Summary
Jaundice, a condition characterized by elevated circulating bilirubin generated by biliverdin reductase A (BVRA), is protective against malaria. Beyond its oxidoreductase activity, BVRA acts as a protein kinase and transcriptional regulator. To probe the protective effect of BVRA oxidoreductase activity, we generated mice harboring G17A and E97A missense mutations in its NAD(P)H-binding and reductase motifs, respectively. BVRA oxidoreductase activity was reduced by ∼95% and ∼80%–90% in BlvraG17A and BlvraE97A vs. wild-type (BlvraWT) mice, respectively. Plasmodium chabaudi chabaudi AS (Pcc) infection was lethal in BlvraG17A and BlvraE97A, compared to the non-lethal outcome in control BlvraWT mice. Quantification of circulating unconjugated bilirubin in Pcc-infected mice revealed dose response effect whereby the mutant strains failed to reach a protective ∼20–30 μM (∼1–2 mg/dL) threshold. These findings establish the antimalarial effect of BVRA oxidoreductase activity and define a threshold of circulating bilirubin required for malaria protection, informing on therapeutic development and biomarker-guided strategies.
Subject areas: biological sciences
Graphical abstract

Highlights
-
•
Establishment of catalytic deficient BVRA mouse mutants
-
•
Antimalarial effect of BVRA relies on its catalytic activity
-
•
A minimal bilirubin threshold for parasite control
-
•
A minimal bilirubin threshold for malaria resolution
Biological sciences
Introduction
Plasmodium falciparum malaria remains a major global burden to humanity.1 In the absence of vaccines providing sterile lifelong protection,2 anti-malarial drugs remain our first line of defense.3 This, however, is poised by the selection of drug-resistant virulent parasite strains,1 requiring the development of orthogonal approaches targeting vital pathways deployed by Plasmodium throughout different stages of infection.4 These approaches can be inferred from rodent models of malaria, when targeting evolutionarily conserved vital pathways used by the parasite to infect their hosts. Vertebrate, including mice and humans, develop malaria upon the inoculation of Plasmodium sporozoites in the dermis, through the bite of infected Anopheles mosquitoes. Sporozoites reach the liver, via the bloodstream, developing and rupturing infected hepatocytes to release merozoites, which invade and multiply exponentially in red blood cells (RBC), during the symptomatic blood stage of infection.5
Plasmodium blood stage is characterized by circadian cycles of intravascular hemolysis with release of Hb tetramers (α2β2) into plasma. Extracellular Hb dissociates into dimers (αβ) that undergo (auto) oxidation and release their non-covalently bound prosthetic heme groups.6,7 This pathologic process produces cytotoxic8,9,10,11,12 labile heme,6,7,13,14 an independent risk factor for severe P. falciparum malaria13 that promotes disease severity and mortality in mice.14,15,16,17,18
The infected host limits the pathogenic effects of labile heme via its catabolism by heme oxygenase-1.14,15,19,20,21 This stress-responsive enzyme cleaves heme’s tetrapyrrole ring to produce biliverdin, releasing equimolar amounts of carbon monoxide and iron.22 Carbon monoxide binds avidly to iron in the heme groups of extracellular Hb, inhibiting further heme release from Hb and conferring protection against experimental cerebral malaria in mice.14,15 Catalytic iron induces ferritin and ferroportin 1 (SLC40A1), which restrain iron redox activity and promote iron cellular export, preventing severe non-cerebral malaria12,20,23 including life-threatening malarial anemia,23 respectively.
We found that the reduction of biliverdin to bilirubin, catalyzed by BVRA,24,25,26 is protective against malaria.27 Once considered as a lipophilic waste product, bilirubin is now recognized as a cytoprotective28,29,30,31 radical-trapping antioxidant,28,30,32 while also regulating immune responses33 and different aspects of energy metabolism.34,35,36
BVRA exerts “non-canonical” functions,25,37,38,39,40,41,42 attributed to its dual-specificity kinase (Ser/Thr and Tyr) and a DNA/chromatin-binding motifs, at the N-terminal (aa 1–107) and C-terminal (aa 107–296) domains, respectively.25,39,43 The dual kinase motif of BVRA phosphorylates the insulin receptor (INSR) substrate-1 (IRS-1), thereby regulating insulin signaling and downstream components of this pathway.34,44 The DNA/chromatin-binding activity regulates the activating transcription factor 2 (ATF-2).38,45 Moreover, BVRA also regulates the transcription factor nuclear factor erythroid-derived factor-like 2 (NRF2), independently of its catalytic activity.46
Circulating bilirubin is lipophilic and is conjugated to glucuronic acid, via a reaction catalyzed in the liver by UDP glucuronosyltransferase family 1 member A1 (UGT1A1),47 preventing its cytotoxicity.48 When bilirubin conjugation falls below its production rate, unconjugated hyperbilirubinemia develops, eventually leading to jaundice.
Recognized clinically by yellowish discoloration of the skin and sclerae,49 jaundice is used clinically as a biomarker of liver dysfunction. While accurate, this led to the perception of jaundice representing a maladaptive response, a notion challenged by the recent finding that unconjugated bilirubin confers resistance to malaria.27
The antimalarial effect of jaundice is attributed to the cytotoxic effect of unconjugated bilirubin on Plasmodium spp. parasites, the causative agents of malaria, suggesting that BVRA enzymatic activity is protective against malaria.27 Here, we tested this hypothesis in mice carrying genetic disruptions in the NAD(P)H-binding or reductase domains. We found that both mutant mouse strains succumbed to malaria, suggesting that the antimalarial effect of BVRA relies strictly on its oxidoreductase activity. Moreover, a comparison between mutant and wild type mouse strains revealed the minimum level of circulating bilirubin required for its antimalarial effect.
Results
CRISPR-Cas9-mediated generation of BVRA catalytic mutant mice
To determine whether the protective effect of BVRA against malaria relies strictly on its oxidoreductase activity, we generated two C57BL/6J mouse strains carrying a G17A mutation targeting the NAD(P)H-binding motif (Figures 1A and 1B) or an E97A mutation targeting the oxidoreductase biliverdin-binding motif of BVRA (Figures 1F and 1G). By targeting these domains, we set out to distinguish between cofactor-[NAD(P)H] and substrate (biliverdin IXα)-dependent mechanisms underlying BVRA’s antimalarial activity.
Figure 1.
Generation and validation of Blvra G17A and Blvra E97A mutant mice
(A) Crystal structure of rat biliverdin reductase A (BVRA, PDB: 1LC3) showing the G17A mutation site within the NADPH-binding motif. The protein backbone is shown as a marine blue cartoon. The NADPH-binding motif (residues 13–19, green sticks) contains the conserved Rossmann fold (GXGXXG) essential for cofactor binding. The G17A mutation site is highlighted in red sticks, a critical position within this cofactor-binding motif.
(B) Schematic representation of CRISPR-Cas9 targeting strategy showing the guide RNA (gRNA) target sequence and protospacer adjacent motif (PAM) for wild-type (WT) and mutant sequences to introduce the G17A mutation in the NAD(P)H-binding motif.
(C) Schematic of genotyping PCR (gPCR) and Sanger sequencing analysis.
(D) gPCR analysis showing gel electrophoresis of amplification products from BlvraG17A mutant, BlvraWT control samples and no template control as NTC, together with molecular weight (MW) markers indicated in base pairs (bp).
(E) Sanger sequencing chromatogram confirming the precise insertion of the G17A mutation in BlvraG17A mice compared to BlvraWT controls.
(F) BVRA crystal structure of rat biliverdin reductase A (BVRA, PDB: 1LC3) showing the E97A mutation site within the biliverdin-binding (reductase) domain (residues 90–105, green sticks). The protein backbone is shown as a marine blue cartoon. The E97A mutation is highlighted in orange sticks, indicating its position within the substrate-binding region.
(G) Schematic representation of CRISPR-Cas9 targeting strategy showing the gRNA target sequence and PAM for WT and mutant sequences to introduce the E97A mutation in the reductase domain.
(H) Schematic of genotyping gPCR and Sanger sequencing analysis.
(I) gPCR analysis showing gel electrophoresis of amplification products from BlvraE97A mutant, BlvraWT control samples and no template control as NTC, together with molecular weight (MW) markers indicated in base pairs (bp).
(J) Sanger sequencing chromatogram confirming the precise insertion of the E97A mutation in BlvraE97A mice compared to BlvraWT controls.
The BlvraG17A strain carries a GGC→GCA missense mutation replacing glycine (G) at position 17 by an alanine (A) (G17A) in the NADPH-binding domain of BVRA (Figures 1A and 1B). This is expected to disrupt the flexibility of the BVRA NADPH-binding loop,46 potentially affecting cofactor binding affinity and therefore catalytic efficiency (Figures 1A and 1B). The GCA missense mutation was confirmed by genomic PCR (Figures 1C and 1D) and validated by Sanger sequencing (Figures 1C and 1E).
The BlvraE97A strain carries a GAA→GCC missense mutation replacing glutamate (E) at position 97 by an alanine (A) (E97A) in the biliverdin-binding (reductase) domain of BVRA (Figures 1F and 1G). This is expected to disrupt BVRA reductase activity, impairing biliverdin IXα reduction into bilirubin IXα (Figures 1F and 1G). The GCC missense mutation was confirmed by genomic PCR and Sanger sequencing (Figures 1H–1J).
BVRA expression in Blvra E97A and Blvra G17A mouse strains
The relative level of Blvra mRNA expression in BlvraG17A mice was comparable to wild-type (BlvraWT) controls, as assessed by RT-qPCR from whole spleen, kidney, and liver (Figure 2A). Blvra−/− mice showed neither Blvra mRNA nor protein expression (Figures 2A and 2B). BVRA protein expression was lower in BlvraG17A vs. BlvraWT mice, as assessed by western blot (Figure 2B).
Figure 2.
Expression analysis of BVRA missense mutants G17A and E97A in C57BL/6J mice
(A) RT-qPCR analysis of Blvra mRNA expression in spleen, kidney, and liver from BlvraWT, Blvra−/− and BlvraG17A mice. Data are expressed as Blvra/Rplp0 (2−ΔCt) and presented as individual data points with bar graphs showing mean ± SD. n = 3 mice per genotype.
(B) Western blot analysis of BVRA protein expression in spleen, kidney, and liver. Representative blots show BVRA (33 kDa) and β-actin (42 kDa) loading control. Quantification of BVRA protein levels normalized to β-actin is shown below each blot as individual data points with bar graphs showing mean ± SD. n = 3–5 per genotype.
(C) RT-qPCR analysis of Blvra mRNA expression in spleen, kidney and liver tissues from BlvraWT, Blvra−/−, and BlvraE97A mice. Data are expressed as Blvra/Rplp0 (2−ΔCt) and presented as individual data points with bar graphs showing mean ± SD. n = 3 per genotype.
(D) Western blot analysis of BVRA protein expression in spleen, kidney, and liver tissue. Representative blots and quantification of BVRA protein levels normalized to β-actin below each blot, shown as individual data points with bar graphs showing mean ± SD. n = 3–6 mice per genotype. Statistical comparisons were performed using one-way ANOVA with Tukey’s post hoc test. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; NS, not significant.
The relative level of Blvra mRNA expression in BlvraE97A mice was slightly elevated in the kidney and liver but not the spleen, where there was a slight decrease, compared to BlvraWT controls, as quantified by RT-qPCR (Figure 2C). BVRA protein expression was only modestly reduced in the spleen of BlvraE97A vs. BlvraWT controls, as assessed by western blot (Figure 2D). This was not observed in the kidney and liver extracts, which may reflect tissue-specific differences in protein levels (Figure 2D).
