Abstract
Background
Dairy cow laminitis causes severe economic losses and animal welfare issues in dairy farms globally. Current clinical interventions for laminitis remain limited in terms of safety and efficacy, which poses significant challenges to pasture-based productivity. Previous studies demonstrated that the activation of PI3K/Akt and NF-κB signaling pathways is a crucial mechanism promoting inflammatory damage and lamellar tissue degradation, providing potential targets for the development of novel therapeutic agents for treating dairy cow laminitis. Quercetin, an accessible and inexpensive flavonoid, exhibits diverse biological activities, including anti-inflammatory, antioxidant, and metabolic-modulatory effects. The present study aimed to elucidate the anti-inflammatory mechanism of quercetin in LPS-induced inflammatory response in dairy cow lamellar keratinocytes.
Results
Our results showed that quercetin at a concentration of 25 µM effectively downregulated the mRNA expression of inflammatory factors, including TNF-α, IL-6, IL-1β, CXCL-1, CXCL-6, COX-2, and iNOS in association with elevated expression of IL-10. Concurrently, quercetin inhibited the activation of the PI3K/Akt and NF-κB signaling pathways. Further experiments demonstrated that co-treatment with ammonium pyrrolidinedithiocarbamate (PDTC, an NF-κB inhibitor) significantly potentiated the inhibitory effect of quercetin on the protein expression of p-IκBα and p-p65. This result confirmed that quercetin exerts its anti-inflammatory effect by targeting and modulating the NF-κB signaling pathway. Additionally, Akt overexpression markedly alleviated quercetin-induced suppression of both p-IκBα/p-p65 protein expression and the mRNA transcription of downstream pro-inflammatory factors (TNF-α, IL-6, and IL-1β) but further increased quercetin-enhanced IL-10 expression. In contrast, combined Akt silencing and quercetin treatment further reduces the activation of the NF-κB signaling pathway.
Conclusions
In conclusion, our findings demonstrate that quercetin alleviates the inflammatory response in LPS-induced dairy cow lamellar keratinocytes by modulating the PI3K/Akt/NF-κB signaling pathway. This study provides experimental evidence for the potential application of quercetin in the prevention and treatment of dairy cow laminitis.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-026-05300-6.
Keywords: Dairy cows, Lamellar keratinocytes, Quercetin, Inflammatory response, PI3K/Akt/NF-κB signaling pathway
Background
Dairy cow laminitis begins as subclinical degeneration of the lamina corium, potentially progressing to severe claw horn disorders and clinical lameness, with substantial economic consequences due to lower milk yield and poor reproductive performance [1, 2]. The initial development stage of subclinical laminitis exhibits no obvious clinical symptoms, which makes early diagnosis challenging and often leads to a delay in effective intervention in practical production. Lamellar tissue damage in cattle is widely regarded as a primarily degenerative process of the lamina corium. The fundamental event is considered to be a weakening of the suspensory apparatus of the distal phalanx (P3), which has been linked to increased activity of matrix metalloproteinases (MMPs), particularly MMP-2 and MMP-9, in the corium during the peripartum period [3]. This degradation of connective tissue structures can occur in the absence of overt inflammatory changes, leading to failure of suspensory structures allowing P3 sinkage in the claw capsule [4]. While the precise inciting causes are multifactorial, subacute ruminal acidosis (SARA), mastitis, and environmental management are considered to be risk factors that may initiate or accelerate this degeneration [5, 6, 7]. Building upon this degenerative foundation, inflammatory responses were recognized as important exacerbating factors in the progression of claw disorders [8]. Current conventional treatments for laminitis primarily involve reducing concentrate intake or administering nonsteroidal anti-inflammatory drugs (NSAIDs) [9, 10]. However, these medications often cause significant side effects and may lead to drug residues. Therefore, a safe and effective method to alleviate laminitis in dairy cows is an urgent clinical concern.
The nuclear factor kappa-light-chain-enhancer of B cells (NF-κB) serves as a key regulator of the inflammatory response. The NF-κB pathway can be activated by LPS, which in turn upregulates the expression of inflammatory factors such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6). These factors can further activate the NF-κB pathway in a retrograde manner, forming an amplified inflammatory feedback loop [11]. Furthermore, NF-κB can bind to the promoter regions of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2), thereby upregulating their expression and exacerbating the inflammatory response [12]. The suppression of the NF-κB pathway mitigates laminitis-associated inflammation, as evidenced by studies with LPS challenged bovine claw corium cells [13]. Furthermore, in vivo studies have provided consistent findings, showing that inhibition of the NF-κB pathway mitigates the inflammatory response in dairy cows with claw lesions [8]. The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) signaling pathway is one of the most critical upstream pathways of the NF-κB signaling pathway and has been reported to play an essential role in the progression of laminitis in equine [14, 15]. This raises the critical question of whether a similar pro-inflammatory signaling axis contributes to the secondary inflammatory damage within the degenerating bovine lamellar corium. Although the primary pathogenesis of bovine laminitis differs from that of acute laminitis in horses, the PI3K/Akt/NF-κB axis is a central, evolutionarily conserved mediator of inflammatory responses. The potential role of this pathway in the complex pathology of bovine claw disorders, particularly its contribution to the inflammatory processes accompanying lamellar degeneration, remains to be elucidated. Based on this rationale, we hypothesized that targeted modulation of PI3K/Akt and NF-κB pathways may represent a potential therapeutic strategy for alleviating laminitis in dairy cows.
Quercetin (3,3′,4′,5,7-pentahydroxy-2-phenylchromen-4-one), a representative natural flavonoid widely abundant in various types of fruits and vegetables, possesses anti-inflammatory, antioxidant, and immunoregulatory properties. These characteristics make it an extremely promising therapeutic candidate for various inflammatory diseases [16, 17, 18]. Previous studies have shown that quercetin exerts anti-inflammatory and protective effects by modulating multiple signaling pathways, including the NF-κB, PI3K/Akt, and mitogen-activated protein kinase (MAPK) pathways. Network pharmacology uncovered that quercetin-targeted genes are significantly enriched in the mouse inflammatory model [19]. For instance, quercetin has been shown to protect human oral mucosal keratinocytes from LPS-induced inflammatory responses by inhibiting the AKT pathway [20]. Furthermore, several studies have confirmed that quercetin alleviates inflammatory responses by modulating the PI3K/Akt/NF-κB pathway in the inflammatory cells of mice, decreasing the expression of pro-inflammatory factors, and increasing the expression of anti-inflammatory factors [21, 22]. Our previous in vivo study demonstrated that dietary quercetin supplementation modulates the PI3K/Akt and NF-κB signaling pathways and reduces the expression of inflammatory mediators in dairy cows with claw horn lesions [8]. However, it remains unexplored whether quercetin can mitigate LPS-induced inflammatory response in dairy cows’ lamellar keratinocytes, as well as the underlying molecular mechanisms. Therefore, building upon these in vivo findings, the present study aimed to investigate the mechanism of quercetin in LPS-induced inflammatory response with lamellar keratinocytes.
In the present study, we isolated keratinocytes from dairy cow lamellar tissues and analyzed the potential mechanisms by which quercetin alleviates LPS-induced inflammatory responses in keratinocytes by silencing and overexpressing the Akt gene. This study provides new insights and therapeutic strategies for the application of quercetin in the management of laminitis in dairy cows.
Results
The LPS-induced inflammatory response model in lamellar keratinocytes
The primary isolated cells exhibited a characteristic cobblestone morphology under phase contrast microscopy, which is typical of keratinocytes in culture (Fig. 1A). To confirm the identity of the primary isolated cells, cellular immunofluorescence staining was performed. Results showed positive expression of pan-cytokeratin AE1/AE3 and negative expression of vimentin in the isolated cells (Fig. 1B). Furthermore, desmosomes between isolated cells were observed under the transmission electron microscope (Fig. 1C). Based on these characteristic results, the isolated cells were identified as lamellar keratinocytes (epidermal keratinocytes from the lamellar tissue, passages 2–4). To construct a model of inflammatory response using these lamellar keratinocytes, we examined the effects of different concentrations of LPS on cell viability and the secretion of pro-inflammatory factors. As shown in Fig. 1D, the cellular metabolic activity of keratinocytes treated with 10 µg/mL LPS for 24 h was significantly increased compared with the control group (P < 0.0001). Additionally, the secretion of pro-inflammatory factors TNF-α (P < 0.0001), IL-1β (P < 0.0001), and IL-6 (P < 0.0001) was significantly increased with treatment of 10 µg/mL LPS for 24 h.
