ABL kinase inactivation induces transcription-replication conflicts and impairs replication fork progression in metastatic small cell lung cancer

Jing Jin Gu; Kevin M Scott; Arijit Ghosh; Roberto H Barbier; Douglas C Rouse; Jacob P Hoj; Michael W Caminear; Fengqi Zhang; Boya Gao; Margaret W Barbier; Lee Zou; Li Lan; Ann Marie Pendergast

doi:10.1016/j.celrep.2026.117699

. Author manuscript; available in PMC: 2026 Aug 18.

Published in final edited form as: Cell Rep. 2026 Jul 15;45(7):117699. doi: 10.1016/j.celrep.2026.117699

ABL kinase inactivation induces transcription-replication conflicts and impairs replication fork progression in metastatic small cell lung cancer

Jing Jin Gu ¹, Kevin M Scott ¹, Arijit Ghosh ², Roberto H Barbier ¹, Douglas C Rouse ³, Jacob P Hoj ¹, Michael W Caminear ¹, Fengqi Zhang ², Boya Gao ², Margaret W Barbier ¹, Lee Zou ¹, Li Lan ², Ann Marie Pendergast ^1,^4,^5,^*

PMCID: PMC13479708 NIHMSID: NIHMS2199975 PMID: 42461725

SUMMARY

Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine cancer that is typically metastatic upon diagnosis and has poor overall survival. Here we report that the inactivation of ABL tyrosine kinases impairs the outgrowth of metastatic SCLC tumors, resulting in prolonged animal survival. ABL inactivation increases the accumulation of transcription-replication conflicts (TRCs), compromises replication fork progression, and impairs the function of proteins implicated in transcription-coupled homologous recombination, including RAD51 and RAD52. Mechanistically, ABL-mediated tyrosine phosphorylation of RAD52 and RAD51 prevents the accumulation of TRCs and promotes replication fork progression, respectively. Because ABL inactivation increased DNA damage, we evaluated whether blocking the activity of DNA damage-repair pathways in the presence of ABL inhibitors might synergize to promote SCLC cell death. Concurrent inactivation of ABL and ATR, the primary responder to replication stress, synergistically inhibits SCLC cell growth in vitro and impairs metastatic outgrowth over single-agent-treated mice. Thus, co-inactivation of ABL and DNA damage-repair pathways might be exploited to inhibit outgrowth of SCLC metastases.

In brief

Maintenance of genomic stability requires coordinated spatial and temporal regulation of the replication and transcription machineries. Gu et al. report that ABL inactivation in SCLC promotes the accumulation of TRCs, compromises replication forks, and increases DNA damage. Combined inhibition of ABL and ATR might be exploited to inhibit metastatic SCLC outgrowth.

Graphical Abstract

graphic file with name nihms-2199975-f0001.jpg

INTRODUCTION

Small cell lung cancer (SCLC) is a highly metastatic neuroendocrine lung cancer.¹ The overall 5-year survival rate for patients with SCLC is only ~7% and has remained unchanged for over 30 years. A notable feature of SCLC is its high metastatic capacity, with ~70% of patients with SCLC harboring distant metastases at diagnosis, but the mechanisms that underlie the exceptional metastatic activity of SCLC tumors are poorly understood.² SCLC is characterized by loss or inactivation of the TP53 and RB1 tumor suppressor genes, with some SCLC tumors over-expressing MYC family proteins. Despite initial sensitivity to first-line platinum and etoposide chemotherapy or radiotherapy, most patients with SCLC relapse and succumb to systemic metastases.³ SCLC can be classified into several molecular subtypes defined by the differential expression of transcription factors ASCL1, NEUROD1, POUF2F3, and YAP1.^4,5 Recently, an inflamed (I), mesenchymal SCLC subtype (SCLC-I) that is responsive to immunotherapy was identified.^4,6,7 SCLC tumors are characterized by intra-tumor heterogeneity and tumor cell plasticity, and phenotypic switching among SCLC subtypes may underlie, in part, therapeutic resistance.⁵ However, progress in the characterization of the SCLC genetic landscape has not yet resulted in effective targeted therapies for this aggressive cancer. Therefore, there is an urgent need to define the molecular mechanisms that promote SCLC to identify effective strategies to treat this deadly cancer.

SCLC cells exhibit a high degree of genomic instability and replication stress, which renders these cells vulnerable to inhibition by drugs targeting components of the replication-coupled DNA repair pathway.⁸ Maintenance of genomic stability requires coordinated spatial and temporal regulation of the replication and transcription machineries on DNA. Deregulated transcription in cancer cells can result in aberrant accumulation of R-loops.⁹ Unresolved R-loops are a source of transcription-replication conflicts (TRCs) through increased collisions with replication forks, which in turn generate replication stress and DNA DSBs.^9–11 R-loops can be transiently induced by DSBs during transcription-coupled homologous recombination (TC-HR). TC-HR promotes repair of DSBs at sites of active transcription. When TC-HR is compromised, damage-induced R-loops become persistent, which may increase TRCs. Defining the molecular mechanisms that regulate the crosstalk of the transcription and replication machineries in cancer cells is needed to identify potential therapeutic targets amenable to pharmacological inhibition by targeting signaling networks required for the resolution of R-loops, replication fork progression, and prevention or resolution of TRCs.

Here we report that the inactivation of the ABL tyrosine kinases markedly impairs outgrowth of metastatic SCLC tumors in mice and prolongs animal survival. The ABL kinases, ABL1 and ABL2, link diverse intracellular and extracellular stimuli to signaling pathways that promote metastatic progression of solid tumors.^12–15 ABL kinases have been shown to be activated downstream of oncogenic stimuli, as well as in response to DNA damage, oxidative stress, and hypoxia.^16,17 Unexpectedly, we found that ABL inactivation impairs the function of proteins implicated in transcription-coupled homologous recombination (TC-HR) and increases DNA damage. Notably, we found that ABL inactivation markedly increases TRCs and impairs replication fork progression in part by targeting RAD52 and RAD51 proteins in SCLC cells. Because ABL inactivation increases DNA damage, we evaluated whether blocking the activity of DNA damage-repair pathways in the presence of ABL inhibitors might synergize to promote SCLC cell death. Concurrent inactivation of ABL and Ataxia telangiectasia and Rad3-related (ATR), the primary responder to replication stress, markedly inhibits SCLC cell growth and impairs metastatic outgrowth compared to single-agent-treated or control mice. These findings suggest that ABL inhibitors in combination with ATR inhibitors might be exploited to block dissemination and outgrowth of SCLC metastases.

RESULTS

ABL kinase inhibition impairs SCLC metastatic dissemination and outgrowth

A characteristic feature of SCLC is its high metastatic capacity as ~70% of patients with SCLC harbor distant metastases at diagnosis.^1,2,18 Despite initial sensitivity to first-line chemotherapy or radiotherapy, most patients with SCLC experience relapse and succumb to systemic metastases.³ Therefore, there is an urgent need to identify effective therapies for the treatment of metastatic SCLC. We have shown that ABL tyrosine kinases promote metastasis of lung adenocarcinoma and breast tumors in mouse models.^12–15 Thus, we evaluated whether ABL inhibition might be exploited to impair outgrowth of metastatic SCLC. To this end, we employed H69 SCLC cells expressing a Luciferase-Tomato vector for bioluminescent imaging (BLI) measurement of tumor burden. SCLC cells were implanted by intra- cardiac injection into nude mice, and the mice were assessed by BLI. Starting on day 17 post-injection, tumor-bearing mice were treated twice per day with control vehicle or the ABL allosteric inhibitor (GNF5) by oral gavage. As previously reported, ABL allosteric inhibitors, including GNF5 and ABL001 (Asciminib) are well tolerated without detectable toxicities or loss of body weight.^12,15,19 Moreover, ABL allosteric inhibitors administered by oral gavage cross the blood-brain-barrier (BBB).^13,15 Notably, we observed decreased metastatic burden in the brain and other organs, and markedly increased animal survival in mice treated with the ABL allosteric inhibitor (Figures 1A and 1B). Interestingly, over 50% of the mice developed brain metastases following intra-cardiac injection of H69 SCLC (ASCL1+) cells, and treatment with the ABL allosteric inhibitor by oral gavage was effective in decreasing brain metastases. The incidence of brain metastases for patients with SCLC is exceptionally high, with 60% of patients developing brain metastases.² Thus, the H69 SCLC cells are a useful tool to interrogate the cellular and molecular pathways that underlie the high metastatic potential of SCLC tumors. Further, the treatment of SCLC cells in vitro with ABL allosteric inhibitors decreased cell viability and growth of various SCLC cell subtypes (ASCL1+ and NEUROD1+) in a dose-dependent manner (Figure S1A–S1F). These data support a role for ABL kinases in promoting outgrowth of metastatic SCLC and nominate ABL as an actionable target for the treatment of SCLC metastatic tumors.

Figure 1. — (A) H69 SCLC cells were intracardiac injected into nude mice and monitored by bioluminescence imaging (BLI). Mice were treated by oral gavage twice daily with vehicle or the ABL kinase inhibitor GNF5 (100 mg/kg) starting at day 17 post-injection. Mice were imaged at day 43 by BLI.

(B) Percentage of mice surviving over the indicated times (days). Log rank (Mantel-Cox) test: *p = 0.0178. Mice number n = 8 each group.

(C and D) H69 cells were treated with GNF5 (20 μM) or vehicle DMSO for 48h. Gene set enrichment analysis of DNA repair (C) and DNA replication (D) signature genes using total RNA-seq data.

(E and F) H69 (E), H146 (F) SCLC cells were treated with GNF5 (G, 20 μM), ABL001 (A, 20 μM), GMB475 (GMB, 10 μM) or vehicle DMSO (C) for 48 h. Cell lysates were analyzed by western blotting with indicated antibodies.

(G) DMS53 cells were treated with GMB475 (10 μM) or vehicle DMSO (control) for 24 h. Immunofluorescence (IF) staining was performed with anti-γH2AX antibody, plus Alexa Fluor 568-coupled secondary antibody. DAPI was used for nucleus staining (left panel) (scale bars, 10 μm). The γH2AX foci were quantified, n = 80 nuclei each (right panel). Student’s t test ****p = 0.0006.

(H) U2OS-Tet-DR-GFP cells transfected with I-SceI-mCherry were treated with ABL001 (20 μM) or GMB475 (10 μM) or vehicle DMSO plus or minus doxycycline (1 μg/mL) for 60 h. Cells were then analyzed by flow cytometry.

Percentage of mCherry and GFP double-positive cells was calculated over total mCherry-positive cells. Data were analyzed with a one-way ANOVA. ****p < 0.0001, *p = 0.03, and ***p = 0.0008.

Data in B and F represented by mean +/− SEM.