Bilirubin production is diminished in Blvra E97A and Blvra G17A mice
To assess the functional consequences of the E97A and G17A on BVRA enzymatic activity, we performed ex vivo activity assays in liver, spleen, and kidney homogenates from BlvraE97A, and BlvraG17A vs. BlvraWT, and Blvra−/− mice. Splenic BVRA enzymatic activity was barely detectable in BlvraG17A compared to ∼0.2 nM bilirubin/μg protein/minute in BlvraWT mice (Figure 3A). Area under the curve (AUC) analysis confirmed a ∼95%–97% reduction, comparable to a 97%–98% reduction in Blvra−/− mice, with no significant difference between mutant genotypes (Figure 3B), consistent with loss of catalytic activity by purified BVRA G17A mutant protein.46,50
Figure 3.
BVRA enzymatic activity is repressed in Blvra G17A and Blvra E97A mutant mice
(A and B) Ex-vivo BVRA enzymatic activity in tissue homogenates from BlvraG17A mice. (A) Time course of bilirubin production measured as bilirubin concentration (nM/μg protein) over 50 min in spleen (left), kidney (middle), and liver (right) from BlvraWT, Blvra−/−, and BlvraG17A mice. (B) Area under the curve (AUC) analysis spleen (left), kidney (middle), and liver (right) comparing enzymatic activity between genotypes.
(C and D) Ex-vivo BVRA enzymatic activity in tissue homogenates from BlvraE97A mice. (C) Time course of bilirubin production measured as BR concentration (nM/μg protein) over 50 min in spleen (left), kidney (middle), and liver (right) from BlvraWT, Blvra−/−, and BlvraG17A mice. (D) Area under the curve (AUC) analysis for spleen (left), kidney (middle), and liver (right) comparing enzymatic activity between genotypes. Data represent mean ± SD. n = 3 mice per genotype. Statistical comparisons were performed using one-way ANOVA with post hoc test. ∗p < 0.05, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; NS, not significant. (A and B) Ex vivo BVRA activity from BlvraG17A mice. (C and D) Ex vivo BVRA activity from BlvraE97A mice. Mean ± SD. n = 3 per genotype. One-way ANOVA. ∗p < 0.05, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; NS, not significant.
Renal BVRA enzymatic activity, estimated to be ∼0.24 nM bilirubin/μg protein/minute in BlvraWT mice was reduced by ∼95%–97% in BlvraG17A mice and greater than 97% in Blvra−/− mice (Figures 3A and 3B). Hepatic BVRA enzymatic activity was relatively lower, compared to spleen or kidney from BlvraWT mice, corresponding to ∼0.14 nM/μg protein/minute (Figure 3A). Liver from BlvraG17A mice presented residual BVRA activity while those from Blvra−/− mice showed no measurable activity (Figure 3A), corresponding to a ∼90%–93% and 95% reduction, compared to BlvraWT controls, respectively (Figure 3B).
The oxidoreductase activity of BVRA was substantially diminished, yet detectable, in the spleen, kidney and liver of BlvraE97A vs. BlvraWT controls (Figure 3C). The spleen from BlvraE97A mice exhibited lower BVRA enzymatic activity, corresponding to ∼0.15 vs. 0.75 nM/μg protein/minute in BlvraWT mice in the first 20 min (Figure 3C). AUC analysis estimated a ∼80% reduction in BVRA enzymatic activity, yet higher in BlvraE97A vs. Blvra−/− mice (Figure 3D). Renal BVRA activity in BlvraE97A mice was also decreased to ∼0.2 nM bilirubin/μg protein/min vs. ∼0.85 nM/μg protein/min in BlvraWT mice (Figure 3C), corresponding to a ∼90%–95% reduction, similar to Blvra−/− mice (Figure 3D). Liver from BlvraE97A mice also showed a ∼85%–90% reduction of BVRA activity to ∼0.15 nM bilirubin/μg protein/min vs. 0.6 nM bilirubin/μg protein/min in BlvraWT mice (Figures 3C and 3D).
These findings suggest that the G17A mutation in the NADPH/NADH binding motif of BVRA results in nearly complete loss of expression and activity. In contrast the E97A mutation in the reductase motif reduces BVRA activity while preserving its expression.
Non-canonical Blvra E97A and Blvra G17A activity
We tested whether silencing the endogenous NADPH/NADH binding (G17A) or reductase (E97A) motifs of BVRA impacts NRF2 activation, as demonstrated recently in neuronal cells.46 To test this hypothesis, we exposed mouse bone marrow-derived macrophages (BMDM) to heme (Figure 4A), a potent pro-inflammatory agonist that induces a profound macrophage morphological51 and transcriptional remodeling,52 including the activation of NRF2.53
Figure 4.
BVRA oxidoreductase activity is dispensable for heme-induced NRF2 activation and insulin receptor signaling in BMDM
(A) BMDM from BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice were stimulated with heme and NRF2 activation assessed by immunofluorescence.
(B) Representative immunofluorescence images of NRF2 nuclear translocation in BMDM following heme stimulation. Images show confocal z stack cross-sections with orthogonal views. NRF2 is shown in red, DAPI nuclear stain in blue, and phalloidin (cytoskeleton marker) in white. Scale bars, 5 μm.
(C) Quantification of cytoplasmic (left graph) or nuclear (right graph) NRF2 MFI in BMDM stimulated with (+) or without (−) heme. Each data point represents a technical replicate. n = 5–10 replicates. Data in (C) is representative from two independent experiments with a similar trend.
(D) BMDM from BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice were stimulated with heme and NRF2-regulated gene expression assessed by qRT-PCR.
(E) RT-qPCR analysis of NRF2 target genes (Nqo1, Fth, Gclc, Hmox1, Nrf2, and Blvra) in BMDM stimulated with (+) or without (−) heme. Data expressed as gene/Rplp0 (2−ΔCt). Each data point represents a technical replicate. n = 3–6 replicates from two independent experiments with a similar trend.
(F) BMDM from BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice were stimulated with insulin and INSR signaling assessed by western blot.
(G) Representative western blots showing IRS-1 phosphorylation at tyrosine 612 (IRS-1Y612), at serine 307 (IRS-1S307), total IRS-1, and vinculin as loading control in BMDM stimulated with insulin vs. control vehicle.
(H) Quantification of IRS-1Y612 normalized to IRS-1S307 in BMDM stimulated with (+) or without (−) insulin. Each data point represents a technical replicate. n = 3 replicates from one experiment. Data in (C, E, and H) are presented as individual data points with bar graphs showing mean ± SD. Statistical comparisons were performed using two-way ANOVA with Šídák’s post hoc test. ∗p < 0.05, ∗∗p < 0.01; NS, not significant.
Heme induced NRF2 protein expression in the cytoplasm of BlvraWT but not Blvra−/− BMDM, as quantified by immunofluorescence (Figures 4B, 4C, and S1E). This was restored in BlvraG17A and BlvraE97A BMDM, suggesting that BVRA regulates NRF2 expression via a mechanism independent of its oxidoreductase activity.
Heme induced NRF2 nuclear translocation to the same extent in BlvraWT vs. Blvra−/− BlvraG17A and BlvraE97A BMDM, as quantified by immunofluorescence (Figures 4B, 4C, and S1E). This suggests that BVRA does not modulate NRF2 nuclear translocation, consistent with prior studies.46
The specificity of the antibody used to detect mouse NRF2 protein was confirmed by immunoblotting and confocal microscopy, using Nrf2-deficient (Nrf2−/−) BMDM exposed to the 26S proteasome inhibitor MG-132, to induce NFR2 nuclear accumulation (S1A-D).
Heme also induced the accumulation of mRNA encoding a number of NRF2-regulated genes, including NAD(P)H:quinone oxidoreductase 1 (Nqo1), ferritin H chain (Fth), glutamate-cysteine ligase catalytic subunit (Gclc) and heme oxygenase-1 (Hmox1), in BlvraWT BMDM (Figures 4D and 4E). The induction of these NRF2-regulated genes occurred to the same extent in Blvra−/−, BlvraG17A and BlvraE97A, compared to BlvraWT BMDM (Figures 4D and 4E).
Heme induced the Nrf2 mRNA accumulation in BlvraWT but not in Blvra−/−, BlvraG17A nor in BlvraE97A BMDM (Figures 4D and 4E). This suggests that the oxidoreductase activity of BVRA interferes with the positive autoregulatory loop, whereby NRF2 regulates its own expression via binding to an antioxidant response element (ARE) in its promoter.54
Of note, Blvra mRNA expression in BlvraWT BMDM was reduced in response to heme (Figures 4D and 4E), suggesting that heme represses Blvra transcription. This repression was also observed in BlvraG17A and BlvraE97A BMDM (Figures 4D and 4E), suggesting that this occurs via a mechanism that is not regulated by BVRA oxidoreductase activity.
We then asked whether the oxidoreductase activity of BVRA interferes with INSR signaling,34,44 via the dual-specificity kinase domain of BVRA.25,39,43 Insulin induced the phosphorylation of IRS-1 at tyrosine 612 (IRS-1Y612) and at serine 307 (IRS-1S307) in BlvraWT BMDM (Figures 4F, 4G, S2A, and S2B), a marker of INSR activation55 and repression,56 respectively. The ratio of IRS-1Y612 over IRS-1S307 phosphorylation, reflecting a net induction of INSR signaling, was increased in BlvraWT but not in Blvra−/− BMDM (Figures 4F, 4G, and S2A, and S2B). The ratio of IRS-1Y612 over IRS-1S307 phosphorylation was induced in response to insulin in BlvraG17A and BlvraE97A BMDM (Figures 4F, 4G, S2A, and S2B). This suggests that endogenous BVRA regulates INSR activation via a mechanism that does not rely on its oxidoreductase activity.
BVRA enzymatic activity is essential to survive malaria
To investigate the contribution of BVRA oxidoreductase activity to its antimalarial effect,27 we used Plasmodium chabaudi chabaudi (Pcc) AS, a well-established experimental model of malaria non-lethal to C57BL/6J mice.57 We then quantified serum unconjugated bilirubin concentration, using an UnaG-based assay,58 and compared multiple disease parameters in BlvraWT vs. Blvra−/−, BlvraG17A and BlvraE97A mice through a 15-day time course of infection.
BlvraG17A mice presented barely detectable levels of unconjugated bilirubin at steady state, prior to Pcc infection, slightly above Blvra−/− mice (Figures 5B and 5C), consistent with almost complete loss of BVRA expression (Figure 2B) and enzymatic activity (Figures 3A and 3B). In contrast, BlvraE97A mice presented ∼1–2 μM of circulating unconjugated bilirubin at steady state, similar to BlvraWT mice (Figures 5A–5C). This confirms that the BVRA E97A mutation retains protein expression (Figure 2D) but only residual enzymatic function (Figures 3C and 3D).
Figure 5.
BVRA oxidoreductase activity determines malaria survival through dose-dependent bilirubin production
(A) Experimental schematic showing Plasmodium chabaudi chabaudi (Pcc) infection in mice with different Blvra where bilirubin production was evaluated.
(B) Time course of serum unconjugated bilirubin concentration following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype) as measured by the UnaG-based assay. Data are shown as mean ± SD.