Fig. 1.
Establishment of an LPS-induced inflammatory model in dairy cow lamellar keratinocytes. A The isolated primary dairy cow lamellar keratinocytes (passages 2–4) in culture. The cells exhibited the typical cobblestone morphology. B The immunofluorescence images confirm the identity of the isolated cells, showing positive staining for the keratinocyte marker pan-cytokeratin AE1/AE3 (green). Nuclei are counterstained with DAPI (blue). C Ultrastructure of isolated lamellar keratinocytes under TEM. Red arrowheads indicate desmosomes, characteristic intracellular adhesion structures definitive of keratinocytes. D The cellular metabolic activity of lamellar keratinocytes following treatment with various concentrations of LPS (0–20 µg/mL) for 12, 24, or 48 h, as determined by CCK-8 assay. E-G The secretion of TNF-α, IL-6, and IL-1β in cell supernatants was detected by ELISA. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol * indicates P < 0.05, and ** indicates P < 0.01
(Fig. 1E-G).
Quercetin attenuates the LPS-induced inflammatory response in lamellar keratinocytes
The chemical structure of quercetin is presented in Fig. 2A. To determine the safe concentration range of quercetin for lamellar keratinocytes, cells were treated with different concentrations of quercetin (0, 6.25, 12.5, 25, 50, and 100 µM) for 24–48 h, followed by cell viability detection. Results showed that quercetin exerted no cytotoxic effects on keratinocytes at concentrations of 50 µM (P = 0.3952) and below (Fig. 2B). Subsequently, to evaluate quercetin’s effect on LPS-induced inflammation, keratinocytes were co-treated with LPS (10 µg/mL) and different concentrations of quercetin (0, 6.25, 12.5, 25, 50, and 100 µM) for 24 h. At concentrations of 12.5 (P = 0.0183) and 25 µM (P = 0.0016), quercetin effectively inhibited LPS-induced increase in metabolic activity of keratinocytes (Fig. 2C). Among these, quercetin at the concentration of 25 µM significantly suppressed the secretion of TNF-α (P = 0.0059), IL-6 (P = 0.0055), IL-1β (P < 0.0001), CXCL-1 (P = 0.0084), CXCL-6 (P = 0.0141), COX-2 (P = 0.0141), and iNOS (P < 0.0001), while enhancing the secretion of IL-10 (P = 0.0106) (Fig. 2D-K). Based on these results, 25 µM quercetin was selected as the optimal concentration for the subsequent experiments.
Fig. 2.
Quercetin attenuates LPS-induced inflammatory response in lamellar keratinocytes. A Chemical structure of quercetin (C15H10O7). B The cellular metabolic activity of lamellar keratinocytes (passages 2–4) was assessed by CCK-8 assay after treatment with various concentrations of quercetin (0-100 µM) for 24–48 h. C The cellular metabolic activity of keratinocytes co-treated with LPS (10 µg/mL) and quercetin (0–50 µM) for 24 h. D-K Secretion levels of (D) TNF-α, (E) IL-6, (F) IL-1β, (G) IL-10, (H) CXCL-1, (I) CXCL-6, (J) COX-2, and (K) iNOS in cell supernatants, as determined by ELISA. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Quercetin attenuates the LPS-induced inflammatory response by inhibiting the NF-κB signaling pathway in lamellar keratinocytes
To verify whether the inhibitory effects of quercetin on the inflammatory response in lamellar keratinocytes depend on the NF-κB signaling pathway, we used PDTC in subsequent experiments. PDTC (10 µM) (P = 0.0205) significantly reduced p-p65 protein expression (Fig. 3A, B). Compared with the LPS-induced group, 25 µM quercetin significantly downregulated the protein expression of p-p65 (P = 0.0008) and p-IκBα (P = 0.0033) (Fig. 3C, D, and F), while the levels of p65 (P = 0.9962) and IκBα (P > 0.9999) were not significantly altered (Fig. 3C, E, G). Notably, this inhibitory effect was further potentiated when quercetin was combined with PDTC. Specifically, compared with the LPS plus quercetin group, the combination of PDTC and quercetin significantly reduced the secretion and mRNA expression of TNF-α (secretion: P = 0.0001; mRNA: P = 0.0290), IL-6 (secretion: P < 0.0001; mRNA: P < 0.0001), IL-1β (secretion: P < 0.0001; mRNA: P = 0.0002), CXCL-1 (secretion: P = 0.0090; mRNA: P = 0.0433), CXCL-6 (secretion: P = 0.0104; mRNA: P = 0.0010), COX-2 (secretion: P = 0.0005; mRNA: P = 0.0001), and iNOS (secretion: P = 0.0033; mRNA: P = 0.0351) (Fig. 4A-P).
Fig. 3.
Quercetin inhibits the LPS-induced activation of the NF-κB signaling pathway in lamellar keratinocytes. A The protein expression of phosphorylated p65 was detected by Western blot. Lamellar keratinocytes (passages 2–4) were pretreated with 0, 5, 10, and 20 µM pyrrolidinedithiocarbamate (PDTC, an NF-κB inhibitor) for 1 h. B The protein expression of phosphorylated p65 was calculated by densitometric analysis. C The protein expression of p-p65, p65, p-IκBα, and IκBα was detected by Western blot. Keratinocytes were pretreated with or without PDTC (10 µM) for 1 h and subsequently treated with LPS (10 µg/mL) and quercetin (25 µM) for 24 h. D-G The protein expression of (D) p-p65, (E) p65, (F) p-IκBα, and (G) IκBα was calculated by densitometric analysis. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Fig. 4.
Quercetin attenuates LPS-induced inflammatory response by inhibiting the NF-κB signaling pathway. Lamellar keratinocytes (passages 2–4) were pretreated with 10 µM PDTC for 1 h, then treated with LPS (10 µg/mL) and quercetin (25 µM). A-H The secretion of (A) TNF-α, (B) IL-6, (C) IL-1β, (D) IL-10, (E) CXCL-1, (F) CXCL-6, (G) COX-2, and (H) iNOS in cell supernatants was detected by ELISA. I-P The mRNA expression of (I) TNF-α, (J) IL-6, (K) IL-1β, (L) IL-10, (M) CXCL-1, (N) CXCL-6, (O) COX-2, and (P) iNOS was determined with RT-qPCR. The data are presented as mean ± standard deviation from three independent biological replicates. The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Overexpression of Akt restores the NF-κB signal transduction reduced by quercetin
To clarify whether the inhibitory effect of quercetin on the NF-κB pathway depends on Akt, we transiently transfected keratinocytes with pcDNA3.1-Akt overexpression plasmid. As shown in Fig. 8A-C, compared with the empty vector control (pcDNA3.1), the mRNA (P = 0.0002) and protein (P = 0.0098) expression of Akt were significantly increased in the pcDNA3.1-Akt group. Next, we evaluated the effect of quercetin on the PI3K/Akt pathway. Compared to the LPS-induced group, quercetin significantly downregulated the protein expression of p-PI3K (P = 0.0119) and p-Akt (P = 0.0031) (Fig. 5D, E, and G), whereas the total protein levels of PI3K (P = 0.9996) and Akt (P = 0.7601) remained unaltered (Fig. 5D, F, H). Quercetin also significantly reduced the mRNA expression of both PI3K (P = 0.0008) and Akt (P = 0.0005) (Fig. 5I, J). Compared with the LPS plus quercetin group, the overexpression of Akt not only elevated Akt levels but also increased the protein expression of p-p65 (P = 0.0019) and p-IκBα (P = 0.0065) (Fig. 5K, L, and N), along with increased mRNA expression of p65 (P < 0.0001) and IκBα (P < 0.0001) (Fig. 5P, Q). Furthermore, overexpression of Akt increased the secretion and mRNA expression of TNF-α (secretion: P < 0.0001; mRNA: P = 0.0003), IL-6 (secretion: P < 0.0001; mRNA: P < 0.0001), IL-1β (secretion: P = 0.0004; mRNA: P < 0.0001), CXCL-1 (secretion: P = 0.0095; mRNA: P = 0.0086), CXCL-6 (secretion: P = 0.0036; mRNA: P = 0.0049), COX-2 (secretion: P = 0.0090; mRNA: P < 0.0001), and iNOS (secretion: P = 0.0174; mRNA: P = 0.0003) (Fig. 6A-P).
