ABSTRACT
Background
Mitochondrial DNA copy number (mtDNA‐CN) in peripheral blood leukocytes has emerged as a surrogate marker of mitochondrial function. This study examined associations between leukocyte mtDNA‐CN, physical performance, and lipid metabolism in community‐dwelling older adults.
Methods
We conducted a cross‐sectional analysis of 594 adults aged ≥ 50 years (median 71 years; 351 women, 243 men) who were independent in activities of daily living. Physical performance was assessed using handgrip strength and gait parameters measured with a triaxial accelerometer. Frailty status was evaluated using the Japanese version of the Cardiovascular Health Study (J‐CHS) criteria. Blood samples were collected after fasting for mtDNA‐CN and other blood chemical measurements.
Results
Median values of mtDNA‐CN were 124 in women and 114 in men. According to the J‐CHS criteria, 6.1% of women and 6.3% of men were classified as frail, while 48.9% of women and 53.6% of men were pre‐frail. Participants with higher mtDNA‐CN levels demonstrated superior physical performance. After multivariable adjustment, mtDNA‐CN correlated positively with gate ability in women and handgrip strength in men. In addition, mtDNA‐CN correlated positively with iron in women and high‐density lipoprotein cholesterol (HDL‐C) in men, and negatively with uric acid and C‐reactive protein in men. In the multivariate regression analyses, mtDNA‐CN still showed positive associations with handgrip strength and HDL‐C, a negative association with uric acid in men, and a positive association with iron in women and men.
Conclusion
Leukocyte mtDNA‐CN was associated with physical performance, suggesting its potential utility as a biomarker for frailty assessment in older adults.
Keywords: frailty, gait speed, handgrip, mitochondrial DNA, triglycerides
Reduced mitochondrial DNA copy number in leukocytes is associated with reduced gait ability in women and with higher handgrip strength in men. Reduced mitochondrial DNA copy number in leukocytes is also associated with lower serum iron in women, lower HDL‐C in men, and higher uric acid and CRP in men.
1. Introduction
Japan has one of the highest life expectancies in the world; however, the discrepancy between healthy and overall life expectancy is 12 years for women and 9 years for men [1, 2]. Frailty is a state of increased vulnerability to various stressors due to age‐related loss of physiological reserves and is considered one factor contributing to these discrepancies [3]. The most widely used definition of frailty is the Fried criteria, including five components: unintentional weight loss, exhaustion, weakness, slow walking speed, and low physical activity [3]. However, biomarkers for predicting frailty risk have not yet been elucidated.
Mitochondria, the powerhouses of cellular energy production, undergo both quantitative and qualitative changes with aging, profoundly influencing frailty development and progression [4, 5, 6]. Additionally, mitochondrial dysfunction is also associated with lipid and glucose metabolism and chronic inflammation, and these disorders constitute risk factors for frailty development [7, 8, 9, 10]. These associations suggest that markers of mitochondrial health may serve as useful indicators of both frailty risk and metabolic status. However, assessing mitochondrial quantity and function typically requires complex methodologies such as fluorescence staining [11], membrane potential measurement [12], or ATP production quantification [13].
Recently, mitochondrial DNA (mtDNA) copy number (mtDNA‐CN) in peripheral blood leukocytes has gained attention as a surrogate marker of mitochondrial function [14, 15, 16]. Each mitochondrion contains multiple copies of its own circular genome, and changes in mtDNA‐CN may reflect cellular adaptation to metabolic demands or mitochondrial dysfunction. This measurement can be performed using standard blood samples via quantitative polymerase chain reaction (PCR). However, the relationships between leukocyte mtDNA‐CN and physical performance or metabolic function in older adults remain insufficiently characterized.
This study aimed to measure leukocyte mtDNA‐CN in community‐dwelling older adults and to examine its associations with physical performance and metabolic biomarkers, thereby elucidating the potential clinical utility of this biomarker for frailty assessment.
2. Methods
2.1. Study Design and Participants
This cross‐sectional study investigated associations between leukocyte mtDNA‐CN, physical performance, and biochemical parameters in community‐dwelling adults. Eligible participants were aged ≥ 50 years, independent in activities of daily living, and residing in Fukuoka Prefecture or Ishigaki City, Okinawa Prefecture, Japan. Participants were recruited from three sources: (1) the Kasuya Town and Ishigaki city cohorts of the Kyushu and Okinawa Population Study (KOPS) [17], an ongoing epidemiological study at Kyushu University Hospital; (2) members of the Kyushu University Shiragiku‐kai, an organization of registered body donors; and (3) members of the Genki 100 Club, a community‐based health promotion group. Individuals who provided written informed consent were included. A total of 594 adults (351 women, 243 men; median age 71 years, range 50–89 years) were enrolled. The study adhered to the Declaration of Helsinki (2024 revision) and received approval from the Kyushu University Ethics Committee (approval number: 22092–00).
2.2. Mitochondrial DNA Quantification
As described in our previous study [18], mtDNA‐CN was determined as follows. Total genomic DNA was extracted from whole blood using the QIAamp DNA kit (Qiagen, Germantown, MD), and the concentration of the extracted DNA was measured and adjusted to 20 ng/μl prior to quantification of both mtDNA and nuclear DNA (nDNA). All pre‐analytical procedures were completed within 24 h of blood collection, and the extracted DNA samples were kept at approximately 4°C until measurement, which was conducted within a few days.
For mtDNA quantification, two sets of primers and probes targeting the NADH dehydrogenase 1 (ND1) and cytochrome B (CYB) regions of the mitochondrial genome were employed. A primer and probe set targeting Serine Protease Inhibitor‐A1 (SERPINA1) was used for nDNA quantification. The following primer sequences were used for both digital PCR and TaqMan PCR:
ND1: Forward: 5′‐CCCTAAAACCCGCCACATCT‐3′.
Reverse: 5′‐GAGCGATGGTGAGAGCTAAGGT‐3′.
CYB: Forward: 5′‐CTCACTCCTTGGCGCCTGCC‐3′.
Reverse: 5′‐GGCGGTTGAGGCGTCTGGTG‐3′.
SERPINA1: Forward: 5′‐TTTTGGTTTAGTTTAGGATTTTGAGG‐3′.
Reverse: 5′‐ACCTACCAATTATTAATACCAAATCTATAC‐3′.
Digital PCR was carried out on a QuantStudio 3D Digital PCR platform (Thermo Fisher Scientific Inc., Waltham, MA, USA) under the following thermal cycling conditions: initial denaturation at 96°C for 10 min, followed by 40 cycles of 98°C for 30 s and 60°C for 2 min. TaqMan PCR was performed on a LightCycler 480 Real‐Time PCR System (Roche Diagnostics K.K., Tokyo, Japan) with the following conditions: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min.