(C) Serum unconjugated bilirubin levels before infection (green shaded region from B) in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 3 to 6 per genotype).
(D) Serum unconjugated bilirubin levels at day 7 post-infection (gray shaded region from B) in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype).
(E) Experimental schematic for disease severity and survival analysis.
(F) Disease severity scores (DSS) over time following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(G) Disease trajectories showing the correlation between DSS and serum bilirubin levels for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(H) Kaplan-Meier survival curves of Pcc-infected BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). (A–H) Data pooled from n = 3 independent experiments.
Statistical comparisons were performed using two-way ANOVA (B and F); one-way ANOVA with Tukey’s multiple comparison test (C and D); log rank (Mantel-Cox) test (H). ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.0001; NS, not significant.
BlvraWT mice developed jaundice in response to Pcc infection (Figures 5A and 5B), consistent with described.27,59 The concentration of unconjugated bilirubin increased progressively in the first few days, reaching the maximal level of ∼30–40 μM by day 7 post-infection (Figures 5A, 5B, and 5D). In contrast, BlvraG17A and Blvra−/− mice presented residual, and no detectable levels of circulating unconjugated bilirubin throughout the course of infection, respectively (Figures 5A, 5B, and 5D). On the other hand, BlvraE97A developed mild jaundice in response to Pcc infection, reaching a maximal level of ∼10–15 μM by day 7, lower than infected BlvraWT mice (Figures 5A, 5B, and 5D).
Malaria severity diverged markedly between BlvraWT vs. BlvraG17A, BlvraE97A or Blvra−/− mice (Figures 5E–5G) with BlvraWT mice reaching disease severity scores (DSS) below 5 at days 7–9 after Pcc-infection, reducing DSS to 0 thereafter (Figures 5E–5G). In contrast, BlvraG17A and BlvraE97A mice reached maximal DSS scores of 10–13 at days 7–9 after Pcc-infection (Figures 5E–5G), similar to Blvra−/− mice (Figures 5E–5G).
The disease trajectories,20,60,61 established by the relationship of DSS and circulating unconjugated bilirubin, presented counter clock progressions (Figure 5G). BlvraWT increased the concentration of circulating unconjugated bilirubin to ∼35–40 μM maxima, concurrent with moderate ∼5–7 DSS scores, decreasing both parameters thereafter toward full disease recovery (Figure 5G). In contrast, BlvraG17A mice displayed a near-vertical DSS trajectory reaching ∼12–13 disease score, concurrent with a maximal bilirubin concentration below 5 μM, somewhat above Blvra−/− mice (Figure 5G). BlvraE97A mice showed an intermediate disease trajectory whereby bilirubin concentration reached a maximal level of ∼15–20 μM, failing however, to restrain an upward progression of DSS toward ∼10–12 (Figure 5G).
Approximately 80% of BlvraWT mice survived Pcc infection (Figure 5H), while BlvraG17A and BlvraE97A mice presented a progressive incidence of mortality starting at 7–8 days and reaching 100% by days 10–12 post-infection, similar to Blvra−/− mice (Figure 5H).27 This demonstrates that BVRA oxidoreductase activity is required to sustain circulating bilirubin above a 20–30 μM threshold required to mitigate malaria severity, similar to observed in P. falciparum malaria.27
BVRA enzymatic activity exerts antiplasmodial effects
The kinetics of parasitemia (% of infected RBC) showed distinct temporal patterns between genotypes (Figures 6A and 6B). Initially, all genotypes exhibited similar infection dynamics through day 6 post-infection, reaching peak parasitemias of ∼50%–60% (Figures 6A and 6B). BlvraWT mice presented parasitemias of ∼15%–20% at day 8 post-infection, compared to ∼30%–50% in BlvraG17A, BlvraE97A and Blvra−/− mice (Figure 6C). The disease trajectories established by the relationship of DSS vs. parasitemia, also showed fundamental differences among genotypes (Figure 6D). While BlvraWT mice progressed toward a maximal DSS of ∼5–6 before transitioning toward full recovery (Figure 6D), BlvraG17A and BlvraE97A mice presented an irreversible upward DSS progression to 13 (i.e., death), similar to Blvra−/− mice (Figure 6D). This is consistent with the BVRA catalytic activity containing parasitemia.27
Figure 6.
Biliverdin reductase A oxidoreductase activity is essential to limit life-threatening Parasitemia
(A) Experimental schematic for disease severity and parasitemia.
(B) Time course parasitemia (% infected RBC; iRBC) following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(C) Highlighted iRBC levels at day 8 (gray shaded region from B). Each circle represents an individual mouse.
(D) Correlation between DSS and parasitemia for each genotype, showing inverse relationship in BlvraWT mice. Direction of disease trajectory is shown by arrows in each curve.
(E) Experimental schematic for total RBC analysis.
(F) Time course of total RBC counts following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(G) Highlighted total RBC count at day 9 (gray shaded region from F). Each circle represents an individual mouse.
(H) Correlation between DSS and total RBC count for each genotype, showing inverse relationship in BlvraWT mice. Direction of disease trajectory is shown by arrows in each curve.
(I) Experimental schematic for parasite burden analysis.
(J) Time course of parasite burden (total infected RBC per μL blood; iRBC) following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(K) Highlighted parasite burden levels at day 9 (gray shaded region from J). Each circle represents an individual mouse.
(L) Correlation between DSS and parasite burden for each genotype, showing inverse relationship most prominently in BlvraWT mice.
(M) Experimental schematic for parasitemia and serum bilirubin.
(N) Disease trajectories showing the correlation between parasitemia and serum unconjugated bilirubin levels for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(O) Experimental schematic for parasite burden and serum unconjugated bilirubin.
(P) Disease trajectories showing the correlation between parasite burden and serum unconjugated bilirubin levels for each genotype. Direction of disease trajectory is shown by arrows in each curve. (A–P) Data pooled from n = 3 independent experiments.
Statistical comparisons were performed using two-way ANOVA (B, F, and J); two-way ANOVA with linear mixed effects model (C and K) as primary analysis and treating independent experiments as linked experiments; one-way ANOVA with Tukey’s multiple comparison test (G) ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001; NS, not significant.
Anemia severity was comparable among BlvraWT vs. Blvra mutant mice, as monitored by the number of circulating RBC throughout the course of the infection (Figures 6E and 6F). Analysis of disease trajectories established by the relationship of DSS vs. total RBC count presented counterclockwise loop progressions (Figure 6H). While BlvraWT mice developed maximal DSS of ∼5–6 at ∼2 × 106 RBC/μL, transitioning to recovery from anemia, Blvra mutant mice underwent irreversible DSS progression under the same levels of anemia (Figure 6G). This suggests that severe anemia does not account for the vulnerability of Blvra mutant mice during Pcc infection.
The kinetics of parasite burden (nbr. RBC/μL) were similar to parasitemia (Figures 6I and 6J). BlvraWT mice decreased parasite burden to approximately 2–3x106 iRBC/μL at day 9 post-infection, while BlvraG17A and BlvraE97A mice presented 1.94- and 1.63-fold higher parasite burdens corresponding to ∼2–6x105 iRBC/μL, respectively, similar to Blvra−/− mice (Figure 6K). This is consistent with BVRA catalytic activity exerting an antimalarial effect27 that contains malaria severity.
Disease trajectories representing the relationship of circulating bilirubin vs. parasitemia or parasite burden confirmed fundamental differences in BlvraWT vs. Blvra mutant mice (Figures 6M–6P). BlvraWT mice presented stable bilirubin concentrations at parasitemia below ∼50% (Figures 6M and 6N) and parasite burden of ∼2–3x106 iRBC/μL (Figures 6O and 6P). Above this threshold, however, bilirubin concentration increased to reach a peak concentration of ∼30–35 μM, followed by a sharp decrease, associated with parasite clearance (Figures 6M–6P). In contrast, BlvraG17A and BlvraE97A mice failed to increase bilirubin and correspondingly, both parasitemia and parasite burden were sustained, similar to Blvra−/− mice (Figures 6M–6P). This suggests that the accumulation of bilirubin above a ∼15–20 μM threshold is necessary for effective parasite clearance.
BVRA enzymatic activity regulates the host metabolic response to malaria
Comparison of host physiological parameters as a function of parasitemia and parasite burden revealed fundamentally distinct disease trajectories in BlvraWT vs. Blvra mutant mice (Figure 7). Body temperature trajectories revealed profound thermoregulatory defects in Blvra mutant mice (Figures 7A–7D). All genotypes displayed clockwise loop trajectories with stable body temperature (∼37°C) until a parasitemia/parasite burden threshold presenting a downward hypothermic inflection thereafter (Figures 7A–7D). While BlvraWT mice developed sub-lethal hypothermia of ∼33°C–35°C (Figures 7A and 7B), this was not the case for Blvra mutants, which developed irreversible downward trajectories culminating in life-threatening hypothermia (∼25°C–27°C) (Figures 7A–7D).
Figure 7.
Biliverdin reductase A oxidoreductase activity is essential to limit severe disease outcome
(A) Experimental schematic for body temperature analysis during infection.
(B) Body temperature over time following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(C) Correlation between body temperature and parasitemia for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(D) Correlation between body temperature and parasite burden levels for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(E) Experimental schematic for weight loss analysis during infection.
(F) Weight loss over time following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(G) Correlation between weight loss and parasitemia for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(H) Correlation between weight loss and parasite burden levels for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(I) Experimental schematic for glucose analysis during infection.
(J) Glucose levels over time following Pcc infection in BlvraWT, Blvra−/−, BlvraG17A, and BlvraE97A mice (n = 5 to 8 per genotype). Data are shown as mean ± SD.
(K) Correlation between glucose levels and parasitemia for each genotype. Direction of disease trajectory is shown by arrows in each curve.
(L) Correlation between glucose levels and parasite burden levels for each genotype. Direction of disease trajectory is shown by arrows in each curve. (A–L) Data pooled from n = 3 independent experiments. Statistical comparisons were performed using two-way ANOVA (B, F, and J). ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001.
Body weight trajectories showed differences between BlvraWT vs. Blvra mutant mice analogous to those observed for thermoregulation (Figures 7E–7H). BlvraWT mice restrained weight loss to ∼10%–15%, whereas BlvraG17A, BlvraE97A, and Blvra−/− mice underwent irreversible ∼20%–30% weight loss trajectories consistent with severe cachexia (Figures 7E–7H).
Glycemia trajectories confirmed major differences between BlvraWT mice vs. Blvra mutants (Figures 7I–7L). BlvraWT mice maintained stable glycemia (∼100–150 mg/dL) throughout infection, whereas Blvra mutants presented upwards glucose trajectories progressing toward severe hyperglycemia (∼400–600 mg/dL) after the peak of parasitemia and parasite burden (Figures 7I–7L). Notably, BlvraE97A mice exhibited the most pronounced hyperglycemic response, consistent with BVRA oxidoreductase activity controlling glycemia during malaria.
Discussion
Through the generation and characterization of mouse strains carrying hypomorphic Blvra mutations, we demonstrate that BVRA-mediated antimalarial protection correlates with unconjugated bilirubin levels. Both mutations result in reduced BVRA enzymatic activity alongside a reduction of circulating bilirubin levels upon Plasmodium infection, supporting that bilirubin production is central to BVRA’s antimalarial effect. However, we cannot exclude that these mutations also affect protein expression, and as such the relative contributions of BVRA oxidoreductase activity vs. non-canonical activities25,37,38,39,40,41,42 to antimalarial protection remain to be definitively established through mutations that selectively abolish catalytic activity while preserving protein expression.