Fig. 8.
Combined Akt silencing and quercetin treatment further reduces the expression of inflammatory cytokines in LPS-induced lamellar keratinocytes. Lamellar keratinocytes (passages 2–4) were transfected with si-Akt or siRNA negative control (si-NC) for 36 h, then treated with LPS (10 µg/mL) and quercetin (25 µM) for 24 h. A-H The secretion of (A) TNF-α, (B) IL-6, (C) IL-1β, (D) IL-10, (E) CXCL-1, (F) CXCL-6, (G) COX-2, and (H) iNOS in cell supernatants was detected by ELISA. I-P The mRNA expression of (I) TNF-α, (J) IL-6, (K) IL-1β, (L) IL-10, (M) CXCL-1, (N) CXCL-6, (O) COX-2, and (P) iNOS was determined with RT-qPCR. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Fig. 5.
Overexpression of Akt restores the NF-κB signal transduction reduced by quercetin. Lamellar keratinocytes (passages 2–4) were transfected with the Akt overexpression plasmid (pcDNA3.1-Akt) or the empty vector control (pcDNA3.1) for 36 h, then treated with LPS (10 µg/mL) and quercetin (25 µM) for 24 h. A The mRNA expression of Akt was determined with RT-qPCR. B The protein expression of Akt was detected by Western blot. C The protein expression of Akt was calculated by densitometric analysis. (D) The protein expression of p-PI3K, PI3K, p-Akt, and Akt was detected by western blotting. E-H The protein expression of (E) p-PI3K, (F) PI3K, (G) p-Akt, and (H) Akt. (I, J) The mRNA expression of (I) PI3K and (J) Akt was determined with RT-qPCR. K The protein expression of p-p65, p65, p-IκBα, and IκBα was detected by Western blot. L-O The protein expression of (L) p-p65, (M) p65, (N) p-IκBα, and (O) IκBα was calculated by densitometric analysis. P, Q The mRNA expression of (P) p65 and (Q) IκBα was determined with RT-qPCR. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Fig. 6.
Overexpression of Akt weakens the inhibitory effect of quercetin on LPS-induced inflammatory response in lamellar keratinocytes. Lamellar keratinocytes (passages 2–4) were transfected with the Akt overexpression plasmid (pcDNA3.1-Akt) or the empty vector control (pcDNA3.1) for 36 h, then treated with LPS (10 µg/mL) and quercetin (25 µM) for 24 h. A-H The secretion of (A) TNF-α, (B) IL-6, (C) IL-1β, (D) IL-10, (E) CXCL-1, (F) CXCL-6, (G) COX-2, and (H) iNOS in cell supernatants was detected by ELISA. I-P The mRNA expression of (I) TNF-α, (J) IL-6, (K) IL-1β, (L) IL-10, (M) CXCL-1, (N) CXCL-6, (O) COX-2, and (P) iNOS was determined with RT-qPCR. The data are presented as mean ± standard deviation from three independent biological replicates (n = 3). The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Silencing of Akt further reduces the NF-κB signal transduction inhibited by quercetin
To further confirm that quercetin’s inhibitory effect on the NF-κB pathway is dependent on Akt, we transiently transfected lamellar keratinocytes with Akt small interfering RNA (si-Akt) or negative control siRNA (si-NC). As shown in Fig. 7A-C, compared with the si-NC group, the si-Akt group showed a significant reduction in Akt mRNA (P = 0.0096) and protein (P = 0.0045) expression (Fig. 7A, B, and C), confirming successful Akt knockdown. Subsequently, we analyzed the impact of Akt silencing on quercetin’s regulatory effect. Compared with the LPS plus quercetin group, the si-Akt with LPS plus quercetin group significantly decreased Akt protein expression (P < 0.0001) (Fig. 7D, G, and H) and mRNA expression (P < 0.0001) (Fig. 7J). Relative to the LPS plus quercetin group, the si-Akt with LPS plus quercetin group not only showed lower total Akt levels but also exhibited significantly decreased protein expression of p-p65 (P < 0.0001) and p-IκBα (P = 0.0023) (Fig. 7K, L, N), as well as reduced mRNA expression of p65 (P = 0.0005) and IκBα (P = 0.0006) (Fig. 7P, Q). Consistent with the potentiated pathway inhibition, Akt silencing further amplified quercetin’s anti-inflammatory effect. Specifically, compared with the LPS plus quercetin group, the si-Akt with LPS plus quercetin group showed significantly reduced secretion and mRNA expression of TNF-α (secretion: P = 0.0004; mRNA: P = 0.0112), IL-6 (secretion: P = 0.0246; mRNA: P = 0.0465), IL-1β (secretion: P < 0.0001; mRNA: P = 0.0093), CXCL-1 (secretion: P = 0.0044; mRNA: P = 0.0495), CXCL-6 (secretion: P = 0.0333; mRNA: P = 0.0079), COX-2 (secretion: P = 0.0458; mRNA: P = 0.0337), and iNOS (secretion: P = 0.0369; mRNA: P = 0.0247) (Fig. 8A-P).
Fig. 7.
Silencing of Akt further reduces the NF-κB signal transduction inhibited by quercetin. Lamellar keratinocytes (passages 2–4) were transfected with si-Akt or siRNA negative control (si-NC) for 36 h, then treated with LPS (10 µg/mL) and quercetin (25 µM) for 24 h. A The mRNA expression of Akt was determined with RT-qPCR. B The protein expression of Akt was detected by Western blot. C The protein expression of Akt was calculated by densitometric analysis. D The protein expression of p-PI3K, PI3K, p-Akt, and Akt was detected by Western blot. E-H The protein expression of (E) p-PI3K, (F) PI3K, (G) p-Akt, and (H) Akt was calculated by densitometric analysis. I, J The mRNA expression of (I) PI3K and (J) Akt was determined with RT-qPCR. K The protein expression of p-p65, p65, p-IκBα, and IκBα was detected by western blotting. L-O The protein expression of (L) p-p65, (M) p65, (N) p-IκBα, and (O)IκBα was calculated by densitometric analysis. P, Q The mRNA expression of (P) p65 and (Q) IκBα was determined with RT-qPCR. The data are presented as mean ± standard deviation from three independent biological replicates. The symbol “+” in the diagram indicates the addition of a substance, while “-” denotes no addition. The symbol * indicates P < 0.05, and ** indicates P < 0.01
Discussion
In recent years, medicinal plants have garnered widespread attention as alternative pharmaceuticals or dietary supplements in livestock production, owing to their multi-target characteristics and low toxicity [23]. This provides an innovative approach for utilizing medicinal plants to control laminitis. Numerous studies have demonstrated that quercetin possesses marked anti-inflammatory effects in various inflammatory diseases [24, 25]. In an earlier study, dietary quercetin supplementation was shown to alleviate inflammation within the lamellar tissue, which is a process implicated in the development of chronic claw horn lesions such as white line disease and sole ulcers [8]. Building on these findings, the present study aimed to investigate the potential molecular mechanism by which quercetin alleviates the LPS-induced inflammatory response in lamellar keratinocytes (passages 2–4).
Keratinocytes serve as essential supporting cells in lamellar tissue and exhibit the most obvious pathological changes during laminitis development [26]. Lamellar keratinocytes are susceptible to activation by inflammatory factors and neutrophils, triggering excessive production of inflammatory factors and initiating a destructive inflammatory cascade [27, 28]. In the context of pre-existing degenerative damage, keratinocytes may transition into a pro-inflammatory state, contributing to a secondary phase of tissue injury. Consequently, keratinocytes represent an ideal in vitro model for studying the pathogenesis and therapeutic interventions of laminitis. In previous studies, keratinocytes have been successfully isolated from equine hooves using explant cultures, with their phenotype identity confirmed by measuring anti-pan cytokeratin (AE1/AE3) expression using cellular immunofluorescence and western blotting [29, 30]. Consistent with these reports, our study successfully isolated keratinocytes with characteristic cobblestone morphology from dairy cow lamellar tissue. These cells exhibited positive staining for pan-cytokeratin AE1/AE3 and displayed typical intercellular desmosomal connections, confirming their epithelial origin. This validates the reliability of our in vitro model and lays a solid foundation for subsequent mechanistic investigations.