Inactivation of ABL kinase in SCLC cells impairs the expression of DNA repair and DNA replication pathways, increases DNA damage, and decreases DNA repair

To identify potential pathways by which ABL inhibition might impair SCLC metastasis and outgrowth, we employed transcriptomic profiling with next-generation sequencing (RNA-seq) of SCLC H69 cells treated with an ABL allosteric inhibitor versus control-treated cells (sequencing data deposited in NCBI Gene Expression Omnibus (GEO) accession no. GEO: GSE289452). We found profound downregulation of various transcripts encoding DNA repair and replication pathways in cells treated with the ABL inhibitor GNF5 (Figures 1C and 1D). Treatment of H69 and H146 SCLC cells with three different ABL allosteric inhibitors revealed that ABL inactivation markedly increased DNA damage assessed by enhanced γH2AX protein expression, a marker of DSBs (Figures 1E and 1F; Figures S2A–S2C). In these studies, we employed the ABL-specific allosteric inhibitors, GNF5 and ABL001 (Asciminib), as well as GMB475, an ABL-specific proteolysis-targeting chimera (PROTAC).²⁰ These inhibitors target the unique myristate-binding site present in the ABL tyrosine kinases.²¹ The effectiveness of the inhibitors in decreasing ABL kinase activity was detected by immunoblotting for the phosphorylation of CrkL (p-CrkL) at the ABL-specific Y-207 site. Treatment of SCLC cells with the ABL PROTAC GMB475 resulted in enhanced γH2AX accumulation compared to vehicle control-treated cells as detected by immunofluorescence (IF) staining (Figure 1G). Further, genetic depletion of ABL kinases with dual-targeting shRNAs for ABL1 and ABL2 resulted in a marked increase in γH2AX levels in SCLC cells, which was reversed by the expression of wild-type (WT) ABL1 but not the kinase-defective ABL1-K290R mutant (Figures S2D and S2E). Thus, ABL inactivation by pharmacological inhibition, post-translational protein depletion, or genetic knockdown in SCLC cells increases DNA damage.

Interestingly, ABL inactivation in SCLC cells reduced the levels of RAD51 and, to a lesser extent, RAD52 proteins at 48 h post-treatment with the ABL allosteric inhibitors (Figures 1E and 1F). The RAD51 and RAD52 proteins have critical roles in DNA repair and DNA replication, and both function to regulate TC-HR.²² To evaluate whether ABL kinase activity regulates TC-HR, we employed an assay that relies on the expression of Tet-inducible direct repeat (DR)-GFP for comparison of homologous recombination (HR) activities in transcriptional “on” and “off” states.²³ In this assay, the reporter construct contains a GFP gene that is interrupted by a rare restriction site (I-SceI), and transient expression of the I-SceI endonuclease generates a DSB that is repaired by HR leading to GFP expression, which is then detected and quantified by flow cytometry and FACS analysis of GFP+ cells. For the TC-HR assay, the constitutive promoter of sce-GFP was replaced with a tetracycline-inducible (Tet-On) promoter for induction with doxycycline.²³ The Tet-DR-GFP HR assay was employed to assess whether ABL regulates TC-HR using U2OS cells stably expressing the Tet-inducible DR-GFP cassette. We observed significantly decreased GFP expression in total I-SceI-expressing cells upon treatment with the ABL inhibitors ABL001 and GMB475 compared to control cells (Figure 1H; Figure S1G). The Tet-DR-GFP system employed here was specifically designed to assess homologous recombination efficiency under transcriptionally regulated conditions. In this system, the sce-GFP gene is driven by a doxycycline-inducible promoter, allowing precise control over transcription at the DSB site, because upon I-SceI-mediated DSB induction, HR-mediated repair restores a functional GFP gene. Importantly, GFP fluorescence is only observed when transcription is induced by doxycycline, and in the absence of doxycycline, even successfully repaired GFP genes remain transcriptionally silent and thus non-fluorescent. This feature enables a direct comparison of HR efficiency between transcriptionally active and inactive conditions. The finding that ABL kinase inhibition or post-translational ABL protein depletion decreased GFP expression over total I-SceI-expressing cells revealed a role for ABL kinase in promoting TC-HR for repair of DSBs at sites of active transcription and demonstrated that ABL inhibition leads to decreased TC-HR and increased DNA damage.

Temporal analysis for markers of DNA damage and cell death in SCLC cells treated with ABL inhibitors, revealed that ABL inhibition with ABL001 induced upregulation of the DNA damage marker γH2AX at 8 h after treatment initiation, without detectable changes in the expression of apoptotic markers cleaved caspase 3 (CC3) and cleaved PARP (C-PARP), which were subsequently increased at 48 h post-treatment in H69 SCLC cells (Figure S2A). Treatment of DMS53 SCLC cells with the GMB475 PROTAC decreased ABL1 and ABL2 protein levels and increased expression of the DNA damage marker γH2AX at ~2 h post-treatment, followed by enhanced C-PARP expression without detectable changes in the expression of the CC3 apoptosis marker up to 6 h (Figure S2B). Treatment of SCLC cells with the GMB475 PROTAC for 24 h decreased ABL1 and ABL2 protein levels and increased levels of the DNA damage marker γH2AX in a dose-dependent manner, followed by increased expression of apoptotic markers CC3 and C-PARP, which were increased at higher doses of GMB475 (Figure S2C). Thus, ABL inactivation induces DNA damage prior to the induction of apoptosis in SCLC cells.

ABL kinase regulates transcription-replication conflicts in SCLC cells

ABL inhibition in SCLC cells decreased the levels of RAD51 and RAD52 proteins (Figures 1E and 1F) after prolonged treatment without decreasing RAD51 and RAD52 transcripts (Figures S2F and S2G). Both RAD51 and RAD52 function to regulate TC-HR, and RAD51 interacts with RAD52 to trigger the activation of DNA damage repair and has a critical role in replication fork progression.^22,24 RAD52 is recruited to R-loops, which are three-stranded DNA: RNA hybrid structures present at DNA damage sites to promote DNA repair.^22,25 Aberrant R-loop accumulation can lead to further DNA damage by causing RNA polymerase II (RNAPII) pausing, which in turn can result in collisions with the DNA replication fork machinery, thereby inducing TRCs.^26,27 RAD52 has been shown to associate with RNA polymerase II at R-loops and resolve TRCs.²⁷ Thus, our finding that ABL inhibition reduces RAD52 protein levels suggested that ABL inhibition could elicit increased TRCs. To test this possibility, we evaluated whether ABL inhibition might induce TRCs by use of the proximity ligation assay (PLA)²⁸ to visualize interactions between R-loops (detected with the S9.6 antibody) and the replication fork complex (detected with antibodies against proliferating cell nuclear antigen, PCNA) (Figure 2A). DMS53 SCLC cells were treated with ABL001, and PLA was performed to examine the co-localization of R-loops and replication forks. ABL kinase inhibition induced a significant increase in PLA foci indicative of enhanced TRCs compared to vehicle control (Figure 2B). Importantly, we found that the enhanced TRC accumulation in cells treated with the ABL kinase inhibitor is dependent on R-loops because it was markedly decreased by RNase H1, which resolves R-loops²⁹ (Figure S3A). To assess whether increased TRCs induced by ABL inactivation are dependent on transcription, SCLC cells were incubated with DRB, an RNA polymerase II inhibitor to block transcription, in the presence of the ABL001 inhibitor, and cells were subjected to the PLA assay for the detection of TRCs. ABL-mediated induction of TRCs was shown to require active transcription, as TRCs markedly decreased in SCLC cells co-treated with ABL001 and DRB compared to single-agent-treated cells (Figure 2C). To evaluate whether global TRCs are increased in response to ABL inhibition, we evaluated the colocalization of RNA polymerase II phospho-Ser2 (RNAPIIpS2) and PCNA by the PLA assay. TRCs were increased with ABL001 treatment and depleted upon co-treatment with DRB (Figure S3B). Like DMS53 cells, the NCI-H1048 SCLC cells exhibited a significant increase in TRCs by co-localization of R-loops and replication forks following treatment with the ABL inhibitor, which was decreased with either RNase H1 enzymatic digestion or DRB co-treatment (Figure S3C).

Figure 2. — (A) Schematic representation of TRCs.

(B) DMS53 cells were treated with vehicle (DMSO) or ABL001 (20 μM) for 16h, and proximity ligation assay (PLA) was performed using S9.6 (R-Loops) and anti-PCNA (replication forks) antibodies (scale bars, 10 μm). Quantification of PLA foci per nucleus, where each dot represents an individual nucleus; n = 95–230 nuclei per experiment with 3 biological replicates. Student’s t test ****p < 0.0001.

(C) DMS53 cells were treated for 24 h with vehicle, 20 μM ABL001, 20 μM DRB, or dual treatment with ABL001 and DRB. Representative images of PLA assay with S9.6 and anti-PCNA antibodies (594 nm) (scale bars, 10 μm). Quantification of PLA foci per nucleus, where each dot represents an individual nucleus; n = 71–204 nuclei per experiment with 2 biological replicates. One-way ANOVA with Tukey-Kramer test for multiple comparisons ****p < 0.0001.

(D) DMS53 cells were transduced with either shSCR or shAA for 5 days, then treated with or without 20 μM DRB for the final 24 h. Representative images of the PLA assay with S9.6 and anti-PCNA antibodies (594 nm) (scale bars, 10 μm). Quantification of PLA foci per nuclei, with the mean value representing PLA foci per nucleus; n = 50–100 nuclei per experiment with 2 biological replicates. One-way ANOVA with Tukey-Kramer test for multiple comparisons ****p < 0.0001.

Data in B, C, and D represented as mean +/− SEM.

To ascertain that the effects of the ABL pharmacological inhibitors were on-target, SCLC cells were transduced with lentiviruses encoding dual-targeting ABL1 and ABL2 shRNAs (shAA) or sh-Scramble (shSCR) control. Genetic depletion of ABL proteins elicited an increase in TRCs as shown by enhanced PLA foci (S9.6-PCNA) compared to control cells (Figure 2D). Treatment with DRB ablated the increase in TRCs induced by ABL knockdown (Figure 2D), indicating that this phenotype is dependent on transcription. Further, add- back of wild-type (WT) ABL1 by the expression of shAA-resistant ABL1-WT in cells with endogenous ABL knockdown reversed the increase in TRCs in response to ABL depletion (Figures S3D and S3E). In contrast, the expression of kinase-defective ABL1-K290R in ABL knockdown SCLC cells did not rescue the increase in TRCs induced by the genetic depletion of endogenous ABL in SCLC cells (Figures S3D and S3E). Together, these data reveal a previously unknown role for ABL kinases in the regulation of collisions between the transcription complex and DNA replication fork machineries and identify ABL-mediated regulation of TRCs as a potential vulnerability in metastatic SCLC. These data suggest that increased TRCs in SCLC cells treated with ABL inhibitors could lead to replication fork stalling.

ABL inactivation compromises DNA replication forks in SCLC cells

TRC accumulation may elicit replication fork collapse and stalling of the replication machinery.^9,30 To address the possibility that enhanced TRC accumulation in cells treated with ABL inhibitors may lead to replication fork defects, we employed the DNA fiber assay. This is a cell-based imaging technique to visualize DNA replication forks by labeling DNA in nascent strands with two thymidine analogs: 5-chloro-2’-deoxyuridine (CldU) and 5-iodo-2’-deoxyuridine (IdU), followed by cell lysis, stretching of DNA fibers on glass coverslips, and visualization by immunofluorescence (IF) microscopy.^31,32 DMS53 SCLC cells were treated with the ABL001 allosteric inhibitor for 24 h followed by sequential labeling with the thymidine analogs CldU and IdU for 20 min each, and slides were processed to visualize the DNA fibers (Figure 3A). As shown in representative images and quantification of DNA fiber lengths, treatment of SCLC cells with ABL001 resulted in compromised, shorter replication forks (Figure 3B). Similarly, treatment of SCLC cells with the GMB475 ABL-PROTAC resulted in compromised, shorter replication forks, even at the lowest doses employed in the DNA fiber assay (Figures S4A and S4B).