Silencing the endogenous oxidoreductase activity of BVRA in macrophages did not compromise the induction of a number of NRF2-regulated genes in response to heme (Figures 4A–4D). We noticed however, that BVRA oxidoreductase activity was required to sustain NRF2 expression (Figures 4A–4D), presumably via a positive autoregulatory loop enforcing NRF2 expression.54 These observations suggest that the protective effect exerted by the oxidoreductase activity BVRA against malaria is not readily explained by a failure to induce the expression of key NRF2-regulated genes, such as Hmox1 and Fth, which exert a major impact on malaria severity.15,20,21 The impact of the oxidoreductase activity BVRA on the NRF2 positive feedback loop54 and how this could affect chronic outcome of malaria remains to be tested experimentally.
Silencing the endogenous oxidoreductase activity of BVRA also did not exert a major impact over INSR signaling in macrophages (Figures 4E–4G, and S2). This suggests that the oxidoreductase activity of BVRA does not interfere with the dual-specificity kinase domain of BVRA,25,39,43 involved in the regulation of INSR signaling.34,44 Importantly, regulation of glycemia does not appear to play a major role in the outcome of Pcc infection,61 further supporting the notion that the protective effect of BVRA against Pcc infection is not readily explained by a putative effect of its dual-specificity kinase domain over INSR signaling.
The observation that the BVRA G17A mutation compromises BVRA protein expression despite physiologic mRNA expression levels in BlvraG17A mice (Figures 2A and 2B), suggests that the glycine at position 17 within the NAD(P)H-binding domain confers conformational flexibility critical for cofactor binding and maintenance of proper protein folding. The BVRA E97A mutation severely impairs oxidoreductase activity while still allowing for protein expression (Figures 2C and 2D), suggesting that the NAD(P)H-binding domain supports cofactor recognition and structural integrity, whereas the reductase domain primarily governs bilirubin production.
The observation that BlvraE97A mice maintain physiological bilirubin levels at steady state (Figures 5A and 5B) is critical for mechanistic interpretation of the antimalarial effects of jaundice.27 It demonstrates that E97A mutation is an oxidoreductase hypomorph that allows circulating bilirubin to accumulate after birth, suggesting that the antimalarial effects of jaundice27 are not related to a putative pre-sensitization mechanism due to baseline bilirubin deficiency.
The dose-response relationship across the Blvra mutant lines enables interpolation of the minimum effective concentration of unconjugated bilirubin providing antimalarial protection (Figures 5A–5D). As BlvraE97A mice succumb to Pcc infection with kinetics nearly identical to BlvraG17A and Blvra−/− mice, this indicates that the protective threshold for unconjugated bilirubin lies between 20 and 30 μM. The convergence of a protective 20–40 μM range in mice and 8–50 μM range in asymptomatic humans,27 supports the idea of evolutionary conservation across host and Plasmodium species.
We note that the apparent high BVRA activity in the spleen (Figure 2), may reflect heme catabolism by erythrophagocytic macrophages,62 a cell compartment depleted during malaria.23 To what extent the contribution of BVRA expression in the spleen contributes to the overall antimalarial effect of bilirubin remains, however, to be established.
Mechanistically, bilirubin inhibits P. falciparum growth through a coordinated targeting of mitochondrial function, inhibition of hemozoin crystallization and disruption of the parasite food vacuole.27,63 Bilirubin disrupts the parasite’s mitochondrial dihydroorotate dehydrogenase (DHODH), a NADPH-dependent oxidoreductase that catalyzes the rate-limiting step in the de novo pyrimidine synthesis, therefore, repressing parasite proliferation.64 Moreover, bilirubin interferes with the parasite’s capacity to detoxify heme into hemozoin,27 similar to, but far less potently than quinoline- and artemisinin-based antimalarial drugs.65
The antiplasmodial effect of bilirubin probably explains why all Plasmodium spp. lack a heme oxygenase system and instead detoxify heme through hemozoin crystallization. This fundamental asymmetry provides bilirubin with selective antiparasitic activity.27
We have previously shown that Plasmodium parasites exhibit increased virulence when transferred from infected to naive Blvra-deficient mice, establishing that bilirubin reduces parasite virulence.27 Whether parasite virulence also increases when the concentration of bilirubin falls below the protective 20–30 μM threshold has not been directly established.
The disease trajectory of BlvraWT mice vs. Blvra mutants provides a mechanistic framework for understanding how BVRA oxidoreductase activity determines malaria outcomes. The superimposable trajectories of Blvra mutants across thermoregulation (Figures 7A–7D) and body weight (Figures 7E–7H) suggest that 20–30 μM bilirubin threshold operates through resistance rather than enhanced disease tolerance, consistent with bilirubin’s direct antiplasmodial activity.27
We have previously shown that bilirubin administration restores survival in Blvra-deficient mice,27 providing proof-of-concept for bilirubin-based therapeutics. Improved bilirubin formulations,66 such as pegylated bilirubin67 and hyaluronic acid coated bilirubin nanoparticles,68,69 could potentially achieve sustained therapeutic concentrations (20–30 μM), below those associated with kernicterus risk in neonates (>340–425 μM).
In conclusion, converging evidence from genetic, biochemical, and pharmacological approaches, unified by UnaG-based quantification methodology, establishes that unconjugated bilirubin concentrations of 20–30 μM represent the minimum threshold for antimalarial protection, providing a quantitative framework for therapeutic development and biomarker-guided treatment strategies.
Limitations of the study
Our study identifies that BVRA activity is essential to limit malaria severity in mice. However, we cannot exclude that these mutations also reduce BVRA protein expression alongside enzymatic activity, precluding definitive separation of effects attributable to oxidoreductase activity from protein expression. While our data demonstrate that bilirubin levels correlate with antimalarial protection, whether non-canonical activities of BVRA also contribute to this protective effect remains to be established. The definition of a bilirubin threshold limiting malaria severity was inferred from a well-established experimental model, which however, differs from the human disease. Therefore, the precise threshold for bilirubin protection during P. falciparum malaria requires further investigation.
Resource availability
Lead contact
Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Miguel P. Soares (miguel.soares@gimm.pt).
Materials availability
C57BL/6J BlvraG17A and C57BL/6J BlvraE97A mouse strains generated in this study are available from the lead contact with a completed materials transfer agreement.
Data and code availability
-
•
All data reported in this paper will be shared by the lead contact upon request.
-
•
This paper does not report original code.
-
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Acknowledgments
The authors are indebted to all members of the Inflammation Group (GIMM) for insightful technical and intellectual contributions, to the staff at the GIMM Flow Cytometry and Rodent Facilities.
This work was supported by GIMM-CARE (European Union grant no. 101060102. GIMM-CARE is co-funded by the Portuguese Government, the Foundation for Science and Technology (FCT), ARICA – Investimentos, Participações e Gestão, Jerónimo Martins, the Gulbenkian Institute for Molecular Medicine, and Lisbon Academic Medical Centre (CAML) (https://doi.org/10.3030/101060102), and by national funds through FCT under the Associate Laboratory Programme (LA/P/0082/2020) (https://doi.org/10.54499/LA/P/0082/2020), and R&D Unit Funding Programme (UID/06357/2025) (https://doi.org/10.54499/UID/06357/2025). We acknowledge individual support by: Fundação para a Ciência e a Tecnologia (UI/BD/152257/2021 to M.M., 2020.04797.BD, COVID/BD/153665/2024 to A.F.; FEDER/29411/2017 to S.R.; PTDC/MED-FSL/4681/2020 https://doi.org/10.54499/PTDC/MED-FSL/4681/2020 to S.P.; CEECIND/01589/2017 and https://doi.org/10.54499/2023.11177.PEX to A.R.C.; 2023.09168.CEECIND to E.J.; FEDER/29411/2017, PTDC/MED-FSL/4681/2020 https://doi.org/10.54499/PTDC/MED-FSL/4681/2020, 2022.02426.PTDC https://doi.org/10.54499/2022.02426.PTDC and Congento LISBOA-01-0145-FEDER-022170 to M.P.S. Gulbenkian Foundation (S.R., S.C., M.P.S., and IBB 2021-51/BI-D/2021 to S.T.). GIMM Foundation (GIMM/BI/36-2025 to M.M., GIMM/BI/37-2025 to S.T., GIMM Cross-Site collaborative project to M.P.S.). la Caixa Foundation HR18-00502 (E.J. and M.P.S.). American Heart Association/Paul Allen Frontiers Group (Project 19PABH134580006 to B.D.P.). DFG Cluster of Excellence “Balance of the Microverse” EXC 2051; 390713860 (E.J., M.P.S. as associated member). NIH/NIA (1R21AG073684–01, R01AG071512 to B.D.P.). The Johns Hopkins Catalyst Award (B.D.P.). Solve ME/CFS Initiative (grant 90089823 to B.D.P.). US Public Health Service (grant DA044123 to B.D.P). Oeiras-ERC Frontier Research Incentive Awards (M.P.S.). H2020-WIDESPREAD-2020-5-952537 SymbNET Research Grants (M.P.S.).
Author contributions
Conceptualization, M.P.S. and M.Mesquita; formal analysis, M.Mesquita, A.F., and R.M.; resources, B.D.P.; investigation, A.F., A.N., A.R.C., M.C., M.Mallo, M.Mesquita, R.M., S.T.R., S.R., S.P., S.C.; visualization, M.Mesquita. and M.P.S.; funding acquisition, M.P.S.; project administration, M.P.S.; supervision, M.P.S. and E.J.; writing—original draft, M.P.S.; writing—review and editing, M.Mesquita.
Declaration of interests
The authors declare no competing interests.