The elevated levels of LPS in the plasma of dairy cows suffering from laminitis exacerbate the inflammatory response and tissue damage [31]. LPS has been identified as a pivotal pathogenic factor contributing to the development of laminitis. Previous studies have shown that LPS compromises the integrity of claw tissue and initiates an inflammatory response in claw explants [32, 33]. In the present study, an in vitro inflammation model was constructed by stimulation of lamellar keratinocytes with LPS. Our results showed that LPS at a concentration of 10 µg/mL significantly promoted the secretion of pro-inflammatory factors, including TNF-α, IL-6, and IL-1β. Notably, in the early stage of laminitis, the mRNA expression of inflammatory factors IL-1β, IL-6, and COX-2 was significantly upregulated [34]. Consistent with this, we observed a marked increase in the mRNA expression of TNF-α, IL-1β, and COX-2 in LPS-induced keratinocytes. Quercetin is widely reported to exert anti-inflammatory effects by modulating the expression of inflammatory factors in a multitude of inflammatory diseases. For example, quercetin exerts anti-inflammatory effects by decreasing the expression of TNF-α, IL-6, and IL-1β in the LPS-induced mammary epithelial cells [35]. Additionally, COX-2 and iNOS have been identified as key molecular targets of quercetin’s anti-inflammatory effects [36, 37]. In line with these findings, our study showed that 25 µM quercetin, an effective concentration that maintained acceptable keratinocyte viability, significantly downregulated the mRNA expression of pro-inflammatory factors (TNF-α, IL-6, IL-1β), chemokines (CXCL-1, CXCL-6), and inflammatory mediators (COX-2, iNOS). Quercetin exerts anti-inflammatory effects by decreasing the mRNA expression of TNF-α and IL-1β while increasing that of IL-10 in LPS-induced periodontal inflammation [38]. Consistent with this anti-inflammatory pattern, our findings indicate that quercetin suppresses inflammatory cytokines (TNF-α, IL-6, IL-1β, CXCL-1, CXCL-6, COX-2, iNOS) to alleviate LPS-induced inflammatory responses in bovine lamellar keratinocytes (passages 2–4), and simultaneously increases the expression of the anti-inflammatory cytokine IL-10.
The NF-κB signaling pathway is well-recognized as a crucial regulator of inflammatory responses and a central mediator of signal transduction in numerous diseases [39, 40]. Under external stimulation, the inhibitory molecule IκB undergoes phosphorylation, which enables nuclear translocation of p65 NF-κB and subsequent transcriptional activation of inflammatory factors, thereby initiating inflammatory responses [41]. The results of this study indicate that quercetin significantly downregulates the mRNA levels of molecules in the PI3K/Akt and NF-κB signaling pathways (PI3K, Akt, p65, and IκBα), while simultaneously inhibiting the expression of their phosphorylated proteins p-PI3K, p-Akt, p-p65, and p-IκBα. Notably, the total protein levels of these signaling molecules showed no significant changes. Our results showed that in the LPS plus quercetin group, the secretion and mRNA expression of pro-inflammatory factors (TNF-α, IL-6, IL-1β, CXCL-1, CXCL-6, COX-2, and iNOS) were significantly decreased, while those of the anti-inflammatory cytokine IL-10 were increased. These findings suggest that quercetin suppresses the activation of inflammatory signaling pathways by downregulating protein phosphorylation. The total expression of related signaling proteins remained stable despite a reduction in the transcriptional levels of their corresponding genes, which may be attributed to a compensatory downregulation of protein degradation rates to buffer against the diminished synthesis, thereby preserving the steady-state levels of key signaling components. The inhibitory effect of quercetin on signal protein phosphorylation is consistent with its efficacy in vivo models [8], further supporting its mechanism of anti‑inflammatory effect. Furthermore, co-treatment with PDTC potentiated the inhibitory effect of quercetin on both pathway activation and inflammatory factor production. These results collectively suggest that quercetin exerts its anti-inflammatory effects by suppressing the NF-κB signaling pathway. Previous studies have demonstrated that quercetin can suppress LPS-induced inflammatory response by downregulating the expression of inflammatory factors in bovine rumen epithelial cells through the TLR4/NF-κB signaling pathway [42]. The findings of the present study correspond with previous literature, indicating that quercetin modulates the expression of inflammatory factors by inhibiting the activation of the NF-κB pathway, thereby exerting a potent anti-inflammatory effect. The findings of the present study correspond with previous literature, indicating that quercetin exerts its anti-inflammatory effect not only by inhibiting the NF-κB pathway and downstream pro-inflammatory factors but also by increasing the expression of the anti-inflammatory cytokine IL-10.
To elucidate the molecular mechanism by which quercetin regulates the inflammatory response of lamellar keratinocytes via the PI3K/Akt/NF-κB pathway, we employed gene overexpression and RNA interference techniques to establish Akt gene gain-of-function and loss-of-function models, respectively. The PI3K/Akt signaling pathway plays a key regulatory role in several pro-inflammatory cascades, such as the TLR-mediated NF-κB pathway, cytokine receptor signaling, and tyrosine kinase receptor pathways, thereby contributing to the production of proinflammatory cytokines [43]. Specifically, activated Akt stimulates IκB kinase α (IKKα), leading to IκB degradation. This degradation releases NF-κB p65, enabling its nuclear translocation and subsequent transcriptional activation of downstream inflammatory factors [44]. Recent studies have further confirmed that quercetin mitigates lung injury by reducing pro-inflammatory factors (TNF, IL-1β, and IL-6) production through inhibiting the PI3K/Akt/NF-κB signaling pathway [45]. Consistent with these findings, our results demonstrated that quercetin decreased the expression level of p-Akt in LPS-induced lamellar keratinocytes. Importantly, overexpression of Akt significantly attenuated the inhibitory effects of quercetin on the NF-κB pathway, pro-inflammatory factors (TNF-α, IL-6, IL-1β), chemokines (CXCL-1, CXCL-6), and inflammatory mediators (COX-2 and iNOS). In contrast, Akt silencing exerted the opposite effect, further enhancing quercetin’s inhibitory role. These findings indicate that quercetin exerts anti-inflammatory effects in LPS-induced keratinocytes by modulating the PI3K/Akt/NF-κB signalling pathway, thereby suppressing the expression of inflammatory cytokines (TNF-α, IL-6, IL-1β, CXCL-1, CXCL-6, COX-2, iNOS) while promoting the expression of the anti-inflammatory cytokine IL-10. The anti-inflammatory cytokine IL-10 not only exerts direct anti-inflammatory effects but also promotes the polarization of macrophages from a pro-inflammatory (M1) toward an anti-inflammatory, reparative (M2) phenotype, potentially playing a crucial role in facilitating tissue repair.
The present study has certain limitations that should be acknowledged. This study employed an in vitro model using LPS-stimulated lamellar keratinocytes. While this model effectively isolates and investigates the intrinsic inflammatory response of keratinocytes and the anti-inflammatory mechanism of quercetin, it cannot fully replicate the complex, multifactorial pathogenesis of subclinical laminitis in vivo, which involves systemic metabolic disturbances, vascular changes, and interactions among multiple cell types. Furthermore, our investigation focused on the PI3K/Akt/NF-κB pathway, and we acknowledge that other signaling pathways may also contribute to the inflammatory process. Consequently, the therapeutic potential of quercetin suggested by this work requires further validation.
Conclusion
In conclusion, the present study demonstrated that quercetin protects dairy cow lamellar keratinocytes against LPS-induced inflammatory response. The underlying mechanism involves the inhibition of the PI3K/Akt/NF-κB signaling pathway, which in turn reduces the secretion and mRNA expression of pro-inflammatory factors (TNF-α, IL-6, IL-1β), chemokines (CXCL-1, CXCL-6), and inflammatory mediators (COX-2, iNOS). These findings confirm that quercetin holds promise as a potential therapeutic agent for dairy cow laminitis. However, it is important to mention that this study employed a two-dimensional (2D) keratinocyte model, and the pathogenesis of laminitis in vivo is a greater complexity, involving a multifactorial process that engages multiple cell types and signaling cascades at the dermal-epidermal interface. Therefore, further studies are warranted to validate the therapeutic potential of quercetin.