The temporal consequences of ABL inactivation with GMB475 on replication fork dynamics were evaluated with the DNA fiber assay (Figure 3C). Treatment of DMS53 cells with GMB475 significantly decreased incorporation of the thymidine analogs into replication forks at 16 and 24 h, without significant changes detected earlier at 2-h post-treatment (Figure 3D). Further, genetic depletion of endogenous ABL proteins following shRNA-mediated knockdown in SCLC cells markedly decreased replication fork progression as detected by reduced DNA fiber lengths (Figures 3E and 3F). Rescue with add-back of wild-type ABL1 significantly rescued the impaired replication fork progression in ABL-knockdown SCLC cells as measured by DNA fiber length assays (Figures S4C and S4D). The decrease in replication forks induced by ABL depletion in ABL-knockdown SCLC cells was not recued with add-back of kinase-defective ABL1-K290R (Figures S4C and S4D). These data reveal for the first time that the inactivation of ABL kinases in SCLC cells causes replication fork defects, suggesting that certain factors promoting fork progression or stabilizing forks become limiting after ABL inactivation at 16 to 24 h.

ABL1 kinase associates with and phosphorylates RAD51 and RAD52

We observed that levels of both RAD51 and RAD52 proteins were decreased by the treatment of SCLC cells with ABL inhibitors for 48 h (Figures 1E and 1F). It was reported that the ABL1 kinase phosphorylates RAD51, leading to enhanced recombinase and DNA strand exchange activities,³³ and that ABL1-mediated phosphorylation of RAD51-Y315 enhances RAD51 chromatin association.³⁴ Other studies have shown that in leukemia cells, oncogenic BCR-ABL1 enhanced the expression of RAD51 dependent on transcriptional as well as post-transcriptional regulation by preventing RAD51 protein degradation.³⁵ Thus, the regulation of RAD51 protein expression is dependent on the cell context. Further, ionizing radiation-induced RAD52 nuclear foci were shown to be dependent on ABL1-mediated RAD52 phosphorylation in CHO cells.³⁶ Thus we evaluated whether ABL1 phosphorylates and interacts with RAD51 and RAD52. We found that active ABL1 interacts with and promotes tyrosine phosphorylation of both RAD51 and RAD52 proteins following co-expression of active ABL1-PP¹⁷ with epitope-tagged RAD51 or RAD52 proteins (Figures 4A and 4B; Figures S5A and S5B). Both RAD51 and RAD52 proteins were strongly tyrosine phosphorylated in cells expressing active ABL1-PP but not the kinase-defective ABL1-KM or weakly active ABL1 wild type (WT) as detected by blotting with anti-phosphotyrosine antibody (4G10) or phospho-specific antibodies against p-RAD51-Y315 and p-RAD52-Y104 (Figures 4A and 4B; Figures S5A and S5B). Further, active ABL1-PP preferentially interacted with phosphorylated RAD51 and RAD52 proteins following co-IP (Figures 4A and 4B; Figures S5A and S5B). Mutation of RAD51 tyrosine (Y) 315 to phenylalanine (F) markedly decreased tyrosine phosphorylation compared to RAD51 wild type (WT) in the presence of active ABL1-PP (Figure 4C). Similarly, tyrosine phosphorylation of the RAD52-Y104F mutant decreased compared to RAD52-WT in cells expressing active ABL1-PP (Figure 4D). These data show that active ABL1 promotes tyrosine phosphorylation of RAD51 and RAD52, and active ABL1 interacts with both RAD51 and RAD52.

Figure 4. — (A and B) 293T cells were transfected with either Flag-RAD51 (A) or GFP-RAD52 (B) and co-transfected with GFP-ABL1-wild type (ABL-WT), or GFP-active ABL1 (ABL-PP) or GFP-kinase-dead ABL1 (ABL-KM) as indicated. Immunoprecipitation (IP) was performed using anti-Flag (A) or anti-RAD52 (B). All IP-products and whole cell lysates (WCL) were analyzed by western blotting with indicated antibodies.

(C) 293T cells were transfected with either Flag-RAD51-WT or Flag-RAD51-YF (Y315F) mutant and co-transfected with or without ABL-PP (GFP-active-ABL1). Immunoprecipitation (IP) was performed using anti-Flag antibody. All IP-products and whole cell lysates (WCL) were analyzed by western blotting with indicated antibodies.

(D) 293 T cells were transfected with either GFP-RAD52-WT or GFP-RAD52-YF (Y104F) mutant and co-transfected with or without ABL-PP (pCDNA-ABL1-PP). Immunoprecipitation (IP) was performed using anti-GFP antibody. All IP-products and whole cell lysates (WCL) were analyzed by western blotting with indicated antibodies. Vinculin and Actin were used as loading control.

(E) H69 cells were treated with or without ABL001 (20 μM) for 24 h and endogenous RAD51 or RAD52 were immunoprecipitated using anti-RAD51 or anti-RAD52 antibodies. Endogenous IP products and WCL were analyzed by western blotting with indicated antibodies (top panel). Phospho-RAD51 and phospho-RAD52 were quantified and normalized to total RAD51 and RAD52 in IP samples. Expression levels were analyzed using FIJI software, samples without ABL001 treatment were set as 1 (bottom panel).

The tyrosine phosphorylation of endogenous RAD51 and RAD52 proteins in SCLC cells was analyzed in the absence and presence of the ABL allosteric inhibitor. We detected tyrosine phosphorylation of endogenous RAD51-Y315 and RAD52-Y104 in H69 cells, which was decreased upon ABL kinase inhibition (Figure 4E). Temporal analysis of the dynamics of tyrosine phosphorylation and protein expression of endogenous RAD51 and RAD52 proteins in SCLC cells was evaluated in the absence and presence of the ABL allosteric inhibitor. Treatment of H69 SCLC cells with ABL001 decreased endogenous RAD51 protein starting at 20 h, which continued to decrease at 48 h (Figure S5C). The endogenous RAD52 protein decreased starting at 48 h post-treatment with ABL001 (Figure S5C). Notably, ABL inhibition with ABL001 decreased the phosphorylation of RAD51-Y315 and RAD52-Y104 at 4 h post-treatment, which preceded detectable changes in the levels of the corresponding RAD51 and RAD52 proteins (Figures S5D and S5E). These data suggest that the primary effect of ABL kinase inhibition is to decrease the tyrosine phosphorylation of RAD51-Y315 and RAD52-Y104 prior to downregulation of the corresponding proteins, which is a secondary consequence of ABL inactivation in SCLC cells. Interestingly, increased expression of RAD51 and RAD52 transcripts is associated with decreased overall survival of patients with lung cancer (Figures S5F and S5G). These findings suggest potential functional roles for RAD51 and RAD52 downstream of ABL kinases in lung cancer cells.

SCLC cells expressing a phospho-deficient RAD52-Y104F mutant exhibit decreased foci and increased TRCs compared to RAD52-WT-expressing cells in response to DNA damage

To evaluate whether ABL-mediated tyrosine phosphorylation of RAD52 plays a functional role in the response to DNA damage and TRC accumulation in SCLC cells, we generated cells stably expressing phospho-deficient GFP-RAD52-Y104F and GFP-RAD52-WT. Transduced SCLC cells were subjected to FACS sorting for GFP+ cells to generate cell lines with similar levels of GFP-RAD52-WT and GFP-RAD52-Y104F, and these cells were then depleted of endogenous RAD52 by knockdown with shRNAs targeting the RAD52 3’UTR sequences (Figure S6A). Nuclear focus formation by RAD52 in response to DNA damage is indicative of RAD52 recruitment to DNA repair complexes that include RAD51 in various cell types.^37,38 To assess whether RAD52-Y104 is required for foci formation in response to DNA damage in SCLC cells, GFP-RAD52-WT- and GFP-RAD52-Y104F-expressing SCLC cells were exposed to ionizing radiation (IR). DNA damage was induced by IR (4Gy) as shown by increased γH2AX accumulation in IR-treated SCLC cells versus untreated controls (Figure S6B). While SCLC cells expressing GFP-RAD52-WT exhibited enhanced RAD52 foci in response to IR, foci formation was profoundly impaired in SCLC cells expressing the GFP-RAD52-Y104F mutant (Figure 5A). Next, we asked whether the RAD52 Y104 phosphorylation site is required for IR-induced TRCs. SCLC cells expressing GFP-RAD52-WT or GFP-RAD52-Y104F mutant were treated without and with IR (4Gy), and 4 h post-treatment, cells were subjected to PLA assays to detect TRCs. SCLC cells expressing the RAD52-Y104F mutant exhibited profoundly increased TRCs compared to cells expressing RAD52-WT (Figure 5B). These data support a functional role for RAD52 Y104 in TRCs, as loss of the ABL-induced Y104 phosphorylation site results in markedly enhanced TRCs in response to IR.

Figure 5. — (A) DMS53 cells expressing GFP-RAD52 wild type (WT) or GFP-RAD52 Y104 (YF) mutant were depleted of endogenous RAD52 using shRNA to the RAD52-UTR region. Cells plated onto the coverslips were treated with 4 Gy or without ionizing radiation (IR). Cells were incubated for 3 h after IR followed by immunofluorescence (IF) staining. RAD52-GFP (green) and DAPI-stained DNA (blue) were visualized with confocal microscope with 40× oil lens.

Representative images are shown (Single RAD52 foci images presented as black and white pseudo-color). The number of RAD52 foci per cell was plotted with GraphPad Prism (number of cells n = 123–139). Statistics was performed with a one-way ANOVA software: ns: not significant; **p = 0.0042 and ****p = 0.0001. Scale bars, 5 μm.

(B) RAD52 WT and RAD52 Y104F (YF) mutant DMS53 cells were treated with 4Gy or without IR. After treatment, cells were incubated for 4 h, then fixed for PLA (S9.6-PCNA). Scale bars, 10 μm. Quantification of PLA foci per nucleus in DMS53 cells expressing RAD52 WT and RAD52 Y104F without irradiation (113 and 164 nuclei, respectively) and RAD52 WT and RAD52 Y104F with 4Gy irradiation (147 and 104 nuclei, respectively). Data were analyzed with a one-way ANOVA: ns: not significant; *p value < 0.05 and ****p < 0.0001.

(C) Schematic representation of the DNA fiber assay. DMS53 cells harboring Flag-tagged RAD51-WT or RAD51-YF (Y315F) mutant were depleted of endogenous RAD51 with shRNA to the RAD51-UTR regionCells were subjected to sequential labeling with thymidine analogs CldU (50 μM) and IdU (100 μM), respectively, for the indicated time periods. For HU treatment, cells were exposed to HU (2 mM) together with IdU.

(D) Representative images of RAD51-WT or RAD51-YF labeled with CIdU and IdU in the presence or absence of HU treatment. Scale bars, 5 μm.

Quantification of DNA Fiber length described in (A). Number of fibers counted n = 50. Statistics were performed with a one-way ANOVA: ****p < 0.0001; ns: not significant.