Three arbitrarily selected DNA samples were used to quantify ND1, CYB, and SERPINA1 expression by digital PCR to generate standard DNA for use as external controls. These external control samples were included in each measurement run to minimize inter‐assay variation. A 10‐fold serial dilution of the external control was prepared to construct a calibration curve for TaqMan PCR. The mtDNA‐CN was determined by dividing the ND1 and CYB values individually by the corresponding SERPINA1 value, with the higher of the two resulting values taken as the final mtDNA‐CN. It should be noted that mtDNA‐CN represents a ratio relative to nDNA rather than an absolute quantity.
2.3. Physical Performance and Frailty Assessment
Handgrip strength was measured twice in each hand using a digital dynamometer (Grip‐D; Takei Scientific Instruments, Niigata, Japan), and the mean value from two trials of the self‐reported dominant hand was used for analysis. Gait performance was evaluated using a triaxial accelerometer (AYUMI EYE medical, Waseda Elderly Health Inc., Tokyo) during a 10‐m walk [19]. The device provides immediate gait function scores. Walking speed, stride length (distance/steps), and lateral balance—derived from lateral sway calculated as lateral acceleration divided by the square of walking speed—were recorded. Measurements were obtained at both normal and fast‐paced walking speeds.
Frailty was determined using the Japanese Cardiovascular Health Study (J‐CHS) criteria revised in 2020 [20]. Five components were assessed: unintentional weight loss (≥ 2 kg in 6 months), low grip strength (men < 28 kg; women < 18 kg), exhaustion within the past 2 weeks, slow gait (usual walking speed < 1.0 m/s), and low physical activity (lack of regular or light exercise). Participants meeting ≥ 3 criteria were classified as frail, those meeting 1 or 2 criteria as pre‐frail, and those meeting none as robust.
2.4. Laboratory Measurements
Blood samples were collected after an overnight fast of at least 8 h. In addition to standard biochemicals, fasting insulin, glycated albumin (GA) [21, 22], C‐reactive protein (CRP), trace elements, and vitamins—including iron, phosphorus, magnesium, copper, zinc, 25‐hydroxyvitamin D, and folate—were also measured.
2.5. Statistical Analysis
Continuous variables were summarized as medians with first and third quartiles due to non‐normal distributions. Group comparisons were performed using the Mann–Whitney U test for two groups and the Kruskal‐Wallis test for three groups, with Bonferroni correction applied when appropriate. Categorical variables were expressed as numbers and percentages and compared using the chi‐square test or Fisher's exact test. Spearman's rank correlation coefficient was used to evaluate relationships between mtDNA‐CN and continuous variables. Partial correlation and multivariable regression analyses were performed between mitochondrial DNA copy number and physical performance or lipid metabolism parameters, adjusting for age, BMI, residential area, smoking habits, alcohol consumption, GA or diabetes mellitus, hypertension, and cancer. All tests were two‐sided, and statistical significance was defined as p < 0.05. Analyses were performed using SAS version 9.4 (SAS Institute Inc., Cary, NC, USA).
3. Results
3.1. Participant Characteristics Classified by Frailty Status
Table 1 summarizes participant characteristics across the three frailty categories defined by the J‐CHS criteria. Among the study population, 236 individuals (43.0%) were classified as robust, 279 (50.8%) as pre‐frail, and 34 (6.2%) as frail. There were no significant differences in age or sex distribution, as well as lifestyle‐related factors such as residential area, smoking habits, and alcohol consumption among the three groups. BMI showed a clear gradient, with the frail group having the highest, the pre‐frail group intermediate, and the robust group the lowest (p < 0.001). Regarding the distribution of frailty components, weakness, slowness, and low activity were the major contributors to the frail classification.
TABLE 1.
Characteristics of participants classified by frailty status.
| Robust (n = 236) | Pre‐frail (n = 279) | Frail (n = 34) | p | |
|---|---|---|---|---|
| Demographic | ||||
| Age—years | 71 [65, 75] | 70 [64, 77] | 71 [66, 76] | 0.64 |
| Sex—no. (%) (Women/Men) | 147 (62.3)/89 (37.7) | 160 (57.4)/119 (42.7) | 20 (58.9)/14 (41.2) | 0.33 |
| Body mass index—kg/m2 | 23.0 [20.5, 24.8] | 23.3 [21.6, 25.8] | 26.1 [22.2, 30.3] | < 0.001 |
| Residential area—no. (%) (Fukuoka/Ishigaki) | 103 (43.6)/133 (56.4) | 111 (39.8)/168 (60.2) | 11 (32.4)/23 (67.7) | 0.18 |
| Smoking habit—no. (current/past/never) | 14 (5.9)/67 (28.4)/155 (65.7) | 14 (5.0)/77 (27.6)/188 (67.4) | 7 (20.6)/7 (20.6)/20 (58.8) | 0.39 |
| Alcohol drinking habit—no. (yes/no) | 110 (46.6)/126 (53.4) | 118 (42.3)/161 (57.7) | 15 (44.1)/19 (55.9) | 0.42 |
| Comorbidities | ||||
| Number of comorbidities—no. | 0 [0, 1] | 1 [0, 2] | 2 [1, 2] | < 0.001 |
| Hypertensionno. (%) | 79 (33.5) | 112 (40.1) | 22 (64.7) | < 0.01 |
| Diabetes—no. (%) | 14 (5.9) | 47 (16.9) | 13 (38.2) | < 0.001 |
| Dyslipidemia—no. (%) | 50 (21.2) | 71 (25.5) | 13 (38.2) | 0.04 |
| Gout—no. (%) | 7 (3.0) | 11 (3.9) | 2 (5.9) | 0.37 |