Methods
Chemicals and reagents
LPS (L2637, Escherichia coli 055: B5) and quercetin (Q4951, purity ≥ 95%, molecular weight = 302.236, CAS: 117-39-5) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The ELISA kits of TNF-α (JM-08321B1), IL-6 (JM-00561B1), IL-1β (JM-00567B1), IL-10 (JM-00568B1), COX-2 (JM-08484B1), iNOS (JM-08419B1), CXCL-1 (JM-08574B1), and CXCL-6 (JM-08583B1) were purchased from Jingmei Biotechnology (Jiangsu, China). The primary antibody against pan-cytokeratin AE1/AE3 (sc-81714, 1:200) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and the FITC-conjugated goat anti-mouse IgG secondary antibody (AB150113, 1:500) was from Abcam (Cambridge, MA, USA). Cell counting kit-8 (CCK-8, CA1210), RIPA cell lysis buffer (R0010), and BCA protein assay kit (PC0020) were acquired from Solarbio (Beijing, China). The reverse transcription was performed using reagents (RR037B) from Takara (Kyoto, Japan), and quantitative PCR was carried out using 2×SYBR Green qPCR master mix (B21203) from Selleck (Houston, Texas, USA). Primary antibodies PI3K (#4257, 1:1000), phospho-PI3K (#4228, 1:1000), phospho-Akt (#4060, 1:2000), NF-κB p65 (#8242, 1:1000), phospho-NF-κB p65 (#3033, 1:1000), IκBα (#4814, 1:1000) and phospho-IκBα (Ser32/36) (#9246, 1:1000) were acquired from Cell Signaling Technology (Danvers, MA, USA), and Akt (10176-2-AP, 1:5000), the rabbit anti-GAPDH (10494-1-AP, 1:5000) and mouse anti-GAPDH (60004-1-Ig, 1:5000) were purchased from Proteintech Biotechnology (Wuhan, China).
Isolation and culture of primary lamellar keratinocytes
Based on the methods reported in previous studies [26], primary keratinocytes from the lamellar tissue of dairy cows were isolated from 6 clinically healthy, non-lame Holstein dairy cows. These cows, aged 2–3 years with a body weight of 550–620 kg, were sourced from a local slaughterhouse (Nanning, China). The lateral and medial claws of the hind limbs from each cow were collected. These claws were selected based on the absence of macroscopic lesions, severe overgrowth, or acute trauma, and were processed for cell isolation and culture in three technical replicates. Dairy cow claws were thoroughly cleaned to remove surface impurities. Then they were completely immersed in a 10% chlorhexidine acetate solution for 10 min and washed with PBS (phosphate buffered saline) three times to eliminate residual disinfectant. Briefly, the dairy cow’s claws were thoroughly cleaned. A sterile saw is employed to make an incision along the edges of the claw wall and sole, creating a trapezoidal opening. The lamellar tissue (a specialized, densely folded tissue located on the inner surface of the claw wall) was then carefully peeled off with a sterile scalpel blade. During the procedure of peeling lamellar tissue, the tissue was continuously washed with PBS containing 5% penicillin-streptomycin to remove blood contaminants. The harvested lamellar tissue was washed in 75% ethanol, immersed in PBS containing 5% penicillin-streptomycin, and promptly transferred to the cell culture laboratory for further processing. Then, the lamellar tissue was carefully peeled off with a sterile scalpel blade and cut into 1 cm³ tissue blocks. The tissue blocks were placed in 0.3% neutral protease solution and digested at 4 ℃ overnight to loosen the intercellular connections. Under a dissection microscope, the epidermal lamellar tissue was meticulously separated from the underlying dermal connective tissue to minimize contamination by dermal fibroblasts. The epidermal lamellar tissue was cut into a paste by sterile scissors and digested with 0.25% trypsin [30]. The cell suspension was filtered through a cell sieve to remove undigested tissue debris, and the filtrate (containing primary lamellar keratinocytes) was collected. The isolated cells were seeded into T-25 culture flasks and cultured in 5 mL of Keratinocyte-Serum Free Medium (KSFM, Gaithersburg, MD, USA) supplemented with 1% penicillin-streptomycin (100 U/mL penicillin and 100 µg/mL streptomycin). The cells were maintained at 37 °C in a 5% CO₂ atmosphere. Primary keratinocytes typically reached approximately 80% confluency within about 7 days of initial seeding. To minimize fibroblast contamination during passaging, a combination of differential digestion and differential adhesion techniques was employed. The culture medium was aspirated, and the cell monolayer was rinsed once with 2 mL of pre-warmed PBS. After adding 1 mL of 0.25% trypsin-EDTA solution, the T-25 culture flask was gently swirled to ensure coverage and incubated at 37 °C for 60–90 s. The enzymatic reaction was immediately stopped by adding 2 mL of complete KSFM medium. The cell suspension containing predominantly detached fibroblasts was then aspirated and discarded. The same flask received an additional 1 mL of 0.25% trypsin-EDTA solution. The culture flask was returned to the incubator for approximately 4 min for microscopic observation. The digestion was terminated by adding 2 mL of complete KSFM medium once the majority of the keratinocytes had detached. The collected cell suspension was centrifuged at 1500 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in 5 mL of pre-warmed KSFM medium. Then, the suspension was transferred at a density of 1 × 10⁴ cells/cm² to a new T-25 culture flask and incubated at 37 °C in a 5% CO₂ incubator. After 1 h of culture, the suspension of non-adherent cells was carefully collected from the culture flask. The suspension was centrifuged again (at 1500 rpm for 5 min), and the supernatant was discarded. Finally, the keratinocytes were resuspended and seeded in KSFM medium. The term ‘lamellar keratinocytes’ in this study refers to primary keratinocytes isolated from the epidermal layer of the lamellar tissue of bovine claws. For all subsequent experiments, cells were used at passages 2–4 to ensure adequate cell numbers while maintaining phenotypic stability and minimizing replicative senescence or fibroblast overgrowth.
Cellular immunofluorescence staining
The lamellar keratinocytes (passages 2–4) were seeded into a 24-well cell plate (NEST, Jiangsu, China) at a density of 2 × 104 cells per well and cultured for 3 days to achieve 80% confluence. The adherent cells were fixed in 4% paraformaldehyde at room temperature for 30 min, and then washed with PBS three times. The lamellar keratinocytes were incubated with 0.1% Triton X-100 (Sigma-Aldrich, St. Louis, Missouri, USA) at room temperature for 10 min. Then, the keratinocytes were incubated at 4 ℃ overnight with a mouse-sourced primary antibody against pan-cytokeratin AE1/AE3 (Santa Cruz Biotechnology, California, USA). Cells were then washed three times with TBST (Tris-buffered saline containing 0.1% Tween 20) for 5 min each. Then the FITC-conjugated goat anti-mouse immunoglobulin G (IgG) (Abcam, Cambridge, UK) was added to keratinocytes, which were incubated at room temperature for 1 h. After washing three times with TBST, cells were stained with 10 µg/mL of DAPI (Sigma-Aldrich, St. Louis, Missouri, USA) at room temperature for 10 min to label cell nuclei. Then, cells were washed three times with TBST. Cellular immunofluorescence photographs were captured using a fluorescence microscope (Nikon Ti-S, Tokyo, Japan). In the images, DAPI-stained positive nuclei appeared blue, and AE1/AE3-positive signals (indicating keratinocytes) appeared green.
Transmission electron microscopy (TEM) observation
For lamellar keratinocytes (passages 2–4), 4% glutaraldehyde was added to the cell culture dish, and the fixed cell samples were collected. After washing in PBS, cell samples were post-fixed in 1% wt/v OsO4 for 2 h, dehydrated in gradient solutions of ethanol, and embedded in Epon. Sections were prepared to a thickness of 50 nm using an ultramicrotome and stained with lead citrate and uranyl acetate. Finally, these sections were observed and photographed with transmission electron microscopy (Hitachi, Japan) at an accelerating voltage of 80 kV with a magnification of 7.0 K.