Data in A, B, and D represented as mean +/− SEM.

To evaluate whether RAD52-Y104 is required for TRC resolution in response to DNA damage induced by stimuli other than IR, we induced site-specific DNA DSBs in SCLC cells. To this end, we employed DMS53 cells expressing ER-Asi-SI for tamoxifen-inducible DNA DSBs at specific sites.³⁹ Enhanced accumulation of γH2AX foci was detected in response to tamoxifen treatment of DMS53-ER-Asi-SI cells (Figure S6C). Importantly, SCLC cells expressing the GFP-RAD52-Y104F mutant lacking the ABL phosphorylation site displayed significantly enhanced TRCs compared to cells expressing GFP-RAD52-WT in the absence, and to a larger extent, in the presence of tamoxifen-induced DNA damage (Figures S6D and S6E). These data reveal that RAD52 recruitment to foci at DNA damage sites, and its role in preventing TRC accumulation, requires Y104, the ABL phosphorylation site in SCLC cells.

Impaired replication fork progression in SCLC cells expressing a RAD51-Y315F mutant compared to RAD51-WT-expressing cells in response to DNA damage

RAD51 plays a critical role in replication fork progression.⁴⁰ It was reported that ABL kinase-mediated phosphorylation of RAD51 on Y315 is required for enhanced RAD51 recombinase activity, chromatin association, and enhanced interaction of RAD51 with RAD52.^33,34 RAD51 Y315F mutant leukemia cells were shown to be deficient in foci formation upon ionizing radiation in BCR-ABL1-expressing 32D cells.⁴¹ However, whether ABL-mediated phosphorylation of RAD51 plays a role in replication fork progression is unclear. Thus, we evaluated RAD51 foci in SCLC cells expressing RAD51-WT and RAD51-Y315F mutant proteins. To this end, we generated SCLC cells expressing exogenous Flag-tagged RAD51-WT or Flag-RAD51-Y315F phosphorylation-deficient mutant, and these cells were sorted to obtain similar levels of RAD51 expression (Figure S7A). The SCLC cells were then subjected to knockdown of endogenous RAD51 with shRNA targeting the RAD51-UTR sequences, and these cells were evaluated for RAD51 foci in the absence and presence of 4Gy IR (Figures S7B and S7C). Upon irradiation, RAD51-Y315F mutant cells exhibited decreased IR-induced foci accumulation compared to RAD51-WT cells, supporting a role for RAD51-Y315 in the response to DNA damage in SCLC cells. Next, we evaluated whether RAD51-Y315 has a role in the regulation of replication fork progression in SCLC cells. The cells expressing the RAD51-Y315F mutant exhibited decreased replication fork progression compared to cells expressing RAD51-WT in response to DNA damage with hydroxyurea (HU) (Figures 5C and 5D). These data support a novel functional role for ABL-mediated phosphorylation of Y315 on RAD51 in replication fork progression in response to DNA damage.

Co-treatment with ABL and ATR inhibitors synergistically inhibits SCLC growth and viability and promotes DNA damage

ATR is a central mediator of the cellular replication stress response.⁴² Inhibition of the ATR kinase, the primary responder of replication stress, has been shown to enhance anti-tumor activity of chemotherapies in SCLC.^43,44 The ATR kinase is activated in response to diverse DNA damage signals and replication stress, leading to the phosphorylation of the CHK1 kinase and other substrates.⁴⁵ ATR signaling maintains genomic integrity and protects against DNA damage and replication stress by coordinating diverse cellular processes including cell-cycle arrest, inhibition of replication origin firing, stabilization of stressed replication forks, and increased DNA repair.⁴⁶ Because ABL inhibition increased DNA damage, we investigated whether blocking the activity of ATR in the presence of ABL kinase inhibitors would synergize to promote cell death and impair growth in SCLC cell lines. We found that concurrent co-treatment of sub-therapeutic doses of ABL inhibitors, ABL001 or GMB475, with the ATR inhibitor M6620 induced profound synergistic inhibition of cell growth and viability in H69, DMS53, and H146 SCLC cell lines analyzed with Synergy Finder, which showed strong synergy scores by the Bliss and HSA models in the SCLC cell lines (Figures 6A and 6B; Figures S8A and S8B and S8D–S8F).

Figure 6. — (A) H69 cells were treated with a range of ABL001 (0–16 μM) and ATR inhibitor M6620 (0–9.6 μM); alone or in combination for 72 h; DMS53 cells were treated with a range of GMB475 (0–3 μM) and M6620 (0–0.3 μM) alone or in combination for 72 h. Cell viability and growth were measured using Cell-Titer-Glo. Data were analyzed using Synergy Finder presented by Bliss and HSA analysis (score >10 is synergistic). P values for significance are indicated in the graph.

(B) H69 cells were treated with ABL001 (4 μM) and M6620 (2.4 μM) for 72 h; DMS53 cells were treated with GMB475 (3 μM) and M6620 (0.3 μM) for 72 h. Cell viability and growth was measured by Cell-titer-Glo. Data (represented as mean +/− SEM) were plotted with GraphPad Prism. Statistics was performed with a one-way ANOVA: ***p < 0.001 and ****p < 0.0001.

(C) H69 cells were treated with ABL001 (6 μM) and M6620 (2 μM).

(D) DMS53 cells were treated with GMB475 (5 μM) and M6620 (1.2 μM) for 48 h. Total cell lysates were analyzed for the indicated proteins by western blotting. (Cl-PARP: Cleaved PARP; Cl-Caspase 3: Cleaved caspase 3).

(E) H69 cells were treated with ABL001 (7.5 μM) and M6620 (0.75 μM).

(F) DMS53 cells were treated with GMB475 (3 μM) and M6620 (0.3 μM) for 72 h. Total cell lysates were analyzed for the indicated proteins by western blotting.

While single treatment with sub-therapeutic (below IC50) doses of ABL allosteric inhibitors did not induce the expression of cell death markers, concurrent treatment with sub-therapeutic doses of ABL and ATR inhibitors resulted in synergistic decrease of SCLC viability in H69, DMS53, and H146 SCLC cell lines (Figures 6C and 6D; Figure S8C). Concurrent treatment of SCLC cells with ABL and ATR inhibitors induced a strong increase in γH2AX, cleaved PARP, and cleaved caspase 3, indicative of DNA damage-induced apoptosis (Figures 6C and 6D; Figure S8C). Inhibition of ABL kinase alone did not decrease the activity of the ATR kinase as measured by phosphorylation of the ATR substrate CHK1 on S345 (Figures 6E and 6F; Figure S8C). Thus, concurrent inhibition of ABL and ATR kinases synergizes to decrease SCLC cell viability and induces DNA damage leading to increased apoptosis.

Co-inhibition of ABL and ATR kinases impairs replication fork progression

To evaluate the contribution of inhibiting ABL and ATR kinases alone or together to replication fork progression, DMS53 SCLC cells were treated with a low dose of the ABL inhibitor GMB475 (5 μM) for 24 h, followed by incubation with the ATR inhibitor M6620 (1 μM) for the last 30 min, and the cells were then subjected to the DNA fiber assay. SCLC cells were labeled with CldU for 20 min, followed by IdU labeling for 20 min, and DNA fibers were processed and analyzed. The doses of the inhibitors employed did not impair cell viability during the duration of the assay. Although treatment with the ABL inhibitor or ATR inhibitor alone reduced DNA replication fork progression, replication forks were stalled to a greater extent in the double-treated cells compared to control or single-treated cells (Figures 7A and 7B). Thus, ABL and ATR kinases may function to regulate distinct targets important for the regulation of replication fork dynamics.

Figure 7. — (A) Schematic representation of the DNA fiber assay.

(B) DMS53 cells were treated with ABL inhibitor GMB475 (GMB, 5 μM, 24 h), ATR inhibitor M6620 (1 μM for the last 30 min), each inhibitor alone or in combination (double), followed by sequential labeling with thymidine analogs CldU (50 μM) and IdU (100 μM), respectively for the indicated times. Representative images and quantification (represented as mean +/− SEM) of DNA Fiber length (n = 50) are shown. Scale bars, 5 μm. Statistics were performed with a one-way ANOVA: ****p < 0.0001.

(C) NCI-H69 cells were intracardiac injected into nude mice. Following BLI, mice were then divided into 4 groups (n = 8 each group). Starting on day 20 post-injection, mice were treated by oral gavage with vehicle control, ABL001 (100 mg/kg) once daily, M6620 (60 mg/kg) 4 times a week, or ABL001 plus M6620 double treatment. Mice were imaged at day 52.

(D) Percentage of mice surviving over the indicated times (days). Log rank (Mantel-Cox) test: *p = 0.013.

(E) Mouse brain with tumor was dissected; cerebral cortex (left and right sides), cerebellum, and skull were imaged in separate wells.

(F) NCI-H82 cells were engrafted in both flanks of nude mice. Mice were randomly enrolled into drug treatment groups once growing tumor volumes reached approximately 100 mm³. Mice were treated once daily by oral gavage with vehicle control (n = 6 tumors), ABL001 (100 mg/kg; n = 6 tumors), M6620 (60 mg/kg; n = 5 tumors), or ABL001 plus M6620 double treatment (n = 6 tumors). Statistics were performed with a two-way ANOVA with treatment groups compared against the control: **p < 0.01, ns = not significant. Data represented as mean + SEM.

Combined inactivation of ABL and ATR kinases impairs SCLC metastasis

To assess whether co-inhibition of ABL and ATR kinases might be leveraged to impair outgrowth of SCLC metastases to a greater extent than single treatment with each drug alone, we used the ABL inhibitor ABL001 and the ATR inhibitor M6620 to treat mice harboring SCLC metastases following intra-cardiac injection. We chose this approach as an in vivo model for the treatment of SCLC tumors because the majority (~70%) of patients with SCLC present with metastasis at the time of diagnosis.^1,2 Our previous work showed that ABL kinases promote metastasis of lung adenocarcinoma and breast cancer cells to multiple sites, including bone and brain.^12,13,15,47 Further, we found that inhibition of ABL alone and in combination with other therapies markedly decreased lung adenocarcinoma metastasis to the brain and other organs.¹⁴ Thus, we used H69 SCLC cells transduced with a Luciferase-Tomato vector to permit bioluminescent imaging (BLI) measurement of tumor burden, and these cells were implanted into nude mice by intracardiac injection. Drug treatment by oral gavage began on day 20 post-injection, which corresponds to a time when cancer cells have undergone extravasation and seeding to multiple organs including the brain. Extravasation of metastatic cells into the brain is complete at ~7 days after inoculation in the circulation and is followed by metastatic seeding and colonization by brain metastases.^12,48 On day 20 post-injection, mice harboring established SCLC metastasis of comparable burden (detected by BLI) were treated by oral gavage with ABL001 with and without ATR inhibitor (M6620, also known as VE-822 or Berzosertib), or vehicle control. We found that the combination of ABL001 and M6620 impaired metastatic SCLC outgrowth and markedly enhanced survival of mice harboring metastases compared to vehicle-treated mice or mice treated with either drug alone (Figures 7C and 7D). Representative BLI images taken 32 days after treatment initiation showed decreased metastatic burden in the combination treatment group (Figure 7C). Mice co-treated with ABL001 and M6620 exhibited significantly prolonged survival (Figure 7D). Importantly, in this experiment we employed a half-dose of ABL001 (once a day) rather than that used to show the effectiveness of single treatment with the ABL allosteric inhibitor (twice daily) (Figures 1A and 1B). The low doses of ABL and ATR inhibitors employed did not induce weight loss or toxicity. Strikingly, the SCLC brain metastases were found to predominantly colonize the mouse cerebellum following intra-cardiac injection of the H69 SCLC cells (Figure 7E).