Declaration of generative AI and AI-assisted technologies in the writing process
During the preparation of this work the author(s) used Claude to edit the manuscript body of text. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the published article.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Polyclonal anti-Biliverdin Reductase A | ThermoFisher Scientific | Cat#PA5-92059; RRID: AB_2806368 |
| Rabbit monoclonal anti- beta-Actin | Cell Signaling Technology | Cat#4970; RRID: AB_2223172 |
| Rabbit monoclonal anti- IRS-1 | Cell Signaling Technology | Cat#3407; RRID: AB_2127860 |
| Rabbit polyclonal anti- Phospho-IRS-1 (Tyr612) | GeneTex | Cat#GTX24868; RRID: AB_380452 |
| Rabbit polyclonal anti- Phospho-IRS-1 (Ser307) | Cell Signaling Technology | Cat#2381; RRID: AB_330342 |
| Rabbit polyclonal anti- Vinculin | Cell Signaling Technology | Cat#4650; RRID: AB_10559207 |
| HRP conjugated goat anti-rabbit IgGH+L | Invitrogen | Cat# 31460; RRID: AB_228341 |
| Rabbit monoclonal anti-Nrf2 | Cell Signaling Technology | Cat#12721; RRID: AB_2715528 |
| Donkey Anti-Rabbit IgG H&L (Alexa Fluor® 568) | Abcam | Cat# ab175470; RRID: AB_2783823 |
| Phalloidin-conjugated Alexa Fluor 647 | ThermoFisher Scientific | Cat#A22287; RRID: AB_2620155 |
| Chemicals, peptides, and recombinant proteins | ||
| Standard, L10, 10 mM, Latex Particle | Beckman Coulter | Cat# 6602796 |
| RPMI 1640 w/Glutamax | ThermoFisher Scientific | Cat# 61870036 |
| Hemin | Frontier Scientific | Cat# H651-9 |
| Bilirubin | Frontier Scientific | Cat# B584-9 |
| TripleXtractor | Grisp | Cat# GB23 |
| Xpert cDNA Synthesis Supermix | Grisp | Cat# GK86.0100 |
| iTaq Universal SYBR Green Supermix | Bio-Rad | Cat# 1725124 |
| Paraformaldehyde | ThermoFisher Scientific | Cat# 043368.9M |
| cOmplete™, Mini, EDTA-free Protease Inhibitor CocktailL | Roche | Cat# 11836170001 |
| Bio-Rad Protein Assay Dye Reagent Concentrate | Bio-Rad | Cat# 5000006 |
| SuperSignal™ West Pico PLUS Chemiluminescent Substrate | ThermoFisher Scientific | Cat# 34580 |
| Insulin solution human | Merck | Cat# I9278 |
| MG-132 | Merck | Cat# 474790 |
| Experimental models: Organisms/strains | ||
| C57BL/6J | Jackson Laboratory | Cat#000664; RRID: IMSR_JAX:000664 |
| C57BL/6J Blvra−/− | Vasavda et al.30 | Provided by Dr. B. Paul |
| C57BL/6J BlvraG17A | This manuscript | N/A |
| C57BL/6J BlvraE97A | This manuscript | N/A |
| C57BL/6J Nrf2−/− | Jackson Laboratory70 | Cat#017009; RRID: IMSR_JAX:017009 |
| Plasmodium chabaudi chabaudi strain: PccAS-GFPML | N/A | Kind gift from Dr. J. Thompson71 |
| Oligonucleotides | ||
| Mouse gRNA BlvraG17A: GTGGTTGGTGTTGGCAGAGC | This manuscript | N/A |
| Mouse gRNA BlvraE97A: ATGCCATGGGGTATTCCACG | This manuscript | N/A |
| Mouse Rep. DNA BlvraG17A: CTCCATTG CATAGCTGGGCTGTTTTTAAA CCCCAC ATCGGTCTTTGATATTTCAGCCAAAGAG GAAATTTGGTGTGGTAGTGGTTGGTGT GGCACGGGCTGGCTCTGTGAGGATA AGGGACTTGAAGGATCCACACTCTTC AGCATTCCTAAACCTGATTGGATATGTGTC |
This manuscript | N/A |
| Mouse Rep. DNA BlvraE97A: TTTGA AGTGTCCTTTCCC TGTCTTTTTGT TTTCAAAGGCAGTTTCTTCAGGCTG GCAAGCATGTCCTCGTCGCCTATC CCATGGCATTGTCATTTGCGGCAGC GCAGGAGCTGTGGGAGCTGGC TGCACAGAAAGGTGATGTT |
This manuscript | N/A |
| Mouse Genotyping primer BlvraWT: Fwd TAGTGGTTGGTGTTGGCAGA; Rev: GGCTTTCCCTTACTCTGGGTC; | This manuscript | N/A |
| Mouse Genotyping primer BlvraG17A: TAGTGGTTGGTGTTGGCAGA; Rev: GGCTTTCCCTTACTCTGGGTC | This manuscript | N/A |
| Mouse Genotyping primer BlvraE97A Fwd: AGCATGTCCTCGTGGAATAC, Rev: TGGGAACTCAGTAGCAAAGCC | This manuscript | N/A |
| Mouse RT- qPCR primer Rplp0, Fwd: 5′-CTTTGGGCATCACCACGAA-3′, Rev: 5′-GCTGGCTCCCACCTTGTCT-3′ | Weis et al.72 | N/A |
| Mouse RT- qPCR primer Blvra, Fwd: 5′-AGCCGCTGGTAAGCTCC-3′, Rev: 5′-ACCAACCACTACCACACCAAA-3′ | Figueiredo27 | N/A |
| Mouse RT- qPCR primer Fth, Fwd: 5′- CCATCAACCGCCAGATCAAC-3′, Rev: 5′- GCCACATCATCTCGGTCAAA-3 | Figueiredo27 | N/A |
| Mouse RT- qPCR primer Hmox1, Fwd: 5′- TGACACCTGAGGTCAAGCAC-3′, Rev: 5′- TCTCTGCAGGGGCAGTATCT-3 | Ramos et al.20 | N/A |
| Mouse RT- qPCR primer Nqo1, Fwd: 5′- GGTAGCGGCTCCATGTACTC-3′, Rev: 5′- CGCAGGATGCCACTCTGAAT-3 | This manuscript | N/A |
| Mouse RT- qPCR primer Nrf2, Fwd: 5′- AGGACATGGAGCAAGTTTGG-3′, Rev: 5′- ATCAGCCAGCTGCTTGTTTT-3 | This manuscript | N/A |
| Mouse RT- qPCR primer Gclc, Fwd: 5′- ACATCTACCACGAGTCAAGGACC-3′, Rev: 5′- CTCAAGAACATCGCCTCCATTCAG-3 | This manuscript | N/A |
| Recombinant DNA | ||
| Plasmid: UnaG pMAL-6P2-6xHIS | Vasavda et al.30 | Kind gift from Dr. B. Paul |
| Software and algorithms | ||
| GraphPad Prism 8 GraphPad Softwa | GraphPad Software | https://www.graphpad.com; RRID: SCR_002798 |
| ImageJ | NIH | https://ImageJ.net/ij/; RRID: SCR_003070 |
| iBright Analysis Software | ThermoFisher Scientific | https://www.thermofisher.com; RRID: SCR_017632 |
| QuantStudio 7 Flex Real-Time PCR System Software | Applied Biosystems | https://www.thermofisher.com; RRID: SCR_020245 |
| SnapGene | Dotmatics | https://.snapgene.com;RRID:SCR_015052 |
| BD FACSDiva FACSDiva software v 8.0.3 | BD Biosciences | https://www.bdbiosciences.com; RRID: SCR_001456 |
| Cell Profiler | Broad Institute73 | https://cellprofiler.org;RRID:SCR_007358 |
| SpectroFlo | CytekBio | https://cytekbio.com; RRID: SCR_019826 |
| FlowJo | FlowJo | https://www.flowjo.com; RRID: SCR_008520 |
Experimental model and study participant details
Mice
Mice were bred and maintained under specific pathogen-free (SPF) conditions at the Gulbenkian Institute for Molecular Medicine (GIMM). Mice were housed at standard vivarium temperature (22°C) in a 12-h light/dark cycle with free access to water and standard chow pellets. All experimental protocols were approved in a two-step procedure, by the Animal Welfare Body of the IGC and by the Portuguese National Entity that regulates the use of laboratory animals in research (Direção Geral de Alimentação e Veterinária; DGAV). Experimental procedures followed the Portuguese (Decreto-Lei no 113/2013) and European (Directive 2010/63/EU) legislation. C57BL/6J mice were obtained from the GIMM animal facility. C57BL/6J Blvra−/− mice were generated at Ozgene (Australia), as described.30
C57BL/6J BlvraG17A and C57BL/6J BlvraE97A mouse strains were developed in collaboration with the GIMM’s transgenic unit. Briefly, they were generated by CRISPR/Cas9, using gRNAs targeting the GTGGTTGGTGTTGGCAGAGC or the ATGCCATGGGGTATTCCACG sequence respectively for the C57BL/6J BlvraG17A and the C57BL/6J BlvraE97A mice, and the replacement oligonucleotides CTCCATTGCATAGCTGG GCTGTTTTTAAACCCCACATCGGTCTTTGATATTTCAGCCAAAGAGGAA ATTTGGTGTGGTAGTGGTTGGTGTGGCACGGGCTGGCTCTGTGAGGATAAGGGACTTGAAGGATCCACACTCTTCAGCATTCCTAACCTGATTGGATATGTGTC or TTTGAAGTGTCCTTTCCCTGTCTTTTT GTTTTCAAAGGCAGTTTCTTCAGGCTGGCAAGCATGTCCTCGTCGCCTATCCCATGGCATTGTCATTTGCGGCAGCGCAGGAGCTGTGGGAGCTGGCTGCACAGAAAGGTGATGTT respectively for the C57BL/6J BlvraG17A and C57BL/6J BlvraE97A mice (all oligos purchased from Integrated DNA Technologies). This resulted in the replacement of glycine 17 for an alanine, in C57BL/6J BlvraG17A, and glutamate 97 for an alanine, in C57BL/6J BlvraE97A.
For better discrimination of BlvraWT vs. BlvraG17A strains during genotyping we replaced in the BlvraG17A strain, the 5′ GTT and 3′AGA codons, flanking the mutated GGC->GCA codon, by the synonymous 5′ GTG and 3′CGG codons, respectively. For better discrimination of BlvraWT vs. BlvraE97A strains during genotyping we replaced in the BlvraE97A strain, the 5′GTG and 3′TAC codons, flanking the mutated GAA->GCC codon, by the synonymous 5′GTC and 3′TAT codons, respectively.
Ribonucleoprotein complexes (1 μM gRNA, 100 ng/μL Cas9 protein) were mixed with the replacement oligo (30 ng/μL) and microinjected into the pronucleus of fertilized C57BL/6J mouse oocytes, which were transferred into the uterus of pseudo pregnant females, according to standard procedures. Genotyping was performed by PCR on genomic DNA using primers to amplify WT or mutant sequences. Sanger sequencing revealed 2 C57BL/6J BlvraG17A founders and C57BL/6J BlvraE97A 3 founders. These were bred with C57BL/6J mice to obtain heterozygous mice for the desired mutations. Offspring was genotyped using the following primer pairs: BlvraWT: Fwd TAGTGGTTGGTGTTGGCAGA; Rev: GGCTTTCCCTTACT CTGGGTC; BlvraG17A: TAGTGGTTGGTGTTGGCAGA; Rev: GGCTTTCCCTTACTCTGGGTC; BlvraE97A Fwd: AGCATGTCCTCGTGGAATAC, Rev: TGGGAACTCAGTAGCAAAGCC. The progeny of positive mutant lines and C57BL/6J mice was subsequently bred to homozygosity.
Method details
RNA extraction and RT-qPCR
Mice were sacrificed by CO2 inhalation at steady state, transcardially perfused in toto with ice-cold PBS (1X, 20 mL) and organs were harvested, snap frozen in liquid nitrogen and stored at −80°C. Total RNA was extracted using tripleXtractor reagent (GRISP), chlorophorm, isopropanol and ethanol, according to manufacturer’s instructions. cDNA was synthesized using the Xpert cDNA Synthesis Mastermix (GRiSP), followed by RT-qPCR using the iTaq Universal SYBR Green Supermix (Bio-Rad) on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Transcript values were calculated from the threshold cycle (Ct) of each gene using the 2−ΔCT method using using Acidic ribosomal phosphoprotein P0 (Rplp0) as the housekeeping control gene. Primers for qPCR include: Rplp0, Fwd: 5′-CTTTGGGCATCACCACGAA-3′, Rev: 5′-GCTGGCTCCCACCTTGTCT-3’; Blvra, Fwd: 5′-AGCCGCTGGTAAGCTCC-3′, Rev: 5′-ACCAACCACTACCACACCAAA-3′; Fth, Fwd: 5′- CCATCAACCGCCAGATCAAC-3′, Rev: 5′- GCCA CATCATCTCGGTCAAA-3; Hmox1, Fwd: 5′- TGACACCTGAGGTCAAGCAC-3′, Rev: 5′- TCTCTG CAGGGGCAGTATCT-3; Nqo1, Fwd: 5′- GGTAGCGGCTCCATGTACTC-3′, Rev: 5′- CGCAGGATG CCACTCTGAAT-3; Nrf2, Fwd: 5′- AGGACATGGAGCAAGTTTGG-3′, Rev: 5′-ATCAG CCAGCTGCTTGTTTT-3; Gclc, Fwd: 5′- ACATCTACCACGAGTCAAGGACC-3′, Rev: 5′-CTCAAGA ACATCGCCTCCATTCAG-3.