| Hyperuricemia—no. (%) | 5 (2.1) | 10 (3.6) | 2 (5.9) | 0.18 |
| Ischemic heart disease—no. (%) | 6 (2.5) | 9 (3.2) | 4 (11.8) | 0.051 |
| Myocardial infarction—no. (%) | 2 (0.9) | 3 (1.1) | 0 (0.0) | 0.90 |
| Coronary heart disease a —no. (%) | 7 (3.0) | 11 (3.9) | 4 (11.8) | 0.06 |
| Stroke b —no. (%) | 0 (0.0) | 4 (1.4) | 0 (0.0) | 0.22 |
| Cancer—no. (%) | 7 (3.0) | 8 (2.9) | 2 (5.9) | 0.60 |
| Frail components | ||||
| Frail score—point | 0 [0, 0] | 1 [1, 2] | 3 [3, 3] | < 0.001 |
| Shrinking—no. (%) | 0 (0.0) | 47 (16.9) | 15 (44.1) | < 0.001 |
| Weakness—no. (%) | 0 (0.0) | 72 (25.8) | 21 (61.8) | < 0.001 |
| Exhaustion—no. (%) | 0 (0.0) | 38 (13.6) | 17 (50.0) | < 0.001 |
| Slowness—no. (%) | 0 (0.0) | 91 (33.0) | 28 (82.4) | < 0.001 |
| Low activity—no. (%) | 0 (0.0) | 117 (41.9) | 28 (82.4) | < 0.001 |
| Physical ability | ||||
| Dominant handgrip—kg | 26.3 [22.4, 33.4] | 24.4 [19.9, 33.8] | 23.1 [16.0, 27.6] | < 0.001 |
| Gait ability (normal walking) | ||||
| Walking speed—m/s | 1.17 [1.10, 1.27] | 1.08 [0.96, 1.20] | 0.92 [0.84, 0.96] | < 0.001 |
| Stride length—cm | 63.9 [60.6, 68.8] | 59.4 [55.6, 65.4] | 52.0 [45.9, 55.4] | < 0.001 |
| Balance—point | 88 [84, 90] | 85 [79, 90] | 77 [69, 85] | < 0.001 |
| Gait ability (fast walking) | ||||
| Walking speed—m/s | 1.52 [1.42, 1.63] | 1.42 [1.29, 1.55] | 1.23 [1.11, 1.42] | < 0.001 |
| Stride length—cm | 72.7 [67.1, 78.9] | 69.3 [63.6, 74.1] | 61.2 [53.6, 68.2] | < 0.001 |
| Balance—point | 90 [89, 91] | 90 [85, 91] | 86 [79, 90] | < 0.001 |
| Laboratory data | ||||
| Mitochondrial DNA copy number—AU | 119 [100, 140] | 119 [97, 138] | 120 [100, 139] | 0.68 |
| Red blood cell—×106/μL | 438 [420, 459] | 444 [415, 478] | 435 [411, 450] | 0.59 |
| Hemoglobin—g/dL | 13.5 [12.8, 14.2] | 13.5 [12.7, 14.4] | 13.2 [12.4, 13.7] | 0.39 |
| Hematocrit—% | 41.8 [39.7, 43.6] | 41.5 [39.4, 44.0] | 40.9 [39.9, 42.0] | 0.71 |
| Total protein—g/dL | 7.3 [7.0, 7.6] | 7.3 [7.1, 7.6] | 7.3 [6.9, 7.4] | 0.21 |
| Albumin—g/dL | 4.5 [4.4, 4.7] | 4.5 [4.3, 4.6] | 4.4 [4.2, 4.5] | 0.01 |
| Total bilirubin—mg/dL | 0.7 [0.6, 0.9] | 0.7 [0.6, 0.9] | 0.8 [0.6, 0.9] | 0.82 |
| Aspartate aminotransferase—U/L | 22 [19, 27] | 22 [19, 26] | 22 [18, 25] | 0.30 |
| Alanine aminotransferase—U/L | 18 [14, 24] | 18 [14, 24] | 20 [16, 25] | 0.76 |
| Gamma‐glutamyl transferase—U/L | 23 [17, 36] | 24 [17, 38] | 24 [17, 45] | 0.97 |
| Urea nitrogen—mg/dL | 15.1 [12.7, 18.7] | 15.8 [12.6, 18.6] | 16.1 [12.8, 19.8] | 0.60 |
| Creatinine—mg/dL | 0.70 [0.62, 0.81] | 0.72 [0.61, 0.85] | 0.72 [0.61, 0.83] | 0.54 |
| Estimate glomerular filtration rate—mL/min/1.73m2 | 68.5 [61.7, 79.2] | 70.8 [59.5, 80.0] | 70.3 [57.3, 79.0] | 0.99 |
| Uric acid—mg/dL | 5.2 [4.4, 6.2] | 5.3 [4.5, 6.2] | 5.2 [4.2, 6.3] | 0.78 |
| Creatinine kinase—U/L | 98 [75, 129] | 99 [71, 137] | 76 [47, 120] | 0.01 |
| HDL cholesterol—mg/dL | 69 [57, 83] | 63 [53, 77] | 64 [51, 77] | 0.02 |
| Triglycerides—mg/dL | 100 [76, 143] | 107 [71, 164] | 102 [75, 148] | 0.63 |
| LDL cholesterol—mg/dL | 130 [107, 153] | 125 [103, 151] | 115 [103, 143] | 0.11 |
| Fasting plasma glucose—mg/dL | 91 [85, 98] | 93 [86, 104] | 95 [84, 105] | 0.02 |
| Insulin—μU/mL | 4.6 [3.1, 7.1] | 5.2 [3.3, 8.4] | 5.5 [3.4, 10.8] | 0.08 |
| Glycated albumin—% | 14.3 [13.3, 15.4] | 14.5 [13.5, 15.7] | 14.1 [13.1, 15.9] | 0.45 |
| Sodium—mmol/L | 141 [140, 142] | 141 [140, 142] | 141 [140, 143] | 0.81 |
| Potassium—mmol/L | 4.3 [4.0, 4.5] | 4.3 [4.1, 4.5] | 4.4 [4.1, 4.6] | 0.37 |
| Calcium—mg/dL | 9.4 [9.2, 9.6] | 9.4 [9.2, 9.7] | 9.4 [9.1, 9.7] | 0.11 |
| Phosphorus—mg/dL | 3.5 [3.2, 3.9] | 3.5 [3.2, 3.8] | 3.5 [3.3, 3.7] | 0.87 |
| Magnesium—mg/dL | 2.3 [2.2, 2.4] | 2.3 [2.1, 2.4] | 2.3 [2.2, 2.4] | 0.13 |
| Iron—μg/dL | 109 [84, 132] | 105 [83, 135] | 101 [81, 132] | 0.78 |
| Copper—μg/dL | 117 [104, 132] | 116 [103, 127] | 120 [110, 139] | 0.23 |
| Zinc—μg/dL | 76 [68, 84] | 77 [68, 86] | 78 [68, 81] | 0.63 |
| Vitamin D—ng/mL | 21.2 [17.2, 25.9] | 19.6 [16.5, 25.7] | 16.7 [12.6, 22.2] | 0.01 |
| Folic acid—ng/mL | 8.1 [6.6, 10.4] | 7.3 [5.6, 9.6] | 6.2 [5.4, 11.1] | < 0.01 |
| C‐reactive protein—mg/dl | 0.06 [0.04, 0.14] | 0.07 [0.04, 0.15] | 0.12 [0.04, 0.24] | 0.06 |
Abbreviations: AU, arbitrary unit; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein.
Combined number of ischemic heart diseases and myocardial infarctions.
Combined number of cerebral infarctions and cerebral hemorrhages.
Physical performance parameters declined progressively from robust to frail groups. Handgrip strength decreased significantly, as did normal walking speed, as expected. Stride length and lateral balance during gait also worsened consistently across categories, and similar patterns were observed in fast‐paced walking performance. Laboratory findings showed significant deterioration with increasing frailty: albumin and creatinine kinase levels were significantly lower in the frail group than in both the robust and pre‐frail groups; HDL‐C was highest among robust participants; and fasting plasma glucose showed an increasing trend with greater frailty. Vitamin D and folate levels also declined progressively across frailty categories. In contrast, mtDNA‐CN showed no significant differences, with median values of 119 in both robust and pre‐frail groups and 120 in the frail group (p = 0.68).