To evaluate whether the co-inhibition of ABL and ATR kinases is generalizable to other SCLC cell lines and tumor models, we employed a dual-flank xenograft mouse model with the engraftment of NCI-H82 SCLC cells in both flanks. We show that daily concurrent treatment of ABL001 and M6620 led to a significant decrease in tumor growth compared to vehicle-treated mice or single drug-treated mice (Figure 7F). These data demonstrate the effectiveness of the combination therapy to treat established SCLC metastases in mouse models, and support investigating the use of combination therapies with low doses of ABL and ATR inhibitors for the treatment of metastatic SCLC.

DISCUSSION

Despite the exceptionally high metastatic capacity of SCLC, the molecular and cellular mechanisms that promote SCLC metastasis remain largely unknown. Approximately 70% of patients with SCLC harbor distant metastases at diagnosis, with the brain being the most common site of distal metastasis in patients with advanced SCLC disease.^1,2,18 Brain metastases are detected in up to ~20% of patients with SCLC at the time of diagnosis, and the incidence of SCLC brain metastasis reaches ~80% during disease progression.^2,49 The mechanisms that underlie the high incidence of SCLC metastasis are poorly understood. Here we reveal that the ABL kinase regulates collisions between the transcription and replication machineries in SCLC cells, as ABL inactivation through pharmacological inhibition, post-translational protein depletion, or genetic knockdown increases the accumulation of TRCs and compromises replication fork progression, thereby increasing DNA damage and inducing cell death.

The ABL tyrosine kinases have been shown to promote metastasis of lung adenocarcinoma and breast cancer tumors to the brain and other organs. Inactivation of ABL kinases with specific allosteric inhibitors in lung adenocarcinoma, triple-negative breast cancer, and HER2+ breast cancer cells impair metastatic dissemination and outgrowth of these tumors in mouse models.^12,13,15,47 ABL kinases employ distinct mechanisms to regulate the metastatic activity of lung adenocarcinoma and breast cancer by targeting transcription factors, such TAZ, and β-catenin, as well as translational regulators such as Y-Box-1.^12,13,15,47 Here we report that SCLC tumors are exquisitely sensitive to ABL kinase inhibition, and treatment of tumor-bearing mice with ABL allosteric inhibitors markedly impairs SCLC metastases to the brain and other sites, leading to prolonged mouse survival. Notably, we found that the H69 SCLC model of metastasis recapitulates the metastatic behavior of human SCLC tumors with high propensity of brain metastases that home to the cerebellum.^50–53 Thus, this model of SCLC metastasis can be exploited to dissect the mechanisms that underlie the outgrowth of SCLC metastasis, and identification of effective therapies in this pre-clinical model.

To gain insights into potential pathways by which ABL inhibition might impair metastatic SCLC outgrowth, we employed transcriptomic profiling (RNA-seq) of SCLC cells treated with ABL-specific allosteric inhibitors versus control-treated cells. We found profound downregulation of transcripts encoding DNA repair and replication pathways in SCLC cells treated with an ABL-specific allosteric inhibitor, concomitant with a marked increase in the levels of the DNA damage marker γH2AX. SCLC tumors exhibit a high degree of genomic instability and replication stress, and therefore these cells are highly vulnerable to disruption of DNA replication and repair pathways. Emerging data have shown that maintenance of genomic stability requires coordinated spatial and temporal regulation of the replication and transcription machineries, and that aberrant transcription in cancer cells induces pathological accumulation of R-loops,⁹ leading to enhanced TRCs by causing RNAPII pausing, which results in collisions with the replication fork machinery, generating replication stress and DNA DSBs.^9–11,26,27 The ABL1 kinase was reported to induce formation of RNAPII foci at sites of DNA damage in U2OS cells,⁵⁴ and phosphorylate hSSB1 upon DNA damage, promoting its localization to DSBs in an R-loop-dependent manner.⁵⁵ In this regard, the ABL1 kinase was shown to be recruited to sites of DNA damage at a transcribed locus in U2OS cells.⁵⁶ Our data have revealed a previously unappreciated role for ABL kinases in the resolution of TRCs, as ABL kinase inhibition induces accumulation of TRCs and compromises replication fork progression, leading to stalling of the replication machinery.

To interrogate the molecular mechanisms by which ABL kinases regulate the replication and transcription machineries in SCLC cells, we focused on the role of ABL-mediated phosphorylation of critical protein components of transcription-replication complexes. Here we reveal a previously unknown functional role of ABL-mediated tyrosine phosphorylation of RAD52-Y104, which is required to prevent accumulation of TRCs in SCLC cells in response to DNA damage. Further, we found that RAD51-Y315, the ABL phosphorylation site, is required for replication fork progression in response to DNA damage in SCLC cells. While long-term treatment with ABL inhibitors decreases RAD51 protein, and to a lesser extent, RAD52 protein in some SCLC cells, our data suggest that the primary functional consequence of ABL kinase inactivation is to decrease tyrosine phosphorylation of RAD51 and RAD52, leading to defective TRCs and compromised replication forks in response to DNA damage. Together, these data support a novel role for ABL-mediated phosphorylation of RAD51 and RAD52 in protecting SCLC cells from replication stress, and therefore disrupting the functions of RAD51 and RAD52 with ABL inhibitors might be leveraged to increase TRCs, leading to increased DNA damage and enhanced SCLC cell death.

The induction of DNA damage in SCLC cells by treatment with ABL allosteric inhibitors, led us to ask whether blocking the activity of ATR, which functions to promote DNA repair, in the presence of ABL kinase inhibitors could be leveraged to promote SCLC cell death and impair the dissemination and outgrowth of SCLC metastases. Indeed, we found that co-treatment of mice harboring established SCLC metastasis with single daily doses of the FDA-approved ABL allosteric inhibitor ABL001 (Asciminib) and low levels of the ATR inhibitor M6620 impaired SCLC metastasis and enhanced survival of tumor-bearing mice compared to vehicle-treated mice or mice treated with either drug alone. Further, we found that concurrent treatment with ABL001 and M6620 in a xenograft model decreased the growth of SCLC tumors. Compared to ATP-competitive ABL kinase inhibitors, ABL001 was shown to elicit major molecular responses and superior efficacy, with a favorable safety profile in patients with leukemia.⁵⁷ We found that ABL001 sensitizes SCLC cells to sub-therapeutic doses of the M6620 ATR inhibitor, allowing for decreased cellular toxicity often associated with the administration of ATR inhibitors.⁵⁸ Remarkably, the combination of ABL001 and M6620 administered by oral gavage results in a profound decrease in the outgrowth of H69 SCLC brain metastases, which predominantly colonizes the mouse cerebellum.

ATR inhibitors have been proposed as a potential therapy to overcome SCLC resistance to chemotherapy, as ATR was identified as a target in a high-throughput combination drug screen that sensitized SCLC cells to topoisomerase inhibitors.⁴⁴ The top target identified in this screen was the ATR protein kinase, and inhibition of ATR was shown to enhance the anti-tumor activity of cisplatin and topoisomerase chemotherapies in SCLC.^43,44 ATR signaling maintains genomic integrity and protects against DNA damage and replication stress by inhibiting replication origin firing, stabilizing stressed replication forks, and increasing DNA repair.⁴⁶ Targeting ATR signaling in tumor cells would render tumor cells susceptible to cell death. ATR kinase inhibitors affect cellular processes not only in the tumor but also in cells in the tumor microenvironment. In this regard, inhibition of ATR or its downstream target CHK1 was shown to promote anti-tumor immunity by activation of the cGAS-STING pathway in SCLC tumors.^59,60 Thus, co-inhibition of ATR and ABL kinases in mouse models is expected to target not only SCLC metastases but also immune cells in the microenvironment. Our findings revealed that co-treatment with sub-therapeutic doses of inhibitors of the ABL and ATR kinases induces synergistic inhibition of SCLC cell viability in vitro and impairs metastatic SCLC outgrowth in mice. Further, we uncovered novel mechanistic insights into ABL-mediated regulation of TRCs and replication fork progression. Our finding that ABL inhibition renders SCLC cells hypersensitive to inactivation of components of DNA damage-repair pathways such as ATR suggests that combination therapies that target ABL and ATR might be exploited to treat patients with metastatic SCLC.

Limitations of the study

While our findings revealed that ABL kinase inhibition impaired outgrowth of metastatic SCLC and that co-inhibition of ABL and ATR kinases decreased SCLC metastases and flank xenograft tumors in athymic nude mice, this study did not evaluate the consequences of single and concurrent inhibition of ABL and ATR kinases on the immune system. Future studies are warranted to interrogate whether single and combination therapies targeting ABL and ATR or other actionable regulators of DNA damage-repair pathways induce anti-tumor immunity in SCLC immune-competent mouse models. While our data support a model where ABL kinases promote replication fork progression, a caveat of this study is that we did not perform experiments to assess whether ABL inactivation affects replication fork initiation, progression, and/or stability. Further, we found that intra-cardiac injection of H69 SCLC cells promotes brain metastases that predominantly colonize the mouse cerebellum. The emergence of brain metastases among patients with SCLC is exceptionally high, with 60% and up to 80% of patients developing brain metastases.^1,2 Understanding the molecular mechanisms that promote SCLC metastases and colonization to the brain is essential to the development of effective therapies against this aggressive and recalcitrant tumor. The SCLC brain metastasis model we employed here allows for the interrogation of the cellular and molecular mechanisms by which the disruption of ABL kinase and DNA damage-repair networks impairs SCLC metastatic dissemination and colonization of the brain. A limitation of our study is that we employed SCLC cell lines rather than patient specimens. Future studies are needed to investigate the expression and function of ABL kinases and components of DNA damage-repair pathways in human SCLC tumors, particularly SCLC brain metastases. Our studies have opened new avenues to interrogate these exciting research questions that may provide impactful answers for the treatment of deadly SCLC tumors.

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Ann Marie Pendergast (ann.pendergast@duke.edu).

Materials availability

All unique and stable reagents generated in this study are available from the lead contact with a completed Materials Transfer Agreement.

Data and code availability

Raw data are available upon request.
This paper does not report original code.
The RNA-sequence dataset generated during this study has been deposited in NCBI Gene Expression Omnibus (GEO) under accession no. GEO: GSE289452.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Animal models

All animal experiments were approved and conducted following the guidance of the Duke University Division of Laboratory Animal Resources Institutional Animal Care and Use Committee (IACUC) (Approval No. A027–22-02–24). We employed 8–12-weeks-old age-matched outbred athymic nu/nu mice (Jackson Laboratory, RRID: IMSR_JAX:007850) purchased from The Jackson Laboratory. Mice were maintained under pathogen-free conditions in the Duke Cancer Center Isolation Facility (CCIF) for immune-deficient mice. Mice were injected with human small cell lung cancer (SCLC) H69 cells that were transduced with pFU-luciferase-tomato DNA for tracking tumor cells by Bioluminescent imaging (BLI). Mice were anesthetized with 5% isoflurane prior to intracardiac injections. H69 cells (3 × 10⁵ in 100 μL PBS) were injected into the left cardiac ventricle using 30-gauge needles. Animals were monitored until full recovery from anesthesia and were subsequently imaged weekly to both confirm proper anatomical injection and to monitor for progression of disease burden using an IVIS XR bioluminescent imager (Duke Cancer Institute). For the dual-flank xenograft study, H82 cells (5 × 10⁶) were injected into both flanks of mice. Tumor burden and body mass were measured daily. The mice were maintained under pathogen-free conditions in the Duke Cancer Center Isolation Facility for immune-deficient mice.