Cell treatment
The lamellar keratinocytes (passages 2–4) were seeded into 96-well plates at a density of 5 × 103 cells/well and cultured for 3 days to achieve 80% confluence. The cells were then treated with different concentrations of LPS (0, 1, 2, 5, 10, and 20 µg/mL) for 12 h, 24 h, or 48 h, respectively. After treatment, cell viability and the secretion of inflammatory factors were detected. Finally, 10 µg/mL was chosen as the LPS’s experimental concentration based on the results. The standard substance of quercetin (purity ≥ 95%, Sigma-Aldrich, St. Louis, Missouri, USA) was diluted in DMSO (Sangon Biotech, Shanghai, China), and it was prepared as a storage solution at a concentration of 10 mM. To investigate the protective effects of quercetin on keratinocytes treated with LPS, cells were treated with LPS (10 µg/mL) and different concentrations of quercetin (0, 6.25, 12.5, 25, 50, and 100 µM) for 12–24 h. Finally, 25 µM was chosen as the quercetin experimental concentration based on the results of cell viability and inflammatory factor secretion. For experiments investigating the NF-κB pathway, keratinocytes were pretreated with 10 µM PDTC (Abcam, an NF-κB inhibitor, Cambridge, UK) for 1 h, then treated with LPS (10 µg/mL) and quercetin (25 µM).
Cellular metabolic activity assay
Cellular metabolic activity was measured using the CCK-8 kits (Solarbio, Beijing, China) according to the manufacturer’s instructions. Briefly, lamellar keratinocytes (passages 2–4) were seeded into 96-well plates at a density of 5 × 103 cells/well and cultured to 80% confluence. After undergoing the treatment, 10 µL of CCK-8 reagent and 100 µL of culture medium were added to each well. The 96-well plates were transferred to a 5% CO2 incubator for 1 h. A microplate reader (Thermo Fisher Scientific, Massachusetts, USA) was used to measure the absorbance of each well at a wavelength of 450 nm. Cellular metabolic activity was calculated as follows: Cellular metabolic activity (%) = [A (drug) – A (blank)] / [A (control) – A (blank)] × 100. A (drug): Absorbance of wells with cells, CCK-8, and the test compound. A (control): Absorbance of control wells with cells and CCK-8 (untreated). A (blank): Absorbance of blank wells with culture medium and CCK-8 only (no cells). Data were obtained from three independent experiments, each performed with technical triplicates.
Enzyme-linked immunosorbent assay (ELISA)
The secretion levels of target molecules in cell culture supernatants, including pro-inflammatory factors (TNF-α, IL-6, IL-1β), anti-inflammatory factor (IL-10), inflammatory mediators (COX-2, iNOS), and chemokines (CXCL-1, CXCL-6) were measured by the bovine-sourced ELISA kits (Jingmei Biotechnology, Jiangsu, China) according to the manufacturer’s instructions. Briefly, the procedure included the addition of the supernatants, incubation, washing, addition of the enzyme, further incubation, washing again, color development, and the termination of the reaction. The absorbance values were determined at 450 nm by a microplate reader, and the concentrations of inflammatory factors were calculated by their standard curves. Data were obtained from three independent experiments, each performed with technical triplicates.
Transient transfection for Akt knockdown (siRNA) and overexpression in keratinocytes
Akt-specific siRNA (targeting the Akt mRNA coding region) and negative control siRNA (Table S1) were synthesized by Gene Pharma Co., Ltd. (Shanghai, China). Transfection was performed using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Briefly, the si-Akt construct was diluted in Opti-MEM (Invitrogen, Carlsbad, CA) and mixed with an equal volume of Lipofectamine. The mixtures were incubated at room temperature for 15–20 min to allow for the formation of siRNA-lipid complexes. The complexes were added dropwise to the culture medium of lamellar keratinocytes (passages 2–4) and were mixed thoroughly. Following a 4 h incubation period, half of the medium was discarded and replaced with fresh, antibiotic-free medium to mitigate potential cytotoxicity from prolonged exposure to the transfection reagents. After 36 h of culture, the amplification efficacy and specificity of si-Akt in keratinocytes were examined by RT-qPCR and Western Blotting.
The bovine Akt gene sequence was synthesized by Sangon Biotec Co., Ltd. according to the published data on the GenBank website (NM_173986.2). The empty pcDNA3.1 vector was constructed by Wuhan Miaoling Biotechnology Co., Ltd. The Akt gene was amplified by polymerase chain reaction (PCR) and cloned into the pcDNA3.1 vector. Its primer sequences are shown in Table S2. The recombinant pcDNA3.1-Akt plasmid was transformed into competent Escherichia coli cells for amplification. Plasmids were extracted using the MagMAX™ Pro HT NoSpin Plasmid Purification Kit (A58310, Thermo Fisher Scientific, Massachusetts, USA) following the manufacturer’s instructions. The concentration and purity of the recombinant plasmid were determined using a Nano Drop ND − 2000 spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). The recombinant pcDNA3.1-Akt plasmid was transfected similarly to the siRNA transfection. Data were obtained from three independent experiments, each performed with technical triplicates.
Quantitative real-time polymerase chain reaction (RT-qPCR) analysis
Total RNA was extracted from lamellar keratinocytes (passages 2–4) using TRIzol reagent following the manufacturer’s instructions (Invitrogen, 15596026CN, Carlsbad, CA). The concentrations and purity of total RNA were detected using a NanoDrop ND-2000 spectrophotometer (ThermoFisher Scientific, Massachusetts, USA), with an OD260/280 value ranging between 1.8 and 2.0. Following the reverse transcription (RT) reagents kits (Takara, Kyoto, Japan) manufacturer’s protocol, total RNA (500 ng) per sample was converted into first-strand complementary DNA (cDNA). Quantitative real-time PCR was performed on a Light Cycler 96 Real-Time Fluorescent Quantitative PCR Instrument (Roche, Basel, Switzerland) using a 2×SYBR Green qPCR master mix (Selleck, Houston, Texas, USA). The reaction program was as follows: pre-denaturation (94 ℃, 2 min), followed by 40 cycles of denaturation (94 ℃, 15 s), annealing (60 ℃, 15 s), and extension (72 ℃, 25 s, fluorescence signal acquisition). All reactions were conducted in triplicate. The relative mRNA expression levels of target genes were calculated using the 2−ΔΔCT method, with GAPDH serving as the housekeeping gene [46, 47]. The expression stability of the reference gene GAPDH was confirmed across all experimental groups by one-way ANOVA (P > 0.05) (Fig.S1). The primer sequences for all target genes were designed using NCBI Primer-BLAST. The specificity of each primer pair was verified using Primer-BLAST and experimentally by a single, sharp peak in the post-run melting curve analysis. The efficiencies for all genes are greater than 96%, and the correlation coefficients (R²) were all greater than 0.99, indicating highly efficient and reliable amplification (Table. S3). The sequences of the specific primers used for each target gene are listed in Table 1. Data were obtained from three independent experiments, each performed with technical triplicates.
Table 1.