3.2. Participant Characteristics Classified by mtDNA‐CN in Women and Men
Sex‐specific analyses stratified by the median mtDNA‐CN are presented in Tables 2 and 3. Among women, participants were divided at a median value of 124 arbitrary units (AU). Women in the high mtDNA‐CN group were significantly younger and showed a significantly lower prevalence of slow walking speed. For physical performance measures, the high mtDNA‐CN group demonstrated faster both normal and fast‐paced walking speed, along with longer stride length. Laboratory characteristics further showed several significant differences: women with higher mtDNA‐CN had higher total bilirubin, iron, and magnesium, and lower triglycerides levels. They also had slightly lower copper levels. Although not statistically significant, the high mtDNA‐CN group tended to show lower CRP levels. In men, participants were divided at a median mtDNA‐CN of 114 AU. Men with high mtDNA‐CN showed significantly higher prevalence of current or past smoking and low activity. Regarding physical performance, handgrip strength was significantly higher in the high mtDNA‐CN group, although walking speed and stride length did not differ between groups. Laboratory results revealed that the high mtDNA‐CN group had significantly lower uric acid and CRP, and higher magnesium and iron. Trends toward lower triglycerides and higher HDL‐C were also observed, though not statistically significant.
TABLE 2.
Characteristics of female participants classified by mitochondrial DNA copy number.
| MtDNA ≥ 124 (n = 176) | MtDNA < 124 (n = 175) | p | |
|---|---|---|---|
| Demographic | |||
| Age—years | 70 [63, 74] | 71 [65, 79] | < 0.01 |
| Body mass index—kg/m2 | 22.5 [20.0, 24.8] | 23.1 [20.8, 25.3] | 0.07 |
| Residential area—no. (%) (Fukuoka/Ishigaki) | 72 (40.9)/104 (59.1) | 88 (50.3)/87 (49.7) | 0.08 |
| Smoking habit—no. (current/past/never) | 5 (2.8)/17 (9.7)/154 (87.5) | 6 (3.4)/14 (8.0)/155 (88.6) | 0.92 |
| Alcohol drinking habit—no. (yes/no) | 49 (27.8)/127 (72.2) | 41 (23.4)/134 (76.6) | 0.23 |
| Comorbidities | |||
| Number of comorbidities—no. | 0 [0, 1] | 1 [0, 1] | 0.02 |
| Hypertension—no. (%) | 51 (29.0) | 73 (41.7) | 0.01 |
| Diabetes—no. (%) | 9 (5.1) | 28 (16.0) | < 0.001 |
| Dyslipidemia—no. (%) | 49 (27.8) | 49 (28.0) | 0.97 |
| Gout—no. (%) | 0 (0.0) | 1 (0.6) | 0.32 |
| Hyperuricemia—no. (%) | 1 (0.6) | 2 (1.1) | 0.56 |
| Ischemic heart disease—no. (%) | 4 (2.3) | 5 (2.9) | 0.73 |
| Myocardial infarction—no. (%) | 1 (0.6) | 1 (0.6) | 0.99 |
| Coronary heart disease a − no. (%) | 5 (2.8) | 5 (2.8) | 0.99 |
| Stroke b —no. (%) | 2 (1.1) | 1 (0.6) | 0.57 |
| Cancer—no. (%) | 5 (2.8) | 3 (1.7) | 0.48 |
| Frail components | |||
| Frail score—point | 1 [0, 1] | 1 [0, 1] | 0.12 |
| Frailty status—no. (%) (robust/pre‐frail/frail) | 79 (49.1)/72 (44.7)/10 (6.2) | 67 (40.8)/87 (53.1)/10 (6.1) | 0.65 |
| Shrinking—no. (%) | 17 (10.6) | 20 (12.2) | 0.98 |
| Weakness—no. (%) | 31 (17.7) | 36 (20.6) | 0.50 |
| Exhaustion—no. (%) | 21 (13.0) | 21 (12.8) | 0.95 |
| Slowness—no. (%) | 23 (13.1) | 37 (21.5) | 0.04 |
| Low activity—no. (%) | 38 (23.6) | 38 (23.2) | 0.93 |
| Physical ability | |||
| Dominant handgrip—kg | 22.1 [19.9, 24.6] | 21.2 [18.7, 24.3] | 0.12 |
| Gait ability (normal walking) | |||
| Walking speed—m/s | 1.17 [1.06, 1.27] | 1.13 [1.03, 1.25] | 0.04 |
| Stride length—cm | 62.0 [57.7, 66.2] | 60.0 [55.0, 65.3] | 0.02 |
| Balance—point | 87 [82, 90] | 86 [80, 89] | 0.051 |
| Gait ability (fast walking) | |||
| Walking speed—m/s | 1.48 [1.36, 1.61] | 1.42 [1.30, 1.59] | 0.02 |
| Stride length—cm | 69.0 [64.2, 73.9] | 66.7 [62.3, 71.7] | 0.02 |
| Balance—point | 90 [87, 91] | 90 [85, 91] | 0.39 |
| Laboratory data | |||
| Mitochondrial DNA copy number—AU | 146 [133, 165] | 101 [89, 114] | < 0.001 |
| Red blood cell—×106/μL | 437 [418, 459] | 429 [406, 459] | 0.26 |
| Hemoglobin—g/dL | 13.3 [12.8, 13.8] | 13.1 [12.6, 13.8] | 0.14 |
| Hematocrit—% | 40.8 [38.8, 42.7] | 40.6 [38.6, 42.3] | 0.50 |
| Total protein—g/dL | 7.3 [7.0, 7.5] | 7.3 [7.0, 7.6] | 0.42 |
| Albumin—g/dL | 4.5 [4.3, 4.6] | 4.5 [4.3, 4.6] | 0.65 |
| Total bilirubin—mg/dL | 0.7 [0.6, 0.8] | 0.6 [0.5, 0.8] | 0.03 |
| Aspartate aminotransferase—U/L | 22 [20, 26] | 21 [19, 25] | 0.06 |
| Alanine aminotransferase—U/L | 17 [14, 23] | 17 [13, 22] | 0.24 |
| Gamma‐glutamyl transferase—U/L | 21 [16, 26] | 20 [16, 32] | 0.73 |
| Urea nitrogen—mg/dL | 14.7 [12.4, 17.7] | 16.0 [12.6, 19.2] | 0.06 |
| Creatinine—mg/dL | 0.64 [0.57, 0.72] | 0.64 [0.57, 0.70] | 0.95 |
| Estimate glomerular filtration rate—mL/min/1.73m2 | 68.9 [60.7, 80.4] | 69.1 [61.4, 78.9] | 0.62 |
| Uric acid—mg/dL | 4.8 [4.2, 5.6] | 4.9 [4.3, 5.9] | 0.11 |
| Creatinine kinase—U/L | 87 [69, 126] | 87 [67, 121] | 0.53 |
| HDL cholesterol—mg/dL | 70 [60, 84] | 70 [57, 84] | 0.30 |
| Triglycerides—mg/dL | 92 [67, 141] | 108 [82, 148] | 0.01 |
| LDL cholesterol—mg/dL | 132 [111, 155] | 130 [111, 155] | 0.91 |
| Fasting plasma glucose—mg/dL | 89 [85, 97] | 91 [84, 99] | 0.52 |
| Insulin—μU/mL | 4.9 [3.2, 7.1] | 5.1 [3.4, 8.2] | 0.06 |
| Glycated albumin—% | 14.3 [13.4, 15.5] | 14.4 [13.4, 15.7] | 0.51 |
| Sodium—mmol/L | 142 [140, 143] | 142 [140, 143] | 0.43 |
| Potassium—mmol/L | 4.3 [4.0, 4.5] | 4.2 [4.0, 4.5] | 0.22 |
| Calcium—mg/dL | 9.5 [9.2, 9.7] | 9.4 [9.2, 9.7] | 0.15 |
| Phosphorus—mg/dL | 3.7 [3.4, 4.0] | 3.7 [3.4, 4.0] | 0.69 |
| Magnesium—mg/dL | 2.3 [2.2, 2.4] | 2.2 [2.1, 2.4] | 0.048 |
| Iron—μg/dL | 109 [86, 133] | 95 [76, 116] | < 0.001 |
| Copper—μg/dL | 122 [112, 134] | 125 [116, 138] | 0.049 |
| Zinc—μg/dL | 78 [69, 86] | 75 [68, 84] | 0.16 |
| Vitamin D—ng/mL | 18.0 [14.2, 21.3] | 18.4 [14.5, 22.6] | 0.50 |
| Folic acid—ng/mL | 8.8 [6.6, 11.6] | 8.2 [6.5, 10.3] | 0.11 |
| C‐reactive protein—mg/dl | 0.07 [0.04, 0.13] | 0.08 [0.04, 0.18] | 0.06 |
Abbreviations: AU, arbitrary unit; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein.