Cell lines

Human small cell lung cancer (SCLC) cell lines NCI-H69, NCI-H146, NCI-H82, NCI-H2171, NCI-H1048, and DMS53 were originally purchased from ATCC or obtained from the Duke University Cell Culture Facility. No additional cell line authentication was performed. H69, H146, H2171, H1048 and H82 cells were cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich). DMS53 cells were maintained in Waymouth’s medium (Thermo Fisher Scientific) supplemented with 10% FBS. DMS53-ER-AsiSI cells were cultured in the same medium as DMS53 cells and used in the absence or presence of Tamoxifen treatment. The human bone osteosarcoma U2OS cells and human embryonic kidney HEK293T cells were cultured in DMEM medium (Life Technologies) supplemented with 10% FBS. All cell lines were maintained in the presence of antibiotics (1% penicillin-streptomycin) at 37°C in humidified air containing 5% CO2. Mycoplasma contamination was tested routinely by collecting cells, then conducting PCR analysis.

METHOD DETAILS

Drug and inhibitors

The ABL allosteric inhibitors GNF5 and ABL001 were synthesized by the Duke University Small Molecule Synthesis Facility and validated by LC-MS and 1H-NMR, as well as cell-based assays. The ABL allosteric- PROTAC inhibitor GMB475 (S8888) and ATR inhibitor M6620 (Berzosertib, S7102) were obtained from Selleckchem. RNA polymerase II Inhibitor DRB (5,6-Dichloro-1-β-D-ribofuranosylbenzimidazole) was purchased from Sigma (287891). Hydoxyurea (HU) was obtained from Sigma (H8627). All inhibitors for in vitro use were dissolved in DMSO. The final concentration of DMSO in culture media did not exceed 0.1%.

Mouse intra-cardiac injection and treatment

Human SCLC H69 cells (3 × 10⁵ in 100 μL PBS) pre-labeled with pFU-luciferase-tomato were injected into the left cardiac ventricle using 30-gauge needles. Tumor metastasis was monitored by Bioluminescent imaging (BLI). Once mice exhibited established base line metastasis by BLI, they were divided into two groups (for control and GNF5 treatment) or four groups (for Control, ABL001 single, M6620 single and combination of both drugs) according to tumor burden (flux, photons/sec). The ABL allosteric inhibitors GNF5 and ABL001 (Asciminib) were prepared at 10 mg/mL in sterile 0.5% methyl cellulose/0.5% Tween-80.^12,21 ATR inhibitor M6620 (Berzosertib) purchased from Selleckchem (#7102) was prepared at 4 mg/mL according to manufacturer’s instructions. For experiments with single GNF5 treatment, we used 100 mg/kg oral gavage twice daily. For experiments using ABL inhibitor and ATR inhibitor single and combination treatments, ABL001 (100 mg/kg) was used by oral gavage once daily, and M6620 (60 mg/kg) was used by oral gavage 4 times per week. Control mice were treated with the solvent used for preparing drugs. To monitor tumor metastasis over time, mice were injected with D-Luciferin (150 mg/kg) intraperitonially and anesthetized with isoflurane before imaging by BLI.

Mouse dual-flank xenograft injection and treatment

Human SCLC NCI-H82 cells (5 × 10⁶ in 100 μL of 1:1 PBS and Matrigel- Corning; Cat# CB-40234A) were injected into the left and right flanks of mice. Tumor volume was assessed daily by using a caliper, measuring the length and width of the tumor, using the formula: Volume = (1/2) Length × Width.² Once tumors reached approximately 100–200 mm³ in total volume, treatment with drug by oral gavage began immediately. ABL001 (20 mg/mL) and M6620 (12 mg/mL) were prepared in sterile 0.5% methyl cellulose/0.1% Tween-80. Mice were treated daily with ABL001 (100 mg/kg), M6620 (60 mg/kg), or combination treatment. Control mice were treated with the solvent used for the indicated drugs. Tumors were harvested when total tumor volume reached 2000 mm³.

RNA-sequencing analysis

To generate the gene expression signature of SCLC cells treated with ABL kinase allosteric inhibitor we performed RNA-sequencing (RNA-seq) analysis of SCLC H69 cells treated with GNF5 (20 μM) or dimethyl sulfoxide (DMSO) for control for 48 h (in triplicates). Total RNA was collected using the RNeasy kit (QIAGEN) and 1 μg total RNA input was used for each sample. RNA-Seq was performed by Duke DUGSIM (Duke Center for Genomic Computational Biology). Libraries were sequenced on an Illumina NovaSeq 6000 sequencing system using 50-bp single-ended reads. RNA-seq fastq data files were processed using the TrimGalore toolkit followed by read quality assessment with the Fast-QC analysis tool. Reads were mapped to the GRCh37 version of the human genome and transcriptome using the HISAT2 RNA-seq alignment tool.⁶¹ Reads were used for subsequent analysis if they mapped to a single genomic location, and gene counts were compiled using FeatureCounts.⁶² Normalization and differential expression were carried out using the DESeq2 Bioconductor package⁶³ in the R statistical programming environment. RNA sequencing raw and processed data have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus (GEO) under accession number GSE289452. Differential expression of H69 cells with or without ABL inhibition was imported into the Gene Set Enrichment analysis (GSEA) software tool from the Broad Institute.⁶⁴

Cell viability assay

SCLC cells (1500–3000) were plated in clear bottom 96-well plates in quadruplicates and treated with vehicle DMSO, ABL inhibitors GNF5, ABL001 or GMB475, using a concentration dose range as indicated. For combination treatment, indicated SCLC cells were treated with ABL inhibitors alone, ATR inhibitor M6620 alone, or in combination. Viability was assessed using Cell-Titer-Glo reagent (Promega). Plates were read on a Tecan Infinite M1000 Microplate Reader and results were analyzed in GraphPad Prism Ver.10 software.

Immunoblotting assay

Cells were lysed in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% SDS, 10% Sodium Deoxycholate) plus 1× protease inhibitor cocktail (Cell Signaling Tech). Cell debris was removed by microcentrifugation, and protein concentration was quantified using the DC Protein Assay (Bio-Rad Laboratories). Equal amounts of protein per sample were analyzed by SDS/PAGE (Bio-Rad) and transferred onto 0.2 μm nitrocellulose membranes (Amersham) using the Transblot Turbo Transfer system (Bio-Rad). The membranes were blocked in 5% milk for 1 h followed by incubation with primary antibodies at 4°C in the dilution recommended by the manufacturer at 4°C overnight followed by incubation with corresponding secondary antibody for 1 h at room temperature. Blots were developed using SuperSignal West PLUS-Chemiluminescent Substrate developing solution (Invitrogen #34580) or WesternBright Sirius kit (Advansta #K-12043-D20) using either High performance chemiluminescence (Cytiva #28906839) or CL-X Posure (Thermo Scitific #34091) films.

Antibodies used for immunoblot analysis were: ABL1 (BD Pharmingen 554148, 1:500), ABL2 (Novus Biologicals H00000027-M03, 1:1000), Phospho-CrkL (Tyr207) (CST #31811:1000), RAD51 (CST #8875, 1:1000), phospho-RAD51 (Tyr315) (ThermoFisher #PA5–38699, 1:500), RAD52 (Proteintech 28045–1-AP, 1:1000), phospho-RAD52 (Y104) (Thermo Fisher PA5–105172, 1:500; Sigma SAB4504265, 1:500). Phospho-Histone H2AX (Ser139) (CST 9718, 1:1000), H2AX (CST 7631, 1:1000), cleaved PARP (CST 5625, 1:1000), cleaved caspase 3 (CST 9661, 1:500), phospho-Chk1 (S345) (CST 2341, 1:1000), phosphotyrosine (4G10) (Sigma 05–321, 1:1000), beta-Actin (CST 3700, 1:1000), beta-Tubulin (CST 2146, 1:1000), Vinculin (CST 13901, 1:1000). Jackson Immunoresearch: Peroxidase AffiniPure Goat anti-Rabbit IgG (H + L) (#111–035-003), Peroxidase AffiniPure Goat anti-Mouse IgG (H + L) (#115–035-003), both used 1:5000.

Proximity ligation assay

Proximity ligation assay was performed using the Duolink In Situ PLA kit (Sigma-Aldrich) following the manufacturer’s protocol. After drug or IR treatment, cells were fixed with 4% paraformaldehyde solution (Thermo Fisher; J61889.AP) for 15 min at room temperature, then washed 3× with PBS. For RNase H digestion, cells were incubated with RNase H1 (New England Biolabs; M0297S) at a 1:50 dilution in 1× RNase H1 buffer for 3 h at 37°C, then washed in low salt buffer (50mM Tris-HCl, 75 mM NaCl, 0.1% BSA, pH 7.5, in water). Cells were incubated with RNase T1 (Thermo Fisher; EN0541; 1:200 dilution) and RNase III (New England Biolabs #M0245S; 5U per sample) enzymatic digests. Cells were then blocked for 1 h at 37°C. For S9.6-PCNA PLA, the S9.6 (Mouse; Millipore Sigma; MABE1095) and the anti-PCNA (Rabbit; Abcam; ab18197) primary antibodies were diluted 1:500 in Duolink antibody diluent and cells were incubated for 1 h at room temperature or at 4°C overnight. For the RNAPIIpSer2-PCNA PLA, the anti-RNA polymerase II phospho-Ser2 (Rabbit; Novus Biologicals; NB100–1805) and anti-PCNA (Mouse; Sigma-Aldrich; NA03) primary antibodies were diluted 1:500 in Duolink antibody diluent and cells were incubated for 1 h at room temperature or at 4°C overnight. Following 3× washes with PBS, cells were incubated with diluted PLA probes (anti-rabbit/anti-mouse) at 37°C for 1 h. Cells were washed 2× with room temperature wash buffer A, then incubated with the ligation mix for 30 min. Following 2× washes with wash buffer A, cells were incubated in amplification mix for 100 min at 37°C. Finally, cells were washed 2× with prewarmed wash buffer B and 1× with 1:100 wash buffer B diluted in molecular biology-grade water. Afterward, cells were mounted with Duolink In Situ mounting medium with DAPI (Sigma-Aldrich; DUO82040). Samples were imaged on the Leica Stellaris SP8 confocal microscope (Grant #NIH S10: 1S10OD034340–01A1) using the 40× oil lens. For imaging, each z stack consisted of 25 images with an approximate step size of 0.6 μm (15 μm total distance), which spanned the thickness of the cells. Images were then analyzed using FIJI (version 1.54p).⁶⁵