Primer sequences of targeted genes and GAPDH
| Gene | GenBank accession number | Primer sequences (5’–3’) | Product size (bp) |
|
|---|---|---|---|---|
| TNF-α | NM_173966.3 | CCAGAGGGAAGAGCAGTCCC | 114 | |
| TCGGCTACAACGTGGGCTAC | ||||
| IL-1β | NM_174093 | ATTCTCTCCAGCCAACCTTCATT | 100 | |
| TTCTCGTCACTGTAGTAAGCCATCA | ||||
| IL-6 | NM_173923 | ATGACTTCTGCTTTCCCTACCC | 180 | |
| GCTGCTTTCACACTCATCATTC | ||||
| IL-10 | NM_174088.1 | ACAGGCTGAGAACCACGGGC | 175 | |
| GACACCCCTCTCTTGGAGCTCACT | ||||
| CXCL-1 | NM_175700.2 | CATCCAGAGCGTGAAGGTGA | 100 | |
| GGTGGGGTTGAGACACACTT | ||||
| CXCL-6 | NM_174300.2 | TGAGAGAGCTGCGTTGTGTG | 119 | |
| GGTGGCTATCACTTCCACCT | ||||
| COX-2 | AF031698 | ATCTACCCGCCTCATGTTCCT | 187 | |
| GGATTAGCCTGCTTGTCTGGA | ||||
| iNOS | XM_024979646.1 | CAGGATGACCCCAAACGTCA | 190 | |
| CCTTCTGGTGAAGCGTGTCT | ||||
| p65 | NM_001080242.2 | CTCACCCCATCTTTGACAACC | 152 | |
| TCCCGTGAAATACACCTCGAT | ||||
| IκBα | NM_001045868.1 | TGTGATCCTGAGCTGCGAGAC | 190 | |
| TGCCCAGGTAGCCATGAATAG | ||||
| Akt | NM_173986.2 | AAAAGGAAGTGGTGTACAGG | 80 | |
| GAAGTCGGTGATCTTGATGT | ||||
| PI3K | NM_174575.1 | ACACAGCTGACGGGACCTTT | 127 | |
| CCATATTTCCCATCTCGGTGA | ||||
| GAPDH | NM_001034034.2 | CCCAGAATATCATCCCTGCT | 185 | |
| CTGCTTCACCACCTTCTTGA | ||||
Western blotting analysis
Total protein was extracted from lamellar keratinocytes (passages 2–4) using radio-immunoprecipitation assay buffer supplemented with phosphatase inhibitors and phenylmethanesulfonyl fluoride (PMSF). The concentration of total protein was measured using a bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, Massachusetts, USA). Equal amounts of protein samples (20 µg per lane) were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels for separation. After electrophoresis, the resolved proteins were transferred onto polyvinylidene difluoride (PVDF) membranes. Subsequently, the membranes were blocked with 5% skimmed milk at room temperature for 2 h. The blocked membranes were washed three times with TBST and then incubated with primary antibodies at 4 ℃ overnight. The next day, the membranes were washed three times with TBST again, then incubated with the horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam, Cambridge, UK) at 37 ℃ for 2 h. After a final set of three TBST washes, protein signals were visualized using an enhanced chemiluminescence (ECL) detection kit (Millipore, Bedford, MA). The intensity of the target protein bands was quantified using ImageJ software. The relative expression level of each target protein was normalized to the expression level of the internal reference protein GAPDH to correct for variations in protein loading. Data were obtained from three independent experiments, each performed with technical triplicates.
Statistical methods
The normality of data distribution was verified using the Shapiro-Wilk test, and the homogeneity of variances was confirmed using the Brown-Forsythe test. All data met the assumptions for parametric analysis. All experimental data were presented as mean value ± standard deviation (mean ± SD). Statistical comparisons between multiple groups were conducted using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. P < 0.05 was considered statistically significant, and P < 0.01 was considered highly significant. All statistical analyses were performed using GraphPad Prism 9.0 software (GraphPad Software Inc., San Diego, California, USA). The symbol “*” indicates P < 0.05; “**” indicates P < 0.01.
Supplementary Information
Acknowledgements
Not applicable.
Authors’ contributions
Conceptualization, C-h. Z and J-f. D; Methodology, C-h. Z, Q-s. W, L. L, and S-m. X; Validation, C-h. Z, Q-s. W, X-n. Y, J. M, and S-m. X; Formal analysis, C-h. Z and Y-l. X; Investigation, C-h. Z, Q-s. W, J. M, L. L, and S-m. X; Resources, G-h. L, J-f. D, and S-m. X; Data curation, C-h. Z, J. M, L. L, and W-d. W; Writing—original draft preparation, C-h. Z; Writing—review & editing, C-h. Z, G-h. L, J-f. D, Q-s. W, and S-m. X; Visualization, X-n. Y and Y-l. X; Supervision, G-h. L, J-f. D, and W-d. W; Project administration, G-h. L and J-f. D; Funding acquisition, G-h. L and J-f. D.
Funding
This study was supported by the National Key Research and Development Program of China (No. 2024YFD1301303), the Guangxi Key Research and Development Plan (AB241484045), the “14th Five-Year Plan” Project of Fangchenggang Science and Technology Program (Fangke 24BB108460), Guangxi Special Program on Talent raining for Agriculture and Rural Revitalization (GXQNTJ242127).
Data availability
This article contains the data presented in the present research.
Declarations
Ethics approval and consent to participate
The Animal Ethics Committee of Guangxi University approved this study (No. GXU-2023-0207). Written informed consent was obtained from participating farm owners prior to the commencement of this study.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Changhong Zhai and Qingsong Wu contributed equally to this work and should be regarded as co-first authors.
References
- 1.Schöpke K, Weidling S, Pijl R, Swalve HH. Relationships between bovine hoof disorders, body condition traits, and test-day yields. J Dairy Sci. 2013;96:679–89. [DOI] [PubMed] [Google Scholar]
- 2.Dolecheck K, Bewley J. Animal board invited review: dairy cow lameness expenditures, losses and total cost. Animal. 2018;12:1462–74. [DOI] [PubMed] [Google Scholar]
- 3.Tarlton JF, Holah DE, Evans KM, Jones S, Pearson GR, Webster AJF. Biomechanical and histopathological changes in the support structures of bovine hooves around the time of first calving. Vet J. 2002;163:196–204. [DOI] [PubMed] [Google Scholar]
- 4.Lischer CJ, Ossent P, Räber M, Geyer H. Suspensory structures and supporting tissues of the third phalanx of cows and their relevance to the development of typical sole ulcers (Rusterholz ulcers). Vet Rec. 2002;151:694–8. [PubMed] [Google Scholar]
- 5.Donovan GA, Risco CA, Temple GMD, Tran TQ, van Horn HH. Influence of transition diets on occurrence of subclinical laminitis in Holstein dairy cows. J Dairy Sci. 2004;87:73–84. [DOI] [PubMed] [Google Scholar]
- 6.Pilachai R, Schonewille JTh, Thamrongyoswittayakul C, Aiumlamai S, Wachirapakorn C, Everts H, et al. Diet factors and subclinical laminitis score in lactating cows of smallholder dairy farms in Thailand. Livest Sci. 2013;155:197–204. [Google Scholar]
- 7.Elmhadi ME, Ali DK, Khogali MK, Wang H. Subacute ruminal acidosis in dairy herds: Microbiological and nutritional causes, consequences, and prevention strategies. Anim Nutr. 2022;10:148–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhai C, Lin J, Yang X, Mu J, Lei L, Wu W, et al. Dietary Quercetin supplementation alleviates claw lesions in dairy cows by modulating the PI3K/Akt and NF-κB signaling pathways. BMC Vet Res. 2025;21:636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Miguel-Pacheco GG, Thomas HJ, Kaler J, Craigon J, Huxley JN. Effects of lameness treatment for claw Horn lesions on lying behaviour in dairy cows. Appl Anim Behav Sci. 2016;179:11–6. [Google Scholar]
- 10.Akerstrom F, Bergsten C, Nyman A-K. Association between hoof trimming frequency in primiparous cows and hoof health and survival in second lactation. J Dairy Sci. 2024;107:9676–93. [DOI] [PubMed] [Google Scholar]
- 11.Guo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, et al. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Tar. 2024;9:53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gu Q, Liu Y, Zhen L, Zhao T, Luo L, Zhang J, et al. The structures of two glucomannans from Bletilla formosana and their protective effect on inflammation via inhibiting NF-κB pathway. Carbohyd Polym. 2022;292:119694. [DOI] [PubMed] [Google Scholar]
- 13.Tian M, Li K, Liu R, Du J, Zou D, Ma Y. Angelica polysaccharide attenuates LPS-induced inflammation response of primary dairy cow claw dermal cells via NF-κB and MAPK signaling pathways. BMC Vet Res. 2021;17:248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Watts MR, Hegedus OC, Eades SC, Belknap JK, Burns TA. Association of sustained Supraphysiologic hyperinsulinemia and inflammatory signaling within the digital lamellae in light-breed horses. J Vet Intern Med. 2019;33:1483–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Dern K, Burns TA, Watts MR, van Eps AW, Belknap JK. Influence of digital hypothermia on lamellar events related to IL-6/gp130 signalling in equine sepsis-related laminitis. Equine Vet J. 2020;52:441–8. [DOI] [PubMed] [Google Scholar]