Combined number of ischemic heart diseases and myocardial infarctions.
Combined number of cerebral infarctions and cerebral hemorrhages.
TABLE 3.
Characteristics of male participants classified by mitochondrial DNA copy number.
| MtDNA ≥ 114 (n = 123) | MtDNA < 114 (n = 120) | p | |
|---|---|---|---|
| Demographic | |||
| Age—years | 71 [65, 76] | 73 [67, 77] | 0.10 |
| Body mass index—kg/m2 | 23.6 [21.9, 25.8] | 23.5 [21.8, 25.6] | 0.72 |
| Residential area—no. (%) (Fukuoka/Ishigaki) | 52 (42.3)/71 (57.7) | 59 (49.2)/61 (50.8) | 0.28 |
| Smoking habit—no. (current/past/never) | 16 (13.0)/73 (59.4)/34 (27.6) | 9 (7.5)/63 (52.5)/48 (40.0) | 0.03 |
| Alcohol drinking habit—no. (yes/no) | 85 (69.1)/38 (30.9) | 78 (65.0)/42 (35.0) | 0.35 |
| Comorbidities | |||
| Number of comorbidities—no. | 1 [0, 2] | 1 [0, 2] | 0.23 |
| Hypertension—no. (%) | 57 (46.3) | 55 (45.8) | 0.94 |
| Diabetes—no. (%) | 23 (18.7) | 30 (25.0) | 0.24 |
| Dyslipidemia—no. (%) | 25 (20.3) | 32 (26.7) | 0.24 |
| Gout—no. (%) | 9 (7.3) | 12 (10.0) | 0.46 |
| Hyperuricemia—no. (%) | 9 (7.3) | 11 (9.2) | 0.60 |
| Ischemic heart disease—no. (%) | 5 (4.1) | 9 (7.5) | 0.25 |
| Myocardial infarction—no. (%) | 3 (2.4) | 3 (2.5) | 0.98 |
| Coronary heart disease a —no. (%) | 8 (6.5) | 11 (9.2) | 0.44 |
| Stroke b —no. (%) | 2 (1.6) | 2 (1.7) | 0.98 |
| Cancer—no. (%) | 6 (4.9) | 7 (5.8) | 0.74 |
| Frail components | |||
| Frail score—point | 1 [0, 2] | 1 [0, 1] | 0.07 |
| Frailty status—no. (%) (robust/pre‐frail/frail) | 39 (34.8)/65 (58.0)/8 (7.2) | 50 (45.9)/54 (49.5)/5 (4.6) | 0.09 |
| Shrinking—no. (%) | 13 (11.6) | 12 (11.1) | 0.89 |
| Weakness—no. (%) | 18 (14.6) | 17 (14.2) | 0.92 |
| Exhaustion—no. (%) | 9 (8.0) | 4 (3.7) | 0.17 |
| Slowness—no. (%) | 34 (27.6) | 31 (25.8) | 0.75 |
| Low activity—no. (%) | 41 (36.6) | 26 (23.9) | 0.04 |
| Physical ability | |||
| Dominant handgrip—kg | 35.2 [31.9, 41.2] | 33.5 [30.0, 38.4] | 0.01 |
| Gait ability (normal walking) | |||
| Walking speed—m/s | 1.09 [0.98, 1.20] | 1.13 [0.99, 1.23] | 0.24 |
| Stride length—cm | 62.8 [57.2, 66.9] | 62.5 [57.6, 68.4] | 0.42 |
| Balance—point | 87 [80, 90] | 86 [81, 90] | 0.80 |
| Gait ability (fast walking) | |||
| Walking speed—m/s | 1.53 [1.35, 1.63] | 1.49 [1.35, 1.62] | 0.85 |
| Stride length—cm | 73.8 [69.4, 80.3] | 74.6 [68.5, 80.0] | 0.85 |
| Balance—point | 91 [89, 92] | 90 [87, 91] | 0.10 |
| Laboratory data | |||
| Mitochondrial DNA copy number—AU | 133 [123, 151] | 96 [88, 105] | < 0.001 |
| Red blood cell—×106/μL | 447 [415, 479] | 448 [431, 474] | 0.85 |
| Hemoglobin—g/dL | 14.2 [12.9, 14.8] | 14.2 [13.3, 15.0] | 0.47 |
| Hematocrit—% | 42.5 [40.0, 45.4] | 42.4 [40.6, 44.9] | 0.84 |
| Total protein—g/dL | 7.2 [7.0, 7.6] | 7.3 [7.0, 7.6] | 0.29 |
| Albumin—g/dL | 4.5 [4.3, 4.6] | 4.5 [4.3, 4.6] | 0.62 |
| Total bilirubin—mg/dL | 0.8 [0.6, 1.0] | 0.8 [0.6, 1.0] | 0.49 |
| Aspartate aminotransferase—U/L | 23 [20, 28] | 23 [20, 28] | 0.64 |
| Alanine aminotransferase—U/L | 22 [16, 28] | 20 [16, 26] | 0.66 |
| Gamma‐glutamyl transferase—U/L | 30 [20, 46] | 29 [21, 45] | 0.98 |
| Urea nitrogen—mg/dL | 15.8 [13.1, 19.0] | 16.0 [13.4, 20.0] | 0.16 |
| Creatinine—mg/dL | 0.83 [0.75, 0.93] | 0.85 [0.77, 0.97] | 0.10 |
| Estimate glomerular filtration rate—mL/min/1.73m2 | 71.9 [61.8, 79.9] | 66.9 [59.1, 77.6] | 0.06 |
| Uric acid—mg/dL | 5.6 [4.9, 6.4] | 6.2 [5.3, 7.0] | < 0.01 |
| Creatinine kinase—U/L | 116 [82, 164] | 107 [78, 142] | 0.29 |
| HDL cholesterol—mg/dL | 61 [51, 71] | 58 [48, 70] | 0.11 |
| Triglycerides—mg/dL | 101 [75, 163] | 113 [77, 171] | 0.37 |
| LDL cholesterol—mg/dL | 120 [97, 146] | 118 [101, 136] | 0.52 |
| Fasting plasma glucose—mg/dL | 97 [89, 108] | 97 [90, 113] | 0.46 |
| Insulin—μU/mL | 5.8 [3.3, 9.5] | 5.2 [3.3, 8.5] | 0.52 |
| Glycated albumin—% | 14.6 [13.3, 16.2] | 14.7 [13.5, 15.9] | 0.68 |
| Sodium—mmol/L | 141 [140, 142] | 141 [140, 142] | 0.61 |
| Potassium—mmol/L | 4.4 [4.1, 4.6] | 4.3 [4.1, 4.5] | 0.17 |
| Calcium—mg/dL | 9.4 [9.2, 9.6] | 9.4 [9.1, 9.7] | 0.68 |
| Phosphorus—mg/dL | 3.3 [3.0, 3.5] | 3.2 [3.0, 3.5] | 0.87 |
| Magnesium—mg/dL | 2.3 [2.2, 2.4] | 2.2 [2.1, 2.3] | 0.03 |
| Iron—μg/dL | 109 [86, 133] | 105 [81, 138] | 0.02 |
| Copper—μg/dL | 106 [96, 117] | 109 [98, 118] | 0.61 |
| Zinc—μg/dL | 78 [69, 88] | 79 [69, 86] | 0.64 |
| Vitamin D—ng/mL | 23.8 [18.8, 28.6] | 24.1 [19.5, 28.4] | 0.72 |
| Folic acid—ng/mL | 6.7 [5.3, 8.5] | 7.1 [5.6, 9.6] | 0.22 |
| C‐reactive protein—mg/dl | 0.06 [0.04, 0.13] | 0.08 [0.04, 0.17] | 0.049 |
Abbreviations: AU, arbitrary unit; HDL, high‐density lipoprotein; LDL, low‐density lipoprotein.
Combined number of ischemic heart diseases and myocardial infarctions.