DNA fiber assay

DMS53 cells (0.7 million) were seeded on 6-well plates, treated with ABL001 (20μM) for 24 h, or GMB475 (10 μM) for 2, 16 and 24 h, or GMB475 (5 μM, 10 μM and 20 μM) for 48 h. For combination treatment, GMB475 (5 μM) for 24 h, M6620 (1 μM) during the last 30 min. For ABL-knockdown experiments, cells expressed control shRNA (shSCR) or dual targeting ABL1/ABL2 shRNA (shAA) for 5 days. After treatment, cells were sequentially exposed to thymidine analogues 5-Chloro-2’-deoxyuridine (CldU 50 μM) (Sigma, cat# C6891) for 20 min followed by iododeoxyuridine (IdU 100 μM) (Sigma I7125) for 20min. For hydroxyurea (HU) experiment, both CldU (50 μM) and IdU (100 μM) were used for 30 min each. HU was added to the cells (2 mM) during IdU labeling. Cells were suspended in PBS (~200 cell/mL) and 6 μl of suspension were spotted onto a glass slide and allowed to dry. Cells were then lysed on glass slides using spreading buffer (0.5% SDS, 200 mM Tris-HCl pH 7.4, 50 mM EDTA) for 3–5 min and the lysate was allowed to drop down slowly through the glass slide forming a trail. The DNA on slides was air-dried, fixed in methanol-acetic acid (3:1) for 10 min. Fixed DNA was denatured with 2.5 N HCl for 1 h at room temperature (RT). Then the slides were washed with PBS and blocked in PBS-T (PBS +0.1% Tween 20) containing 2% BSA for 30 min at RT in a humid chamber. This was followed by staining for CldU with rat anti-BrdU (Abcam, ab6326) and for IdU with mouse anti-BrdU (BD Biosciences, Cat# 347580). Then the slides were washed and re-incubated with respective secondary antibodies Alexa Fluor 594-conjugated anti-rat secondary antibody (Thermo Fisher scientific, A-11007) and Alexa Fluor 488-conjugated anti-mouse secondary antibody (Thermo Fisher scientific, A-11001). Finally, the slides were mounted and subjected to microscopy using 40× oil objective (Carl Zeiss AG). Number of fibers counted per sample n = 50.

Double-strand break (DSB) repair assay

The Tet-DR-GFP HR reporter plasmid²³ was stably expressed in U2OS cells under neomycin selection. Cells (5 × 10⁵) were seeded without antibiotics on 6 cm plates. For each plate, 5 μg of I-SceI-T2A-mCherry plasmid²³ was used for transfection with Fugene HD transfection reagent (Promega #E2311) according to the manufacturer’s instructions. Eight hours after transfection, cells were trypsinized and plated onto two 6 cm plates. Cells were treated with or without 1 μg/mL Dox in the presence or absence of ABL inhibitors, ABL001 (20 μM) or GMB475 (10 μM) for 60 h. Cells were then subjected to FACS analysis (Fortessa analyzer, Duke cancer center flow cytometry core), to determine both I-SceI-mCherry plasmid transfection and Dox-induced HR efficiencies. The percentage of both mCherry- and GFP-positive cells over mCherry-single positive cells was plotted.

Transient transfection and immunoprecipitation

HEK293T cells were transfected with indicated DNAs using Lipofectamine 2000 (Invitrogen, 11668–027) according to the manufacturer’s instructions. After 24 h, cells were lysed in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% SDS, 10% Sodium Deoxycholate) plus 1× protease inhibitor cocktail (Cell Signaling Tech). Lysates were incubated for 30 min on ice and then cleared by spinning at 15,000 rpm for 15 min. Protein concentration was quantified using the DC Protein Assay (BIO-RAD Laboratories). Lysates were incubated with anti-Flag M2 magnetic beads (Sigma, M8823), anti-GFP (CST, 55494), anti-RAD51 (Abcam ab133534), or anti-RAD52 (Proteintech28045–1-AP) antibodies overnight at 4°C. For endogenous IP, H69 SCLC cells were treated with ABL001 (20 μM) for various times as indicated. Cells were lysed in NP-Lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP40) plus 1× protease inhibitor cocktail. Total cell lysates were incubated with anti-RAD51 (Abcam, ab133534) or anti-RAD52 (Proteintech, 28045–1-AP) antibodies overnight at 4°C. For pull down assays, the protein A/G PLUS- agarose beads (Santa Cruz) were added for another 4 h in 4°C. Beads were washed five times with either RIPA or NP buffer. Bound proteins were eluted with 4× Laemmli Sample Buffer (Bio-Rad) and heated 100°C for 5 min. IP products and total lysates were visualized with immunoblot analysis.

Mutagenesis and cloning

To generate RAD52-Y104F, the GFP-C1-RAD52-WT plasmid (gift from Dr. Li Lan) was mutated by site-directed mutagenesis using Q5 polymerase (NEB Cat# M0492) (primers F: 5’-TGTGCATTTGTGAGGGTCC-3’, R: 5’-GACTCCCACGAAGAACTTGCC-3’). The linearized vector was phosphorylated using T4 Polynucleotide Kinase (NEB Cat# M0201) then ligated using T4 ligase (NEB Cat# M0202) and transformed into Stbl3 E. Coli (Thermofisher Cat# C737303; Zymo Research Cat# T3001).

The RAD52-WT and RAD52-Y104F plasmids were subcloned in the N174-MCS-Puro vector (gift from Dr. Adam Karpf, Addgene Cat# 81068) by PCR restriction cloning. The RAD52 coding sequences were PCR amplified (primers F: 5’-TCATCGTCTCTAATTCGCCACCATGGTGAG-3’, R: 5’-AGTACGTCTCAGGCCTCTACAAATGTGGTATGGC-3’), gel purified and then restriction digested using Esp3I and DpnI (Thermofisher Cat# ER045, NEB Cat# R0176). The N174-MCS-Puro vector was restriction-digested using EcoRI and NotI (NEB Cat# R3101, R3189) and dephosphorylated using Quick CIP (NEB Cat# M0525), then gel purified. The resulting digested RAD52 PCR products and N174-MCS-Puro vector were ligated using T4 ligase (NEB Cat# M0202) and transformed into Stbl3 E. Coli (Thermofisher Cat# C737303; Zymo Research Cat# T3001). All cloning products from mutagenesis and sub-cloning were sequence-verified using Plasmidsaurus Inc. whole plasmid sequencing.

To generate shRNA resistant ABL1-WT and ABL1-K290R, the human hu-ABL1 CDS was obtained from Sino Biological (Cat# HG11199-ACGLN). ABL1(K290R) kinase dead mutation was introduced by inverse PCR mutagenesis (primers F: 5’-CGAACCTTGAAGGAGGACACC-3’, R: 5’-CACGGCCACCGTCAG-3’), using NEB High-Fidelity 2× Master Mix (Cat# M0492) to introduce a missense mutation and linearize the plasmid. The linear plasmid was then ligated using NEB T4 Polynucleotide Kinase (Cat# M0201), NEB T4 Ligase (Cat# M0202), and NEB DpnI (Cat# R0176). shRNA-resistant ABL1 was generated by replacing the homologous sequence to the ABL1 shRNA contained within the CDS with one containing numerous missense mutations. To this end, inverse primers were designed to exclude the homologous region and to introduce flanking PaqCI restriction sites (primers F: 5’- TCATCACCTGCAGAAGGACTACCGCATGGAGC-3’, R: 5’- TCATCACCTGCCACCTGGGACAGGTCAATTC-3’). The shRNA-resistant missense sequence was synthesized as oligos with flanking 4bp overhangs compatible with the overhangs produced by PaqCI digest. Inverse PCR was performed using NEB High-Fidelity 2× Master Mix (Cat# M0492), followed by restriction digestion with NEB PaqCI (Cat# R0745) and dephosphorylation with NEB rSAP (Cat# M0371). Oligos (primer F: 5’- CCCAAgtC taCgaActActGgaAaa-3’, R: 5’-GTCCttTtcCagTagTtcGtaGacT-3’) were hybridized and phosphorylated with NEB T4 Polynucleotide Kinase (Cat# M0201) before ligation into the digested vector PCR product with NEB T4 Ligase (Cat# M0202). shRNA resistant ABL1 plasmids were first transferred into a pcDNA3-HA-clover mammalian expression plasmid (Addgene Cat# 163366) by PCR (primers F: 5’-TAAGCAGGCGCGCCAGGATCCATGGTGAGCAAGGG-3’, R: 5’-TGCTTAACCGGTGCTTGGGTCTCCCTATAGTG-3’), then restriction digest cloning. Primers were designed for both the vector and ABL1 insert PCRs to introduce complementary AgeI and AscI restriction sites (primers F: 5’-TAAGCAACCGGTATGGGGCAACAACCTGG-3’, R: 5’-TGCTTAGGCGCGCCCCTCTGCACTATGTCACTGATTTC-3’). PCR was performed using NEB High-Fidelity 2× Master Mix (Cat# M0492), followed by restriction digestion with NEB AscI (Cat# R0558) and NEB AgeI-HF (Cat# R3552). Digested vector and insert fragments were ligated together with NEB T4 Ligase (Cat# M0202).

To generate lentiviral plasmids with shRNA-resistant human hu-ABL1-Clover and hu-ABL1(K290R)-Clover constructs, pcDNA3-huABL1-Clover plasmids were PCR amplified flanking existing EcoRI and NotI restriction sites using NEB High-Fidelity 2× Master Mix (Cat# M0492), with lentiviral transfer insert primers (primers F: 5’-tcatgaattCCGGTATGGGGCAAC-3’, R: 5’-ctagaaggca cagtcgagg-3’). The lentiviral vector, N174-MCS (Addgene Cat# 81061), and the PCR-amplified huABL1-Clover fragments were digested with NEB EcoRI-HF (Cat# R3101) and NotI-HF (Cat# R3189), then ligated with NEB T4 Ligase (Cat# M0202). All cloning was followed by transformation into One Shot Stbl3 chemically competent E. coli (ThermoFisher, Cat# C737303) and antibiotic selection.

