scholar]

[bib47] Reilly A, Deguise MO, Beauvais A, Yaworski R, Thebault S, Tessier DR, Tabard-Cossa V, Hensel N, Schneider BL, Kothary R. Central and peripheral delivered AAV9-SMN are both efficient but target different pathomechanisms in a mouse model of spinal muscular atrophy. Gene Therapy. 2022;29:544–554. doi: 10.1038/s41434-022-00338-1. [DOI] [PubMed] [Google Scholar]

[bib48] Reilly A, Yaworski R, Beauvais A, Schneider BL, Kothary R. Long term peripheral AAV9-SMN gene therapy promotes survival in a mouse model of spinal muscular atrophy. Human Molecular Genetics. 2024;33:510–519. doi: 10.1093/hmg/ddad202. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib49] Richter MM, Galsgaard KD, Elmelund E, Knop FK, Suppli MP, Holst JJ, Winther-Sørensen M, Kjeldsen SAS, Wewer Albrechtsen NJ. The liver-α-cell axis in health and in disease. Diabetes. 2022;71:1852–1861. doi: 10.2337/dbi22-0004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib50] Rix I, Johansen ML, Lund A, Suppli MP, Chabanova E, van Hall G, Holst JJ, Wewer Albrechtsen NJ, Kistorp C, Knop FK. Hyperglucagonaemia and amino acid alterations in individuals with type 2 diabetes and non-alcoholic fatty liver disease. Endocrine Connections. 2024;13:e230161. doi: 10.1530/EC-23-0161. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib51] Schrank B, Götz R, Gunnersen JM, Ure JM, Toyka KV, Smith AG, Sendtner M. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. PNAS. 1997;94:9920–9925. doi: 10.1073/pnas.94.18.9920. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib52] Shababi M, Lorson CL, Rudnik-Schöneborn SS. Spinal muscular atrophy: a motor neuron disorder or a multi-organ disease? Journal of Anatomy. 2014;224:15–28. doi: 10.1111/joa.12083. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib53] Sutton ER, Beauvais A, Yaworski R, De Repentigny Y, Reilly A, Alves de Almeida MM, Deguise MO, Poulin KL, Parks RJ, Schneider BL, Kothary R. Liver SMN restoration rescues the SMN2B/- mouse model of spinal muscular atrophy. EBioMedicine. 2024;110:e105444. doi: 10.1016/j.ebiom.2024.105444. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib54] Tandra S, Yeh MM, Brunt EM, Vuppalanchi R, Cummings OW, Ünalp-Arida A, Wilson LA, Chalasani N. Presence and significance of microvesicular steatosis in nonalcoholic fatty liver disease. Journal of Hepatology. 2011;55:654–659. doi: 10.1016/j.jhep.2010.11.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib55] Trefts E, Gannon M, Wasserman DH. The liver. Current Biology. 2017;27:R1147–R1151. doi: 10.1016/j.cub.2017.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib56] Vitte JM, Davoult B, Roblot N, Mayer M, Joshi V, Courageot S, Tronche F, Vadrot J, Moreau MH, Kemeny F, Melki J. Deletion of murine Smn exon 7 directed to liver leads to severe defect of liver development associated with iron overload. The American Journal of Pathology. 2004;165:1731–1741. doi: 10.1016/S0002-9440(10)63428-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Impact of liver-specific survival motor neuron (SMN) depletion on central nervous system and peripheral tissue pathology

Monique Marylin Alves de Almeida

Yves De Repentigny

Sabrina Gagnon

Emma R Sutton

Rashmi Kothary

Roles

Abstract

Introduction

Results

Generation of liver-specific SMN-depleted mice

Figure 1. Generation of liver-specific SMN-depleted mice.

Figure 1—figure supplement 1. Cre expression across different tissues.

AlbCre/+;Smn2B/F7 mice show mild yet important liver steatosis

Figure 2. Impact of liver-specific SMN depletion in liver function.

Liver-specific SMN-depleted mice display pancreatic defects

Figure 3. Contribution of liver-specific SMN depletion to pancreatic pathology.

Motor neurons, neuromuscular junction (NMJ) or motor fibers are unaffected in liver-specific SMN-depleted mice

Figure 4. Impact of liver-specific SMN depletion on motor neuron cell body numbers.

Figure 5. Impact of liver-specific SMN depletion on neuromuscular junction pathology.

Figure 6. Impact of liver-specific SMN depletion on muscle fiber size and distribution.

Liver-specific SMN-depleted mice show transitory liver and pancreatic pathology

Figure 7. Consequences of liver-specific SMN depletion to early adulthood liver and pancreatic pathology.

Liver-specific SMN depletion does not affect major adipocyte and gastrointestinal hormones

Figure 8. Contribution of liver-specific SMN depletion to major adipocyte and gastrointestinal hormones at P19 and P60.

Liver-specific SMN-depleted mice have normal survival rates and motor function

Figure 9. Impact of liver-specific SMN depletion on motor function.

Discussion

Materials and methods

Mouse models

Table 1. List of primers used for genotyping.

Tissue harvesting and processing

Immunoblotting

Immunohistochemistry

Pancreas

Table 2. List of antibodies used.

Motor neurons

Neuromuscular junction (NMJ)

Muscle fiber analysis

Glucose levels

ELISA for insulin-like growth factor I (IGF-1)

Triglycerides quantification

Mouse metabolic hormone assay

Motor function, weight, and survival assessments

Statistical analysis

Data sharing

Acknowledgements

Funding Statement

Contributor Information

Funding Information

Additional information

Competing interests

Author contributions

Ethics

Additional files

Data availability

References

eLife Assessment

Pramod K Mistry

Roles

Reviewer #1 (Public review):

Anonymous

Roles

Reviewer #2 (Public review):

Anonymous

Roles

Author response

Monique Marylin de Almeida

Yves De Repentigny

Sabrina Gagnon

Emma R Sutton

Rashmi Kothary

Roles

Associated Data

Data Citations

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

Alb^Cre/+;Smn^2B/F7 mice show mild yet important liver steatosis