Combined number of cerebral infarctions and cerebral hemorrhages.
3.3. Correlations Between mtDNA‐CN and Physical Performance
Sex‐specific correlation analyses are shown in Figure 1a,b. In women (Figure 1a), mtDNA‐CN exhibited significant negative correlations with age and frailty score. Positive correlations were observed with handgrip strength, normal walking speed, stride length, balance, and fast‐paced walking speed. Age and frailty scores themselves showed expected negative relationships with physical performance measures. After adjusting for age, BMI, residential area, smoking habits, alcohol consumption, GA or diabetes mellitus, hypertension, and cancer, significant correlations persisted for normal walking stride (r = 0.132; p = 0.02), normal walking balance (r = 0.131; p = 0.02), and fast‐paced walking speed (r = 0.116; p = 0.03). However, these associations did not reach statistical significance in the multivariate regression analyses because BMI was strongly negatively associated with gait performance. In men (Figure 1b), mtDNA‐CN showed a significant negative correlation with age and a positive correlation with handgrip strength. No significant correlations with gait parameters were observed. After multivariable adjustment, the association between mtDNA‐CN and handgrip strength remained significant (r = 0.129; p = 0.048). This positive association remained statistically significant in the multivariate regression analysis (p = 0.046).
FIGURE 1.
Correlations between mitochondrial DNA copy number, demographic characteristics, hand grip, and gait ability. The Spearman correlation coefficients heatmaps between factors in women (a) and men (b) are shown; the positive correlations in red and the negative correlations in blue. It ranges from −1.0 to 1.0. Balance_f, a point of fast‐paced walking balance; Balance_n, a point of normal walking balance; BMI, body mass index; MtDNA, mitochondrial DNA copy number; Speed_f, a fast‐paced walking speed; Speed_n, a normal walking speed; Stride_f, a fast‐paced stride length; Stride_n, a normal stride length.
3.4. Correlations Between mtDNA‐CN and the Laboratory Parameters
Correlations between mtDNA‐CN and the laboratory parameters were shown in Figure 2a,b. In women (Figure 2a), mtDNA‐CN correlated negatively with triglycerides and uric acid and positively with iron. After multivariable adjustment, mtDNA‐CN showed a significant positive correlation only with iron (r = 0.179; p < 0.001). This positive association remained statistically significant in the multivariate regression analysis (p < 0.01). In men (Figure 2b), mtDNA‐CN correlated negatively with uric acid and positively with iron; after multivariable adjustment, significant correlations also emerged with HDL‐C (r = 0.154; p = 0.02), uric acid (r = −0.240; p < 0.001), and CRP (r = −0.144; p = 0.03). The multivariate regression analyses demonstrated that mtDNA‐CN had significant positive associations with HDL‐C and iron, and a negative association with uric acid (all p < 0.05). However, there was no significant association between mtDNA‐CN and CRP in the multivariate regression analysis.
FIGURE 2.
Correlation between mitochondrial DNA copy number and laboratory measurements. The Spearman correlation coefficients heatmaps between factors in women (a) and men (b) are shown; the positive correlations in red, and the negative correlations in blue. It ranges from −1.0 to 1.0. CK, creatinine kinase; CRP, C‐reactive protein; Cu, copper; FA, folic acid; Fe, iron; FPG, fasting plasma glucose; HDL‐C, high‐density lipoprotein cholesterol; LDL‐C, low‐density lipoprotein cholesterol; Mg, magnesium; MtDNA, mitochondrial DNA copy number; TG, triglycerides; UA, uric acid; VitD, vitamin D.
4. Discussion
In this cross‐sectional study of 594 community‐dwelling older adults, our results indicate that mtDNA‐CN is associated with physical function, including grip strength and gait parameters, as well as several metabolic indicators. Notably, these associations in physical performance differed between men and women, suggesting sex‐specific mechanisms through which mitochondrial function contributes to age‐related physiological decline. Although a previous cross‐sectional study has reported an association between lower mtDNA‐CN and the prevalence of frailty [23], our study did not demonstrate a significant correlation. However, even after multivariable adjustment, correlation analyses showed a consistent decrease in mtDNA‐CN with worsening physical performance. Thus, mtDNA‐CN may serve as an accessible biomarker for diminished energy‐generating capacity in older adults.