BVRA enzymatic activity assay
BVRA enzymatic activity was measured as described.74 Snap-frozen tissues were homogenized in homogenization buffer (10 mM Tris-HCl pH7.5, 250 mM sucrose) and the enzymatic activity was then measured in 50 μL of protein homogenate in assay buffer (100 mM Tris-base, 1 mM EDTA, pH 8.7, 1 mM NADPH, and 3 μM biliverdin), at 37°C in a spectrophotometer with shaking for 1h. The rate of reaction was determined by monitoring the change in absorbance at 450 nm over time. Bilirubin levels in the assay samples were determined using a standard curve of bilirubin IXα (0–300 μM) (Frontier Chemicals) and then normalized to cellular protein levels and presented as bilirubin concentration per μg of total protein. The activity assay was performed in a final volume of 600 μL.
BMDM generation and stimulation
Primary mouse BMDMs from wild-type (WT) and indicated mutant mice (Blvra−/−, BlvraG17A, BlvraE97A) were grown for 6 days in RPMI (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum (GIBCO), 10% L929 conditioned media and 1% penicillin and streptomycin.75,76 BMDMs were seeded at a density of 2 × 106 cells/well in 6 well plates, 1 × 106 cells/well in 12 well plates or 100 × 104 cells/well in 8-chamber slides (μ-slide, Ibidi) and allowed to adhere overnight. Cells were stimulated with 50 μM heme (Frontier Scientific) for 24h, 500 nM insulin (Merck) for 10 min or 10 μM MG-132 (Merck) for 6h and treated for downstream analysis. For microscopical assays, BMDM were fixed with 4% PFA and stained with DAPI (1 μg/mL) and phalloidin-Alexa Fluor 647 (0.2 μg/mL). Five random fields per well were acquired using a Zeiss LSM900 confocal microscope equipped with a Plan-Apochromat 20×/0.8 M27 or Plan-Apochromat 63x/1.4 Oil DIC M27 objectives Automatic image analysis was performed using the CellProfiler software,73 which was programmed to: a) split images into DAPI, Phalloidin-conjugated to Alexa Fluor 647 (AF647) and Alexa Fluor 568 (AF568) channels; b) load the channels into the pipeline and identify primary objects (nuclei; DAPI) using Global method with minimum cross-entropy thresholding, and shape method to distinguish clumped objects; c) identify secondary objects (whole cell area; Phalloidin-AF647) based on the primary objects (nuclei) identified before using the propagation method with 3-class Otsu adaptive thresholding; d) generate cytoplasm objects by masking detected nuclei from the whole cell area; e) extract fluorescence intensity of NRF2-AF568 in nuclei and cytoplasm. Primary and secondary objects touching the image borders are excluded from analysis. The level of cytoplasmic or nuclear translocation of NRF2 is expressed as the mean fluorescence intensity (MFI) of AF568, per captured microscopy field.
Western blot
Mice were sacrificed, transcardially perfused in toto with ice-cold PBS (1X, 20 mL) and organs were harvested and kept at −80°C until tissue lysates preparation. Tissues were lysed using 2% SDS-PAGE sample buffer (100 mM Tris, pH 6.8, 20% glycerol, 4% SDS, 0.2% bromophenol blue, 100 mM DTT and 1X protease inhibitor cocktail (cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail; Roche)) or NP40 extraction buffer (0.15M NaCl, 1% NP-40, 0.05M Tris, 1X protease inhibitor cocktail (cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail; Roche) and homogenized in a tissue lyser (Qiagen) with tungsten carbide beads (Qiagen). For the SDS-PAGE sample method, supernatants were collected and total protein was quantified at λ280nm using the DS-11 FX Spectrophotometer (DeNovix). For NP40 method, supernatant was collected and protein was quantified via Bradford assay (BioRad). Protein was resolved (50 μg) on a 12% SDS-PAGE and transferred to Polyvinylidene fluoride (PVDF) membranes. Membranes were blocked for 1 h at room temperature (5% bovine serum albumin in 1X TBS-T), washed in 1X TBS-T and incubated with primary antibodies, overnight at 4°C. The primary antibodies used were rabbit polyclonal anti-BVRA (Thermofisher scientific, PA5-92059; 1:750), rabbit monoclonal anti- IRS-1 (Cell Signaling Technology, 3407; 1:1000), rabbit polyclonal anti- Phospho-IRS-1 (Tyr612) (GeneTex, GTX24868, 1:1000), rabbit polyclonal anti- Phospho-IRS-1 (Ser307) (Cell Signaling Technology, 2381, 1:1000, rabbit polyclonal anti- Vinculin (Cell Signaling Technology, 4650, 1:1000) and rabbit polyclonal anti-β-actin (Cell Signaling Technology, 4967; 1:1000). Membranes were washed 3 times (1X TBS-T) and incubated (1 h; RT) with the peroxidase-conjugated secondary antibody (HRP conjugated goat anti-rabbit IgGH+L; Invitrogen, 31460; 1:5000). Membranes were washed 3 times (1X TBS-T) and peroxidase activity was detected using SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific). Blots were developed using Amersham Imager 680 (GE Healthcare), equipped with a Peltier cooled Fujifilm Super CCD or using an iBright FL1500 (ThermoFisher Scientific). Densitometry analysis was performed using ImageJ software, from images without saturated pixels.
Plasmodium chabaudi chabaudi AS infection and disease assessment
Mice (females and males, 10–16 weeks old) were infected with Plasmodium chabaudi chabaudi AS transgenic GFP-expressing Pcc AS (Pcc AS-GFPML).27 Infections were performed by intraperitoneal (i.p.) administration of freshly isolated blood (Passage 29; 2 × 106 infected RBC diluted in 200 μL PBS) collected from a previously infected C57BL/6J mouse. Mice were monitored daily from day 0 (day of infection) onwards for parasitemia (% infected RBC; iRBC), parasite burden (number of iRBC per μL of blood), body weight (Ohaus CS200 scaler, Sigma Aldrich), core (i.e., rectal) body temperature (Rodent thermometer; BIO-TK8851, Bioset), blood glucose concentration (AccuCHECK Performa glucometer, Roche) and survival, essentially as described.27 Briefly, the number of RBC per μL of blood was quantified by flow cytometry (LSR Fortessa X20 analyzer; BD Bioscience) using a standard concentration of reference latex beads (10 μm; Coulter CC Size Standard L10, Beckman Coulter, 6602796), gating on RBC, based on size and granularity and on bead population.
UnaG protein synthesis and purification
UnaG protein synthesis and purification was done as before.30 Briefly, UnaG was expressed in pMAL-6P2-6xHIS in BL21(DE3) cells.30 Starter cultures were grown to saturation in Luria Broth (LB) (overnight at 37°C), diluted 10-fold in LB and grown to an OD600 of 0.3 at 37°C, after which cultures were moved to 18°C. UnaG expression was induced at OD600 of 0.6, by the addition of 400 μM isopropyl β-D-1thiogalactopyranoside (16 h, 18°C). Cells were harvested by centrifugation (3,800 g, 4°C, 25 min), resuspended in 15 mL of resuspension buffer (50 mM HEPES, 300 mM NaCl, 0.5 mM TCEP, 10% glycerol, 1 mM PMSF, 2.34 μM leupeptin, 1.45 μM pepstatin at pH 7.4) per liter of culture. The sample was further lysed by sonication (QSonica Sonicator) with an amplitude of 5% in a pulse mode of 0.8s ON and 0.5s OFF for total 30 s. Lysate was clarified by centrifugation (26,000 g, 4°C, 30 min) and loaded onto an amylose column (MBPTrap HP Column, GE Healthcare). Protein was eluted with 20 mM maltose in protease buffer (50 mM Tris, 150 mM NaCl, 0.5 mM TCEP, 10% glycerol, 0.01% Triton X-100 at pH 7.4). MBP was removed by the addition (16 h, 4°C) of PreScission Protease (GE Healthcare). UnaG was purified via a nickel column (HisTrap HP Column, GE Healthcare) to remove the cleaved tag and eluted with (30 mM Tris, 1M NaCl, 0.5 mM TCEP, 10% glycerol, 500 mM imidazole, pH 7.4). UnaG was further purified on a gel-filtration column (S-200, GE Healthcare) in gel filtration buffer (50 mM HEPES, 300 mM NaCl, 0.5 mM TCEP, 10% glycerol at pH 7.4), concentrated using 10 kDa amicon ultracentrifugal filter (Merck), and flash frozen in gel filtration buffer at 30% glycerol for storage at −80°C.
UnaG-based assay for quantification of unconjugated bilirubin
Blood from BlvraWT, Blvra−/−, BlvraG17A and BlvraE97A mice was obtained from the tail vein, before (Day 0) and during Pcc infection. Samples were collected and immediately centrifuged (1000 g, 15 min) and plasma was collected, frozen in liquid nitrogen and stored at −80°C until used for bilirubin quantification. Total plasma unconjugated bilirubin was determined using UnaG.77 Plasma samples from mice noninfected or infected with Pcc was diluted 1:100 in PBS. Then, 100 pM of UnaG was added to the diluted plasma sample and incubated for 10 min at RT. After incubation, fluorescence intensity was measured at excitation λ480 nm and emission λ530 nm using a microplate reader (Promega GloMax). Bilirubin IXα (Frontier Chemicals) was used as standard.
Quantification and statistical analysis
All statistical analyses were performed using GraphPad Prism 10 software. Statistically significant differences between more than two groups were assessed using two-way ANOVA with Tukey’s multiple comparison test or two-way ANOVA with Linear Mixed Effects Model. Survival curves are represented by Kaplan-Meier plots and differences assessed using the log rank test. One-way ANOVA with Tukey’s post hoc test was used for comparisons of protein expression, mRNA expression, bilirubin levels and enzymatic activity. two-way ANOVA with Sidak’s post hoc test was used for NRF2 immunofluorescence and insulin signaling experiments. Differences were considered statistically significant at a p value < 0.05. NS: not-significant, p > 0.05; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001. The exact value of n and what n represents is stated in the corresponding figure legends. Data are presented as mean ± SD. All animal experiments were performed using male and female mice and no sex-dependency was observed.
Published: April 30, 2026
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2026.115958.