- 16.Sadalage PS, Patil RV, Havaldar DV, Gavade SS, Santos AC, Pawar KD. Optimally biosynthesized, pegylated gold nanoparticles functionalized with Quercetin and camptothecin enhance potential anti-inflammatory, anti-cancer and anti-angiogenic activities. J Nanobiotechnol. 2021;19:84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Di Petrillo A, Orrù G, Fais A, Fantini MC. Quercetin and its derivates as antiviral potentials: A comprehensive review. Phytother Res. 2022;36:266–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chaudhary S, Sharma S, Fuloria S, Sharma PK. Anti-Inflammatory and Anti-Arthritis activity of quercetin: A comprehensive review. Curr Rheumatol Rev. 2025;21:144–59. [DOI] [PubMed] [Google Scholar]
- 19.Zhang Q, Wen F, Sun F, Xu Z, Liu Y, Tao C, et al. Efficacy and mechanism of Quercetin in the treatment of experimental colitis using network Pharmacology analysis. Molecules. 2022;28:146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Cao J, Xue R, He B. Quercetin protects oral mucosal keratinocytes against lipopolysaccharide-induced inflammatory toxicity by suppressing the AKT/AMPK/mTOR pathway. Immunopharm Immunot. 2021;43:519–26. [DOI] [PubMed] [Google Scholar]
- 21.Li L, Jiang W, Yu B, Liang H, Mao S, Hu X, et al. Quercetin improves cerebral ischemia/reperfusion injury by promoting microglia/macrophages M2 polarization via regulating PI3K/Akt/NF-κB signaling pathway. Biomed Pharmacother. 2023;168:115653. [DOI] [PubMed] [Google Scholar]
- 22.Liao Y-R, Lin J-Y. Quercetin, but not its metabolite Quercetin-3-glucuronide, exerts prophylactic immunostimulatory activity and therapeutic antiinflammatory effects on Lipopolysaccharide-Treated mouse peritoneal macrophages ex vivo. J Agric Food Chem. 2014;62:2872–80. [DOI] [PubMed] [Google Scholar]
- 23.Subudhi L, Thatoi H, Banerjee A. Anti-inflammatory activity of essential oil from medicinal plants: an insight into molecular mechanism, in-silico studies and signaling pathways. Phytomedicine. 2025;138:156364. [DOI] [PubMed] [Google Scholar]
- 24.Ho T-Y, Lo H-Y, Liu I-C, Lin K-A, Liao Y-F, Lo Y-C, et al. The protective effect of Quercetin on retinal inflammation in mice: the involvement of tumor necrosis factor/nuclear factor-κB signaling pathways. Food Funct. 2020;11:8150–60. [DOI] [PubMed] [Google Scholar]
- 25.Ren N, Kim E, Li B, Pan H, Tong T, Yang CS, et al. Flavonoids alleviating insulin resistance through Inhibition of inflammatory signaling. J Agric Food Chem. 2019;67:5361–73. [DOI] [PubMed] [Google Scholar]
- 26.Lan X, Qi D, Ren H, Liu T, Shao H, Zhang J. Chicoric acid ameliorates LPS-induced inflammatory injury in bovine lamellar keratinocytes by modulating the TLR4/MAPK/NF-κB signaling pathway. Sci Rep. 2023;13:21963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Faleiros RR, Leise BB, Westerman T, Yin C, Nuovo GJ, Belknap JK. In vivo and in vitro evidence of the involvement of CXCL1, a keratinocyte-derived chemokine, in equine laminitis. J Vet Intern Med. 2009;23:1086–96. [DOI] [PubMed] [Google Scholar]
- 28.de Pouyade G, de la Serteyn R. The role of activated neutrophils in the early stage of equine laminitis. Vet J. 2011;189:27–33. [DOI] [PubMed] [Google Scholar]
- 29.Pfeifer JPH, Santos VH, Rosa G, Souza JB, Watanabe MJ, Fonseca-Alves CE, et al. Isolation, cultivation and Immunofluorescence characterization of lamellar keratinocytes from equine hoof by using explants. Pesqui Vet Brasil. 2019;39:292–8. [Google Scholar]
- 30.Visser MB, Pollitt CC. Characterization of extracellular matrix macromolecules in primary cultures of equine keratinocytes. BMC Vet Res. 2010;6:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Xianhao Z, Jiafeng D, Yuepeng L, Qiaozhi S, Shuaichen L, Hayat MA, et al. The changes of inflammatory mediators and vasoactive substances in dairy cows’ plasma with pasture-associated laminitis. BMC Vet Res. 2020;16:119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Reisinger N, Schaumberger S, Nagl V, Hessenberger S, Schatzmayr G. Concentration dependent influence of lipopolysaccharides on separation of hoof explants and supernatant lactic acid concentration in an ex Vivo/In vitro laminitis model. PLoS ONE. 2015;10:e0143754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Reisinger N, Wendner D, Schauerhuber N, Mayer E. Effect of lipopolysaccharides (LPS) and Lipoteichoic acid (LTA) on the inflammatory response in rumen epithelial cells (REC) and the impact of LPS on claw explants. Animals. 2021;11:2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Loftus JP, Black SJ, Pettigrew A, Abrahamsen EJ, Belknap JK. Early laminar events involving endothelial activation in horses with black walnut-induced laminitis. Am J Vet Res. 2007;68:1205–11. [DOI] [PubMed] [Google Scholar]
- 35.Jiang M, Lv Z, Huang Y, Cheng Z, Meng Z, Yang T, et al. Quercetin alleviates Lipopolysaccharide-Induced inflammatory response in bovine mammary epithelial cells by suppressing TLR4/NF-kappa B signaling pathway. Front Vet Sci. 2022;9:915726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mukherjee D, Ahmad R, Nayeem S. Molecular interplay promotes amelioration by Quercetin during experimental hepatic inflammation in rodents. Int J Biol Macromol. 2022;222:2936–47. [DOI] [PubMed] [Google Scholar]
- 37.Duan W, Li T, Liu RH. Bioactive compounds, quercetin, Curcumin and β-glucan,regulate innate immunity via the gut-liver-brain axis. Trends Food Sci Tech. 2025;156:104864. [Google Scholar]
- 38.Carvalho JDS, Ramadan D, De Paiva Gonçalves V, Maquera-Huacho PM, Assis RP, Lima TFO, et al. Impact of citrus flavonoid supplementation on inflammation in lipopolysaccharide-induced periodontal disease in mice. Food Funct. 2021;12:5007–17. [DOI] [PubMed] [Google Scholar]
- 39.Baker RG, Hayden MS, Ghosh S. NF-κB, Inflammation, and metabolic disease. Cell Metab. 2011;13:11–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Mukherjee T, Kumar N, Chawla M, Philpott DJ, Basak S. The NF-κB signaling system in the Immunopathogenesis of inflammatory bowel disease. Sci Signal. 2024;17:eadh1641. [DOI] [PubMed] [Google Scholar]
- 41.Liu T, Zhang L, Joo D, Sun S-C. NF-κB signaling in inflammation. Sig Transduct Tar. 2017;2:17023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Jiang M, Wang K, Huang Y, Zhang X, Yang T, Zhan K, et al. Quercetin alleviates Lipopolysaccharide-Induced cell oxidative stress and inflammatory responses via regulation of the TLR4-NF-κB signaling pathway in bovine rumen epithelial cells. Toxins. 2023;15:512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Acosta-Martinez M, Cabail MZ. The PI3K/Akt pathway in Meta-Inflammation. Int J Mol Sci. 2022;23:15330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Qi X, Lu X, Han Y, Xing Y, Zheng Y, Cui C. Ginseng polysaccharide reduces autoimmune hepatitis inflammatory response by inhibiting PI3K/AKT and TLRs/NF-κB signaling pathways. Phytomedicine. 2023;116:154859. [DOI] [PubMed] [Google Scholar]
- 45.Jia X, Gu M, Dai J, Wang J, Zhang Y, Pang Z. Quercetin attenuates Pseudomonas aeruginosa-induced acute lung inflammation by inhibiting PI3K/AKT/NF-κB signaling pathway. Inflammopharmacology. 2024;32:1059–76. [DOI] [PubMed] [Google Scholar]
- 46.Li J, Zhao C, Liu M, Chen L, Zhu Y, Gao W, et al. Nuciferine ameliorates nonesterified fatty Acid-Induced bovine mammary epithelial cell lipid Accumulation, Apoptosis, and impaired migration via activating LKB1/AMPK signaling pathway. J Agric Food Chem. 2023;71:443–56. [DOI] [PubMed] [Google Scholar]
- 47.El-Sheikh M, Mesalam A, Khalil AAK, Idrees M, Ahn M-J, Mesalam AA, et al. Downregulation of PI3K/AKT/mTOR pathway in Juglone-Treated bovine oocytes. Antioxidants. 2023;12:114. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
This article contains the data presented in the present research.