Sex‐stratified analyses revealed distinct patterns. Among women, mtDNA‐CN showed a significant positive correlation with gait performance after multivariable adjustment. Given that women typically have a higher proportion of oxidative type I muscle fibers, reduced mitochondrial capacity may more directly impair gait and postural control [24, 25]. However, mtDNA‐CN did not show a significant association with gait performance in the multivariate regression analysis because BMI was strongly associated with it. In contrast, handgrip strength in men was significantly related to mtDNA‐CN both in the multivariable adjusted correlation and regression analyses, whereas gait parameters did not. Men generally possess greater muscle mass and rely more heavily on glycolytic fibers; therefore, mitochondrial deficits may preferentially affect muscle strength rather than gait speed [24, 25]. These findings emphasize the importance of considering sex‐specific pathways in research on mitochondrial aging and functional decline.
Previous studies have reported that mtDNA‐CN showed a negative correlation with BMI, triglycerides, FPG, glycated hemoglobin (HbA1c), insulin resistance (HOMA‐IR), and LDL‐C, and a positive correlation with HDL‐C [26, 27]. In this study, mtDNA‐CN was also associated with several metabolic biomarkers. The negative association between mtDNA‐CN and uric acid may indicate increased purine degradation under mitochondrial dysfunction, as well as a cycle in which elevated uric acid further damages mitochondrial DNA through oxidative stress [28, 29]. The positive association with iron suggests that mtDNA‐CN may reflect adequate iron availability for the electron transport chain, as iron is essential for oxidative phosphorylation [30]. Among men, mtDNA‐CN was additionally associated with higher HDL‐C and lower CRP levels after adjustment. Given that the reverse cholesterol transport system via ABCA1/ABCG1 represents an ATP‐dependent active transport process, a positive correlation with mitochondria, the primary site of ATP generation, is expected. Consistent findings were reported in studies involving Mediterranean populations [26]. Moreover, mitochondrial dysfunction leads to excessive ROS generation, which can trigger inflammatory responses. In accordance with our findings, investigations in Belgian and Taiwanese populations have also demonstrated inverse associations between mtDNA‐CN and inflammatory markers, including CRP, IL‐6, and TNF‐α [31, 32].
This study has several strengths, including a relatively large sample size, detailed frailty assessment, objective gait measurements using a triaxial accelerometer, and extensive biochemical profiling. Furthermore, conducting sex‐specific analyses clarified biological relationships that would have been obscured in pooled analyses.
Several limitations should be noted. The cross‐sectional design does not permit causal inference, and longitudinal data are required to determine whether mtDNA‐CN predicts subsequent declines in strength, gait performance, frailty progression, or metabolic deterioration. Additionally, mtDNA‐CN measured in leukocytes may not fully reflect mitochondrial function in skeletal muscle. However, previous observational studies demonstrated that low mtDNA‐CN values predict all‐cause mortality or cardiovascular disease risk [15, 16, 23, 33].
In conclusion, mtDNA‐CN in peripheral blood leukocytes is associated with physical performance and multiple metabolic biomarkers in older adults, with notable sex‐specific patterns. These findings underscore the central role of mitochondrial function in age‐related physiological decline and support the potential utility of mtDNA‐CN as a non‐invasive biomarker for monitoring frailty and health status in aging populations.
Author Contributions
The conception and design of the study were carried out by H.I., R.N., H.N., and N.S. Data acquisition was performed by H.I. and R.N. The data were analyzed by H.I. and R.N., and interpreted by all authors. All authors contributed to the drafting and revision of the paper and are responsible for the intellectual content and the final approval of the version to be published.
Funding
This study was supported by Grants‐in‐Aid for Scientific Research for Priority Areas of Cancer (JP17015018), Innovative Areas (JP221S0001), and by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant (JP20K17155, JP16H06277 and JP22H04923 [CoBiA]; JP21H04824) from the Japanese Ministry of Education, Culture, Sports, Science, and Technology. This study was also supported by the Takeda Medical Research Foundation.
Ethics Statement
The study was reviewed and approved by the Institutional Review Boards/Ethics Committees of Kyushu University Hospital and Medical Institutions (approval number 22092–00).
Consent
Each participant provided informed consent prior to enrollment.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
We dedicate this manuscript to the memory of Dr. Hiroshi Hara (1932‐2025), who helped with the original design and execution of this study. The authors appreciate Dr. Eto for measuring mitochondrial DNA content and the cooperation of the staff at Haradoi Hospital and Hara School of Nursing in data collection.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
References
- 1. Ministry of Health, Labour and Welfare of Japan , “Abridged Life Tables for Japan 2022. Life Expectancies at Specified Ages,” 2025, https://www.mhlw.go.jp/english/database/db‐hw/lifetb22/dl/lifetb22‐01.pdf.
- 2. Ministry of Health, Labour and Welfare of Japan , “Summary Report of Comprehensive Survey of Living Conditions 2022,” 2025, https://www.mhlw.go.jp/english/database/db‐hss/dl/report_gaikyo_2022.pdf.