Supplemental information
References
- 1.Weiss D.J., Dzianach P.A., Saddler A., Lubinda J., Browne A., McPhail M., Rumisha S.F., Sanna F., Gelaw Y., Kiss J.B., et al. Mapping the global prevalence, incidence, and mortality of Plasmodium falciparum and Plasmodium vivax malaria, 2000–22: a spatial and temporal modelling study. Lancet. 2025;405:979–990. doi: 10.1016/s0140-6736(25)00038-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Duffy P.E., Gorres J.P., Healy S.A., Fried M. Malaria vaccines: a new era of prevention and control. Nat. Rev. Microbiol. 2024;22:756–772. doi: 10.1038/s41579-024-01065-7. [DOI] [PubMed] [Google Scholar]
- 3.Eastman R.T., Fidock D.A. Artemisinin-based combination therapies: a vital tool in efforts to eliminate malaria. Nat. Rev. Microbiol. 2009;7:864–874. doi: 10.1038/nrmicro2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Okombo J., Fidock D.A. Towards next-generation treatment options to combat Plasmodium falciparum malaria. Nat. Rev. Microbiol. 2025;23:178–191. doi: 10.1038/s41579-024-01099-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sigala P.A., Goldberg D.E. The peculiarities and paradoxes of Plasmodium heme metabolism. Annu. Rev. Microbiol. 2014;68:259–278. doi: 10.1146/annurev-micro-091313-103537. [DOI] [PubMed] [Google Scholar]
- 6.Ferreira A., Balla J., Jeney V., Balla G., Soares M.P. A central role for free heme in the pathogenesis of severe malaria: the missing link? J Mol Med. 2008;86:1097–1111. doi: 10.1007/s00109-008-0368-5. http://www.springerlink.com/content/r2g1r01848677445/ [DOI] [PubMed] [Google Scholar]
- 7.Gouveia Z., Carlos A.R., Yuan X., Aires-da-Silva F., Stocker R., Maghzal G.J., Leal S.S., Gomes C.M., Todorovic S., Iranzo O., et al. Characterization of plasma labile heme in hemolytic conditions. FEBS J. 2017;284:3278–3301. doi: 10.1111/febs.14192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Sundaram B., Pandian N., Kim H.J., Abdelaal H.M., Mall R., Indari O., Sarkar R., Tweedell R.E., Alonzo E.Q., Klein J., et al. NLRC5 senses NAD(+) depletion, forming a PANoptosome and driving PANoptosis and inflammation. Cell. 2024;187:4061–4077.e4017. doi: 10.1016/j.cell.2024.05.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Sundaram B., Pandian N., Mall R., Wang Y., Sarkar R., Kim H.J., Malireddi R.K.S., Karki R., Janke L.J., Vogel P., Kanneganti T.D. NLRP12-PANoptosome activates PANoptosis and pathology in response to heme and PAMPs. Cell. 2023;186:2783–2801.e2720. doi: 10.1016/j.cell.2023.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Larsen R., Gozzelino R., Jeney V., Tokaji L., Bozza F.A., Japiassu A.M., Bonaparte D., Cavalcante M.M., Chora A., Ferreira A., et al. A central role for free heme in the pathogenesis of severe sepsis. Sci. Transl. Med. 2010;2 doi: 10.1126/scitranslmed.3001118. [DOI] [PubMed] [Google Scholar]
- 11.Gozzelino R., Jeney V., Soares M.P. Mechanisms of cell protection by heme oxygenase-1. Annu. Rev. Pharmacol. Toxicol. 2010;50:323–354. doi: 10.1146/annurev.pharmtox.010909.105600. [DOI] [PubMed] [Google Scholar]
- 12.Gozzelino R., Andrade B.B., Larsen R., Luz N.F., Vanoaica L., Seixas E., Coutinho A., Cardoso S., Rebelo S., Poli M., et al. Metabolic adaptation to tissue iron overload confers tolerance to malaria. Cell Host Microbe. 2012;12:693–704. doi: 10.1016/j.chom.2012.10.011. [DOI] [PubMed] [Google Scholar]
- 13.Ramos S., Jeney V., Figueiredo A., Paixão T., Sambo M.R., Quinhentos V., Martins R., Gouveia Z., Carlos A.R., Ferreira A., et al. Targeting circulating labile heme as a defense strategy against malaria. Life Sci. Alliance. 2024;7 doi: 10.26508/lsa.202302276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pamplona A., Ferreira A., Balla J., Jeney V., Balla G., Epiphanio S., Chora A., Rodrigues C.D., Gregoire I.P., Cunha-Rodrigues M., et al. Heme oxygenase-1 and carbon monoxide suppress the pathogenesis of experimental cerebral malaria. Nat Med. 2007;13:703–710. doi: 10.1038/nm1586. [DOI] [PubMed] [Google Scholar]
- 15.Ferreira A., Marguti I., Bechmann I., Jeney V., Chora A., Palha N.R., Rebelo S., Henri A., Beuzard Y., Soares M.P. Sickle Hemoglobin Confers Tolerance to Plasmodium Infection. Cell. 2011;145:398–409. doi: 10.1016/j.cell.2011.03.049. [DOI] [PubMed] [Google Scholar]
- 16.Pais T.F., Ali H., Moreira da Silva J., Duarte N., Neres R., Chhatbar C., Acurcio R.C., Guedes R.C., Strano Moraes M.C., Costa-Silva B., et al. Brain endothelial STING1 activation by Plasmodium-sequestered heme promotes cerebral malaria via type I IFN response. Proc. Natl. Acad. Sci. USA. 2022;119 doi: 10.1073/pnas.2206327119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Soares M.P., Bozza M.T. Red alert: labile heme is an alarmin. Curr. Opin. Immunol. 2016;38:94–100. doi: 10.1016/j.coi.2015.11.006. [DOI] [PubMed] [Google Scholar]
- 18.Knackstedt S.L., Georgiadou A., Apel F., Abu-Abed U., Moxon C.A., Cunnington A.J., Raupach B., Cunningham D., Langhorne J., Krüger R., et al. Neutrophil extracellular traps drive inflammatory pathogenesis in malaria. Sci. Immunol. 2019;4 doi: 10.1126/sciimmunol.aaw0336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Seixas E., Gozzelino R., Chora A., Ferreira A., Silva G., Larsen R., Rebelo S., Penido C., Smith N.R., Coutinho A., Soares M.P. Heme oxygenase-1 affords protection against noncerebral forms of severe malaria. Proc. Natl. Acad. Sci. USA. 2009;106:15837–15842. doi: 10.1073/pnas.0903419106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ramos S., Carlos A.R., Sundaram B., Jeney V., Ribeiro A., Gozzelino R., Bank C., Gjini E., Braza F., Martins R., et al. Renal control of disease tolerance to malaria. Proc. Natl. Acad. Sci. USA. 2019;116:5681–5686. doi: 10.1073/pnas.1822024116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jeney V., Ramos S., Bergman M.L., Bechmann I., Tischer J., Ferreira A., Oliveira-Marques V., Janse C.J., Rebelo S., Cardoso S., Soares M.P. Control of disease tolerance to malaria by nitric oxide and carbon monoxide. Cell Rep. 2014;8:126–136. doi: 10.1016/j.celrep.2014.05.054. [DOI] [PubMed] [Google Scholar]
- 22.Tenhunen R., Marver H.S., Schmid R. The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc. Natl. Acad. Sci. USA. 1968;61:748. doi: 10.1073/pnas.61.2.748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wu Q., Sacomboio E., Valente de Souza L., Martins R., Kitoko J., Cardoso S., Ademolue T.W., Paixao T., Lehtimaki J., Figueiredo A., et al. Renal control of life-threatening malarial anemia. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112057. [DOI] [PubMed] [Google Scholar]
- 24.Kutty R.K., Maines M.D. Purification and characterization of biliverdin reductase from rat liver. J. Biol. Chem. 1981;256:3956–3962. [PubMed] [Google Scholar]
- 25.Kapitulnik J., Maines M.D. Pleiotropic functions of biliverdin reductase: cellular signaling and generation of cytoprotective and cytotoxic bilirubin. Trends Pharmacol. Sci. 2009;30:129–137. doi: 10.1016/j.tips.2008.12.003. [DOI] [PubMed] [Google Scholar]
- 26.Maines M.D., Trakshel G.M. Purification and characterization of human biliverdin reductase. Arch. Biochem. Biophys. 1993;300:320–326. doi: 10.1006/abbi.1993.1044. [DOI] [PubMed] [Google Scholar]
- 27.Figueiredo A., Rastogi S.T., Ramos S., Nogueira F., De Villiers K., de Sousa A.G.G., Votborg-Novél L., von Wedel C., Tober-Lau P., Jentho E., et al. A metabolite-based resistance mechanism against malaria. Science. 2025;388 doi: 10.1126/science.adq6741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Baranano D.E., Rao M., Ferris C.D., Snyder S.H. Biliverdin reductase: a major physiologic cytoprotectant. Proc. Natl. Acad. Sci. USA. 2002;99:16093–16098. doi: 10.1073/pnas.252626999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Maghzal G.J., Leck M.C., Collinson E., Li C., Stocker R. Limited role for the bilirubin-biliverdin redox amplification cycle in the cellular antioxidant protection by biliverdin reductase. J. Biol. Chem. 2009;284:29251–29259. doi: 10.1074/jbc.M109.037119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Vasavda C., Kothari R., Malla A.P., Tokhunts R., Lin A., Ji M., Ricco C., Xu R., Saavedra H.G., Sbodio J.I., et al. Bilirubin Links Heme Metabolism to Neuroprotection by Scavenging Superoxide. Cell Chem. Biol. 2019;26:1450–1460.e1457. doi: 10.1016/j.chembiol.2019.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Paul B.D., Pieper A.A. Neuroprotective Roles of the Biliverdin Reductase-A/Bilirubin Axis in the Brain. Biomolecules. 2024;14:155. doi: 10.3390/biom14020155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Stocker R., Yamamoto Y., McDonagh A.F., Glazer A.N., Ames B.N. Bilirubin is an antioxidant of possible physiological importance. Science. 1987;235:1043–1046. doi: 10.1126/science.3029864. [DOI] [PubMed] [Google Scholar]
- 33.Yamashita K., McDaid J., Ollinger R., Tsui T.Y., Berberat P.O., Usheva A., Csizmadia E., Smith R.N., Soares M.P., Bach F.H. Biliverdin, a natural product of heme catabolism, induces tolerance to cardiac allografts. FASEB J. 2004;18:765–767. doi: 10.1096/fj.03-0839fje. [DOI] [PubMed] [Google Scholar]
- 34.Tramutola A., Di Domenico F., Perluigi M., Barone E. Biliverdin reductase-A is a key modulator in insulin signaling and metabolism. Trends Endocrinol. Metab. 2026;37:466–479. doi: 10.1016/j.tem.2025.08.007. S1043-2760(25)00176-6. [DOI] [PubMed] [Google Scholar]
- 35.Stec D.E., John K., Trabbic C.J., Luniwal A., Hankins M.W., Baum J., Hinds T.D., Jr. Bilirubin Binding to PPARalpha Inhibits Lipid Accumulation. PLoS One. 2016;11 doi: 10.1371/journal.pone.0153427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Vitek L., Hinds T.D., Jr., Stec D.E., Tiribelli C. The physiology of bilirubin: health and disease equilibrium. Trends Mol. Med. 2023;29:315–328. doi: 10.1016/j.molmed.2023.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Maines M.D. Biliverdin reductase: PKC interaction at the cross-talk of MAPK and PI3K signaling pathways. Antioxid Redox Signal. 2007;9:2187–2195. doi: 10.1089/ars.2007.1805. [DOI] [PubMed] [Google Scholar]
- 38.Maines M.D. New insights into biliverdin reductase functions: linking heme metabolism to cell signaling. Physiology. 2005;20:382–389. doi: 10.1152/physiol.00029.2005. [DOI] [PubMed] [Google Scholar]
- 39.Ahmad Z., Salim M., Maines M.D. Human biliverdin reductase is a leucine zipper-like DNA-binding protein and functions in transcriptional activation of heme oxygenase-1 by oxidative stress. J. Biol. Chem. 2002;277:9226–9232. doi: 10.1074/jbc.M108239200. [DOI] [PubMed] [Google Scholar]