- 3. Fried L. P., Tangen C. M., Walston J., et al., “Frailty in Older Adults: Evidence for a Phenotype,” Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 56, no. 3 (2001): M146–M156, 10.1093/gerona/56.3.m146. [DOI] [PubMed] [Google Scholar]
- 4. Gonzalez‐Freire M., de Cabo R., Bernier M., et al., “Reconsidering the Role of Mitochondria in Aging,” Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 70, no. 11 (2015): 1334–1342, 10.1093/gerona/glv070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Cedikova M., Pitule P., Kripnerova M., et al., “Multiple Roles of Mitochondria in Aging Processes,” Physiological Research 65, no. 5 (2016): S519–S531, 10.33549/physiolres.933538. [DOI] [PubMed] [Google Scholar]
- 6. Fountain W. A., Bopp T. S., Bene M., and Walston J. D., “Metabolic Dysfunction and the Development of Physical Frailty: An Aging War of Attrition,” Geroscience 46, no. 4 (2024): 3711–3721, 10.1007/s11357-024-01101-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zoico E., Rossi A., Di Francesco V., et al., “Adipose Tissue Infiltration in Skeletal Muscle of Healthy Elderly Men: Relationships With Body Composition, Insulin Resistance, and Inflammation at the Systemic and Tissue Level,” Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 65, no. 3 (2010): 295–299, 10.1093/gerona/glp155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Stout M. B., Justice J. N., Nicklas B. J., and Kirkland J. L., “Physiological Aging: Links Among Adipose Tissue Dysfunction, Diabetes, and Frailty,” Physiology (Bethesda, Md.) 32, no. 1 (2017): 9–19, 10.1152/physiol.00012.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Jang S. Y. and Choi K. M., “Impact of Adipose Tissue and Lipids on Skeletal Muscle in Sarcopenia,” Journal of Cachexia, Sarcopenia and Muscle 16, no. 4 (2025): e70000, 10.1002/jcsm.70000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Zhao Q., Zhou X., Kuiper R., Curbo S., and Karlsson A., “Mitochondrial Dysfunction Is Associated With Lipid Metabolism Disorder and Upregulation of Angiotensin‐Converting Enzyme 2,” PLoS One 17, no. 6 (2022): e0270418, 10.1371/journal.pone.0270418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. R. C. Scaduto, Jr. and Grotyohann L. W., “Measurement of Mitochondrial Membrane Potential Using Fluorescent Rhodamine Derivatives,” Biophysical Journal 76, no. 1 Pt 1 (1999): 469–477, 10.1016/S0006-3495(99)77214-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Gerencser A. A., Chinopoulos C., Birket M. J., et al., “Quantitative Measurement of Mitochondrial Membrane Potential in Cultured Cells: Calcium‐Induced de‐ and Hyperpolarization of Neuronal Mitochondria,” Journal of Physiology 590, no. 12 (2012): 2845–2871, 10.1113/jphysiol.2012.228387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Wibom R., Hagenfeldt L., and von Döbeln U., “Measurement of ATP Production and Respiratory Chain Enzyme Activities in Mitochondria Isolated From Small Muscle Biopsy Samples,” Analytical Biochemistry 311, no. 2 (2002): 139–151, 10.1016/s0003-2697(02)00424-4. [DOI] [PubMed] [Google Scholar]
- 14. Castellani C. A., Longchamps R. J., Sun J., Guallar E., and Arking D. E., “Thinking Outside the Nucleus: Mitochondrial DNA Copy Number in Health and Disease,” Mitochondrion 53 (2020): 214–223, 10.1016/j.mito.2020.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Ashar F. N., Zhang Y., Longchamps R. J., et al., “Association of Mitochondrial DNA Copy Number With Cardiovascular Disease,” JAMA Cardiology 2, no. 11 (2017): 1247–1255, 10.1001/jamacardio.2017.3683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Li X., Liu X., Chen X., et al., “Leukocyte Mitochondrial DNA Copy Number and Cardiovascular Disease: A Systematic Review and Meta‐Analysis of Cohort Studies,” iScience 27, no. 9 (2024): 110522, 10.1016/j.isci.2024.110522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Ikezaki H., Furusyo N., Nakashima R., et al., “Kyushu and Okinawa Population Study (KOPS): A Large Prospective Cohort Study in Japan,” BMJ Open 11, no. 21 (2021): e053763, 10.1136/bmjopen-2021-053763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Ikezaki H., Nomura H., and Shimono N., “Impact of Peripheral Mitochondrial DNA Level on Immune Response After COVID‐19 Vaccination,” iScience 26, no. 7 (2023): 107094, 10.1016/j.isci.2023.107094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. AYUMIEYE , “AYUMIEYE Waseda Elderly Health Association Co., Ltd,” 2025, https://ayumieye.com.
- 20. Satake S. and Arai H., “The Revised Japanese Version of the Cardiovascular Health Study Criteria (Revised J‐CHS Criteria),” Geriatrics & Gerontology International 20, no. 10 (2020): 992–993, 10.1111/ggi.14005. [DOI] [PubMed] [Google Scholar]
- 21. Ikezaki H., Furusyo N., Yokota Y., et al., “Small Dense Low‐Density Lipoprotein Cholesterol and Carotid Intimal Medial Thickness Progression,” Journal of Atherosclerosis and Thrombosis 27, no. 10 (2020): 1108–1122, 10.5551/jat.54130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ikezaki H., Furusyo N., Ihara T., et al., “Glycated Albumin as a Diagnostic Tool for Diabetes in a General Japanese Population,” Metabolism 64, no. 6 (2015): 698–705, 10.1016/j.metabol.2015.03.003. [DOI] [PubMed] [Google Scholar]
- 23. Ashar F. N., Moes A., Moore A. Z., et al., “Association of Mitochondrial DNA Levels With Frailty and All‐Cause Mortality,” Journal of Molecular Medicine (Berlin, Germany) 93, no. 2 (2015): 177–186, 10.1007/s00109-014-1233-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Haizlip K. M., Harrison B. C., and Leinwand L. A., “Sex‐Based Differences in Skeletal Muscle Kinetics and Fiber‐Type Composition,” Physiology (Bethesda, Md.) 30, no. 1 (2015): 30–39, 10.1152/physiol.00024.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Landen S., Hiam D., Voisin S., Jacques M., Lamon S., and Eynon N., “Physiological and Molecular Sex Differences in Human Skeletal Muscle in Response to Exercise Training,” Journal of Physiology 601, no. 3 (2023): 419–434, 10.1113/JP279499. [DOI] [PubMed] [Google Scholar]
- 26. Agius R., Pace N. P., and Fava S., “Reduced Leukocyte Mitochondrial Copy Number in Metabolic Syndrome and Metabolically Healthy Obesity,” Front Endocrinol (Lausanne) 13 (2022): 886957, 10.3389/fendo.2022.886957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Liu X., Sun X., Zhang Y., et al., “Association Between Whole Blood‐Derived Mitochondrial DNA Copy Number, Low‐Density Lipoprotein Cholesterol, and Cardiovascular Disease Risk,” Journal of the American Heart Association 12, no. 20 (2023): e029090, 10.1161/JAHA.122.029090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Furuhashi M., “New Insights Into Purine Metabolism in Metabolic Diseases: Role of Xanthine Oxidoreductase Activity,” American Journal of Physiology. Endocrinology and Metabolism 319, no. 5 (2020): E827–E834, 10.1152/ajpendo.00378.2020. [DOI] [PubMed] [Google Scholar]
- 29. Liu N., Huang L., Xu H., et al., “Phosphatidylserine Decarboxylase Downregulation in Uric Acid‐Induced Hepatic Mitochondrial Dysfunction and Apoptosis,” MedComm 4, no. 4 (2023): e336, 10.1002/mco2.336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Paul B. T., Manz D. H., Torti F. M., and Torti S. V., “Mitochondria and Iron: Current Questions,” Expert Review of Hematology 10, no. 1 (2017): 65–79, 10.1080/17474086.2016.1268047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Knez J., Marrachelli V. G., Cauwenberghs N., et al., “Peripheral Blood Mitochondrial DNA Content in Relation to Circulating Metabolites and Inflammatory Markers: A Population Study,” PLoS One 12, no. 7 (2017): e0181036, 10.1371/journal.pone.0181036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wu I. C., Lin C. C., Liu C. S., Hsu C. C., Chen C. Y., and Hsiung C. A., “Interrelations Between Mitochondrial DNA Copy Number and Inflammation in Older Adults,” Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 72, no. 7 (2017): 937–944, 10.1093/gerona/glx033. [DOI] [PubMed] [Google Scholar]
- 33. Mizuno G., Yamada H., Tsuboi Y., et al., “Low Mitochondrial DNA Copy Number in Peripheral Blood Mononuclear Cells Is Associated With Future Mortality Risk: A Long‐Term Follow‐Up Study From Japan,” Journal of Nutrition, Health & Aging 28, no. 1 (2024): 100013, 10.1016/j.jnha.2023.100013. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.