- 40.O'Brien L., Hosick P.A., John K., Stec D.E., Hinds T.D., Jr. Biliverdin reductase isozymes in metabolism. Trends Endocrinol. Metab. 2015;26:212–220. doi: 10.1016/j.tem.2015.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wegiel B., Otterbein L.E. Go green: the anti-inflammatory effects of biliverdin reductase. Front. Pharmacol. 2012;3:47. doi: 10.3389/fphar.2012.00047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Vasavda C., Semenza E.R., Liew J., Kothari R., Dhindsa R.S., Shanmukha S., Lin A., Tokhunts R., Ricco C., Snowman A.M., et al. Biliverdin reductase bridges focal adhesion kinase to Src to modulate synaptic signaling. Sci. Signal. 2022;15 doi: 10.1126/scisignal.abh3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Lerner-Marmarosh N., Shen J., Torno M.D., Kravets A., Hu Z., Maines M.D. Human biliverdin reductase: a member of the insulin receptor substrate family with serine/threonine/tyrosine kinase activity. Proc. Natl. Acad. Sci. USA. 2005;102:7109–7114. doi: 10.1073/pnas.0502173102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Lanzillotta C., Tramutola A., Lanzillotta S., Greco V., Pagnotta S., Sanchini C., Di Angelantonio S., Forte E., Rinaldo S., Paone A., et al. Biliverdin Reductase-A integrates insulin signaling with mitochondrial metabolism through phosphorylation of GSK3beta. Redox Biol. 2024;73 doi: 10.1016/j.redox.2024.103221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Kravets A., Hu Z., Miralem T., Torno M.D., Maines M.D. Biliverdin reductase, a novel regulator for induction of activating transcription factor-2 and heme oxygenase-1. J. Biol. Chem. 2004;279:19916–19923. doi: 10.1074/jbc.M314251200. [DOI] [PubMed] [Google Scholar]
- 46.Vasavda C., Kothari R., Kaidery N.A., Chakraborty S., Tripathi S.J., Dhindsa R.S., Ricco C., Shanmukha S., Saberi S., Lefler J.E., et al. Biliverdin reductase A is a major determinant of protective NRF2 signaling. Proc. Natl. Acad. Sci. 2025;122 doi: 10.1073/pnas.2513120122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Bosma P.J., Seppen J., Goldhoorn B., Bakker C., Oude Elferink R.P., Chowdhury J.R., Chowdhury N.R., Jansen P.L. Bilirubin UDP-glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J. Biol. Chem. 1994;269:17960–17964. doi: 10.1016/S0021-9258(17)32403-1. [DOI] [PubMed] [Google Scholar]
- 48.Levitt D.G., Levitt M.D. Quantitative assessment of the multiple processes responsible for bilirubin homeostasis in health and disease. Clin. Exp. Gastroenterol. 2014;7:307–328. doi: 10.2147/CEG.S64283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Herta T., Beuers U. A historical review of jaundice: May the golden oriole live forever. Clin. Liver Dis. 2022;20:45–56. doi: 10.1002/cld.1267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Lerner-Marmarosh N., Miralem T., Gibbs P.E., Maines M.D. Regulation of TNF-alpha-activated PKC-zeta signaling by the human biliverdin reductase: identification of activating and inhibitory domains of the reductase. FASEB J. 2007;21:3949–3962. doi: 10.1096/fj.07-8544com. [DOI] [PubMed] [Google Scholar]
- 51.Martins R., Maier J., Gorki A.D., Huber K.V., Sharif O., Starkl P., Saluzzo S., Quattrone F., Gawish R., Lakovits K., et al. Heme drives hemolysis-induced susceptibility to infection via disruption of phagocyte functions. Nat. Immunol. 2016;17:1361–1372. doi: 10.1038/ni.3590. [DOI] [PubMed] [Google Scholar]
- 52.Jentho E., Ruiz-Moreno C., Novakovic B., Kourtzelis I., Megchelenbrink W.L., Martins R., Chavakis T., Soares M.P., Kalafati L., Guerra J., et al. Trained innate immunity, long-lasting epigenetic modulation, and skewed myelopoiesis by heme. Proc. Natl. Acad. Sci. USA. 2021;118 doi: 10.1073/pnas.2102698118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Alam J., Stewart D., Touchard C., Boinapally S., Choi A.M., Cook J.L. Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J. Biol. Chem. 1999;274:26071–26078. doi: 10.1074/jbc.274.37.26071. [DOI] [PubMed] [Google Scholar]
- 54.Kwak M.K., Itoh K., Yamamoto M., Kensler T.W. Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2 promoter. Mol. Cell Biol. 2002;22:2883–2892. doi: 10.1128/mcb.22.9.2883-2892.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Andreozzi F., Laratta E., Sciacqua A., Perticone F., Sesti G. Angiotensin II Impairs the Insulin Signaling Pathway Promoting Production of Nitric Oxide by Inducing Phosphorylation of Insulin Receptor Substrate-1 on Ser312 and Ser616 in Human Umbilical Vein Endothelial Cells. Circ. Res. 2004;94:1211–1218. doi: 10.1161/01.RES.0000126501.34994.96. [DOI] [PubMed] [Google Scholar]
- 56.Aguirre V., Werner E.D., Giraud J., Lee Y.H., Shoelson S.E., White M.F. Phosphorylation of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J. Biol. Chem. 2002;277:1531–1537. doi: 10.1074/jbc.M101521200. [DOI] [PubMed] [Google Scholar]
- 57.Stephens R., Culleton R.L., Lamb T.J. The contribution of Plasmodium chabaudi to our understanding of malaria. Trends Parasitol. 2012;28:73–82. doi: 10.1016/j.pt.2011.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kumagai A., Ando R., Miyatake H., Greimel P., Kobayashi T., Hirabayashi Y., Shimogori T., Miyawaki A. A bilirubin-inducible fluorescent protein from eel muscle. Cell. 2013;153:1602–1611. doi: 10.1016/j.cell.2013.05.038. [DOI] [PubMed] [Google Scholar]
- 59.Cumnock K., Gupta A.S., Lissner M., Chevee V., Davis N.M., Schneider D.S. Host Energy Source Is Important for Disease Tolerance to Malaria. Curr. Biol. 2018;28:1635–1642.e1633. doi: 10.1016/j.cub.2018.04.009. [DOI] [PubMed] [Google Scholar]
- 60.Schneider D.S. Tracing personalized health curves during infections. PLoS Biol. 2011;9 doi: 10.1371/journal.pbio.1001158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Ramos S., Ademolue T.W., Jentho E., Wu Q., Guerra J., Martins R., Pires G., Weis S., Carlos A.R., Mahú I., et al. A hypometabolic defense strategy against malaria. Cell Metab. 2022;34:1183–1200.e12. doi: 10.1016/j.cmet.2022.06.011. [DOI] [PubMed] [Google Scholar]
- 62.Soares M.P., Hamza I. Macrophages and Iron Metabolism. Immunity. 2016;44:492–504. doi: 10.1016/j.immuni.2016.02.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Kumar S., Guha M., Choubey V., Maity P., Srivastava K., Puri S.K., Bandyopadhyay U. Bilirubin inhibits Plasmodium falciparum growth through the generation of reactive oxygen species. Free Radic. Biol. Med. 2008;44:602–613. doi: 10.1016/j.freeradbiomed.2007.10.057. [DOI] [PubMed] [Google Scholar]
- 64.Painter H.J., Morrisey J.M., Mather M.W., Vaidya A.B. Specific role of mitochondrial electron transport in blood-stage Plasmodium falciparum. Nature. 2007;446:88–91. doi: 10.1038/nature05572. [DOI] [PubMed] [Google Scholar]
- 65.Villiers K.A.d., Egan T.J. Heme Detoxification in the Malaria Parasite: A Target for Antimalarial Drug Development. Acc. Chem. Res. 2021;54:2649–2659. doi: 10.1021/acs.accounts.1c00154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Cui Y., Wu C., Li L., shi H., Li C., Yin S. Toward nanotechnology-enabled application of bilirubin in the treatment and diagnosis of various civilization diseases. Mater. Today Bio. 2023;20 doi: 10.1016/j.mtbio.2023.100658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Lee Y., Kim H., Kang S., Lee J., Park J., Jon S. Bilirubin Nanoparticles as a Nanomedicine for Anti-inflammation Therapy. Angew. Chem. Int. Ed. 2016;55:7460–7463. doi: 10.1002/anie.201602525. [DOI] [PubMed] [Google Scholar]
- 68.Lee Y., Sugihara K., Gillilland M.G., Jon S., Kamada N., Moon J.J. Hyaluronic acid–bilirubin nanomedicine for targeted modulation of dysregulated intestinal barrier, microbiome and immune responses in colitis. Nat. Mater. 2020;19:118–126. doi: 10.1038/s41563-019-0462-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Tatikolov A.S., Pronkin P.G., Panova I.G. Bilirubin nanotechnology: An innovative approach in biomedicine. Biophys. Chem. 2025;320–321 doi: 10.1016/j.bpc.2025.107412. [DOI] [PubMed] [Google Scholar]
- 70.Chan K., Lu R., Chang J.C., Kan Y.W. NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc. Natl. Acad. Sci. USA. 1996;93:13943–13948. doi: 10.1073/pnas.93.24.13943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Marr E., Milne R., Anar B., Girling G., Schwach F., Mooney J., Nahrendorf W., Spence P., Cunningham D., Baker D., et al. An enhanced toolkit for the generation of knockout and marker-free fluorescent Plasmodium chabaudi. Wellcome Open Res. 2020;5:71. doi: 10.12688/wellcomeopenres.15587.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Weis S., Carlos A.R., Moita M.R., Singh S., Blankenhaus B., Cardoso S., Larsen R., Rebelo S., Schäuble S., Del Barrio L., et al. Metabolic adaptation establishes disease tolerance to sepsis. Cell. 2017;169:1263–1275. doi: 10.1016/j.cell.2017.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Carpenter A.E., Jones T.R., Lamprecht M.R., Clarke C., Kang I.H., Friman O., Guertin D.A., Chang J.H., Lindquist R.A., Moffat J., et al. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol. 2006;7 doi: 10.1186/gb-2006-7-10-r100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Huang T.-J. Detection of Biliverdin Reductase Activity. Curr. Protoc. Toxicol. 1999;Chapter 9 doi: 10.1002/0471140856.tx0904s00. [DOI] [PubMed] [Google Scholar]
- 75.Toda G., Yamauchi T., Kadowaki T., Ueki K. Preparation and culture of bone marrow-derived macrophages from mice for functional analysis. STAR Protoc. 2021;2 doi: 10.1016/j.xpro.2020.100246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Martins R., Blankehaus B., Braza F., Mesquita M., Ventura P., Singh S., Weis S., Pires M., Pagnotta S., Wu Q., et al. Homeostatic control of energy metabolism by monocyte-derived macrophages. EMBO J. 2025;45:106–150. doi: 10.1038/s44318-025-00622-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Iwatani S., Nakamura H., Kurokawa D., Yamana K., Nishida K., Fukushima S., Koda T., Nishimura N., Nishio H., Iijima K., et al. Fluorescent protein-based detection of unconjugated bilirubin in newborn serum. Sci. Rep. 2016;6 doi: 10.1038/srep28489. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
-
•
All data reported in this paper will be shared by the lead contact upon request.
-
•
This paper does not report original code.
-
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.