DNA plasmids

pReceiver-M35 (GeneCopoeia, Cat# Ex-B0087-M35), pReceiver-Lv203 (RAD51-WT, GeneCopoeia, Cat# Ex-B0087-Lv203), CS-B0087-Lv203–01 (RAD51-Y315F, GeneCopoeia). pEGFP-C1-RAD52 was used for mutagenesis to generate RAD52 Y104F mutant. Both RAD52-WT and RAD52 Y104F mutant DNAs were then cloned into the pN174 lentiviral vector. The pN1-GFP-ABL-WT, pN1-GFP-ABL-KM (K790M) and pN1-GFP-ABL-PP mutant plasmids were previously generated.¹⁷ Sequences for shRNA targeting the RAD51–3UTR (TRCN0000018875, CTAAGACTAACTCAAGATAA) were obtained through the Duke Functional Genomics Shared Resource Facility. Sequences for shRNA targeting the RAD52–3UTR were obtained from Sigma Mission (Cat# Shclnd, TRCN0000271415, ATGAACGTCATTGCGATTTAT). All lentiviral packaging DNAs pMDL, pCMV-VSVG pRSV-REV and pFU-luciferase-tomato were described previously.¹³

Lentiviral transduction

Lentiviral plasmids pReceiver-Lv203-Flag-RAD51-WT, CS-B0087-Lv203-Flag-RAD51-Y315F, pN174 GFP-RAD52-WT and pN174-GFP-RAD52-Y104F were packaged in third generation lentiviral packaging vectors (pMDL, pCMV-VSVG, pRSV-REV). 293T cells were transfected with packaging DNAs and corresponding lentiviral DNAs using FuGENE6 reagent (Promega, E2692). Culture supernatants containing virus were harvested and filtered 48 and 72 h after transfection and were added to SCLC cell cultures in the presence of 10 μg/mL polybrene (Sigma-Aldrich). Stable-transfected GFP-RAD52 cells were subjected with FACS sorting by Astrios Sorter or Sony SH800 sorter (Duke Cancer Center flow cytometry core). RAD51-WT and RAD51-Y315F mutant plasmids express GFP, which is not linked to RAD51, and is used for FACS sorting. To generate shRNAs in the pLKO.1-puro backbone, shRNAs targeting the RAD51-UTR and RAD52-UTR sequences were packaged in the DNAs indicated above. pLKO.1 vector was used as control. Cells were used 7–14 days after transduction. To generate stable ER-AsiSI expression in DMS53 cells, the cells were transduced with ER-AsiSI lentiviral DNA³⁹ described above, and subjected to puromycin selection.

Lentiviral plasmids pN174-huABL1(shRNA_Res)-WT-HA-Clover-Neo and pN174-huABL1(shRNA_Res)-K290R-HA-Clover-Neo were packaged in second generation lentiviral packaging vectors (psPAX2 and pMD2.G). Transfection into 293T cells and harvesting virus-containing supernatant was as described above. Stable-transfected ABL1-Clover cells were subject to antibiotic selection and sorted. These cells were then subjected to dual ABL1/ABL2 knockdown as described.¹² Cells were used 5 days after transduction with ABL knockdown vectors.

DNA damage induction with endonuclease AsiSI

The ER-AsiSI (pTP5310) DNA vas kindly provided by Dr. Tanya Paull.³⁹ Expression of AsiSI endonuclease was induced by Tamoxifen (Sigma, H7904). DMS53 cells were transduced with viruses containing ER-AsiSI generated from transfected 293T cells, and following lentiviral transduction, DMS53 cells were selected in puromycin. To induce site-specific DNA damage, cells were treated with Tamoxifen (300 nM) for 1 h. Immunofluorescence staining showed strong induction of γH2AX expression.

Kaplan-meier analysis

Lung cancer patient microarray data were analyzed using the KM plot analysis tool (kmplot.com).⁶⁶ Affymetrix identifiers for RAD51 is 205024_s_at, and RAD52 is 211904_x_at. Patients were stratified by Median into high and low expressions.

Real-time quantitative PCR

H69 SCLC cells were treated with GNF5 (20 μM), ABL001 (20 μM) and GMB475 (10 μM) for 24 h. RNA was isolated using the RNeasy RNA isolation kit (QIAGEN) and cDNA synthesis was performed using oligo (dT) primers and M-MLV reverse transcriptase (Thermo Fisher). RT-qPCR was performed in triplicate wells using iTaq Universal SYBR Green Supermix (Bio-Rad). Primers used in this study were purchased from Sigma Aldrich and are listed in Source table. Analysis of real-time data was collected using a Bio-Rad CFX384 machine and CFX Maestro software. Expression levels of each gene were normalized to 18S control housekeeping genes using the ddCT algorithm.

Immunofluorescence and confocal microscopy

For irradiation experiments, cells (2 × 10⁵) were plated on 18 mm glass coverslips in 12-well plate for 24h and were then exposed to IR-4Gy. Three hours after IR, cells were fixed in 4% PFA for 15 min and permeabilized with Perm Buffer (3% BSA, 0.1% TX100 and 0.05% NaAz) for 15 min followed blocking in Blocking buffer (3% BSA, 5% normal goat serum, 0.1% TX100 and 0.05% NaAz) for 1 h at room temperature. Primary antibodies were diluted in blocking buffer, incubated at 4°C overnight. After washing in 1× PBS, Alexa Fluor-coupled secondary antibodies were diluted (1:250) in blocking buffer at room temperature for 1 h. Primary antibodies used were anti-γH2AX (CST #9718 diluted 1:200 in blocking buffer), anti-RAD51 (ab133534, 1:1000 in blocking buffer). For RAD52 immunofluorescence, GFP-RAD52 was directly visualized under confocal microscope. After washing, coverslips were mounted onto Microscope slides using Prolong Gold antifade reagent with DAPI (Invitrogen Cat# P36941). Cells were imaged on Leica Stellaris SP8 confocal microscope using 40× oil lens. For γH2AX immunofluorescence, DMS53 cells were treated with DMSO or GMB475, or cells expressing control shRNA (shSCR) or dual targeting ABL1/ABL2 shRNA (shAA). The same anti-γH2AX primary antibody as mentioned above was used in both experiments, along with the same protocol from 4% PFA fixation through imaging.

Ionizing radiation experiments

Cells in vitro were irradiated with the Xstrahl CIX3 320kV irradiator, which was operated at 10 mA producing 3.598 cGy/s. Cells were either sham irradiated (0 Gy) or received a single dose of 4 Gy. Sham irradiated samples were removed from tissue culture incubators for the same duration as irradiated samples, and then processed for imaging.

QUANTIFICATION AND STATISTICAL ANALYSIS

All statistical analyses are included in the figure legends, including the statistical test conducted, the number of replicates, the value of n, and the definition of n in each experiment. Statistical tests, which includes Student’s t test, one-way ANOVA, two-way ANOVA, and Log Rank (Mantel-Cox) test were performed using GraphPad Prism 10 software. Unless otherwise specified, the data are represented as mean ± SEM. p < 0.05 indicated statistical significance.

Supplementary Material

NIHMS2199975-supplement-1.pdf^{(1.9MB, pdf)}

NIHMS2199975-supplement-2.xlsx^{(9.8KB, xlsx)}

Supplementary data related to this article can be found online at https://doi.org/10.1016/j.celrep.2026.117699.

KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER

Antibodies

RAD51 (D4B10)	Cell Signaling	Cat# 8875; RRID:AB_2721109
RAD51	Abcam	Cat# ab133534; RRID:AB_2722613
Phospho-RAD51 (Tyr315)	Thermo Fisher Scientific	Cat# PA5-38699; RRID: AB_2555293
ABL1 (8E9)	BD Pharmingen	Cat# 554148; RRID:AB_2220994
CrkL (B-1)	Santa Cruz	Cat# sc-365092; RRID:AB_10847682
Phospho-CrkL (Tyr207)	Cell Signaling Technology	Cat# 3181; RRID:AB_331068
ABL2 (6D5)	Novus Biologicals	Cat# H00000027-M03; RRID: AB_828506
RAD52	Proteintech	Cat# 28045-1-AP; RRID:AB_2881046
Phospho-RAD52 (Tyr104)	Thermo Fisher Scientific	Cat# PA5-105172; RRID:AB_2816645
Phospho-RAD52 (Tyr104)	Sigma	Cat# SAB4504265
Phospho-Histone H2A.X (Ser139) (20E3)	Cell Signaling Technology	Cat# 9718; RRID:AB_2118009
Histone H2A.X (D17A3)	Cell Signaling Technology	Cat# 7631; RRID:AB_10860771
Vinculin (E1E9V)	Cell Signaling Technology	Cat# 13901; RRID:AB_2728768
Beta-Tubulin	Cell Signaling Technology	Cat# 2146; RRID:AB_2210545
Beta-Actin (8H10D10)	Cell Signaling Technology	Cat# 3700; RRID: AB_2242334
Cleaved PARP (Asp214) (D64E10)	Cell Signaling Technology	Cat# 5625; RRID: AB_10699459
Cleaved Caspase 3 (Asp175)	Cell Signaling Technology	Cat# 9661; RRID: AB_2341188
Chk1	Cell Signaling Technology	Cat# 2360; RRID:AB_2080320
Phosphor-Chk1 (S345)	Cell Signaling Technology	Cat# 2341; RRID: AB_330023
Phosphotyrosine (4G10)	Millipore Sigma	Cat# 05-321; RRID: AB_309678
Anti-BrdU (Rat)	Abcam	Cat# ab6326; RRID:AB_305426
Anti-BrdU (Mouse)	BD Biosciences	Cat# 347580; RRID:AB_10015219
GFP (5G4)	Cell Signaling	Cat# 55494; RRID: AB_3101977
FLAG (M2)-magnetic beads	Millipore Sigma	Cat#F8823; RRID:AB_2637089
S9.6	Millipore Sigma	Cat# MABE1095; RRID: AB_2861387
PCNA (Rabbit)	Abcam	Cat# ab18197; RRID: AB_444313
PCNA (Mouse)	Millipore Sigma	Cat# NA03; RRID: AB_2160355
RNA Polymerase II/POL2RA pSer2	Novus Biologicals	Cat# NB100-1805; RRID: AB_10001499
Peroxidase AffiniPure Goat Anti-Rabbit IgG (H + L)	Jackson Immunoresearch	Cat#111-035-003; RRID:AB_2313567
Peroxidase AffiniPure Goat Anti-Mouse IgG (H + L)	Jackson Immunoresearch	Cat# 115-035-003; RRID:AB_10015289
Alexa Fluor-488-goat anti-Mouse IgG (H + L) antibody	Thermo Fisher Invitrogen	Cat# A11001; RRID: AB_2534069
Alexa Fluor-568-goat anti-Rabbit IgG (H + L) antibody	Thermo Fisher Invitrogen	Cat# A11011; RRID: AB_143157
Alexa Fluor-594-goat anti-Rat-IgG	Thermo Fisher Invitrogen	Cat# A11007; RRID:AB_141374
Alexa Fluor 647-goat anti-Rabbit IgG (H + L) antibody	Thermo Fisher Invitrogen	Cat# A21244; RRID: AB_2535812

Chemicals, Peptides, and Recombinant Proteins

GNF-5 (Abl kinase small molecule inhibitor)	Duke Small Molecule Synthesis Facility	N/A
ABL001 (Asciminib)	Duke Small Molecule Synthesis Facility	N/A
Berzosertib (VE-822, VX970, M6620)	Selleckchem	Cat# 7102
DRB (5,6-Dichloro-1-β-D-ribofuranosylbenzimidazole	Sigma	Cat# 287891
Doxycycline Hyclate	Millipore Sigma	Cat# D5207
Fugene 6	Promega	Cat# E2692
Fugene HD	Promega	Cat# E2311
Lipofectamine 2000	Invitrogen	Cat# 1668-027
5-Chloro-2'-deoxyuridine (CldU)	Sigma	Cat# C6891
Iododeoxyuridine (IdU)	Sigma	Cat# I7125
D-Luciferin potassium	Thermo Fisher	L2916
Isoflurane	Duke CCIF pharmacy (Covetrus)	NDC: 11695-6777-2
Protein A/G plus-agarose	Sanat Cruz Biotechnology	Cat# sc-2003
Polybrene	Sigma	Cat# TR-1003-G
RNase H1	New England Biolabs	Cat# M0297S
RNase III	New England Biolabs	Cat# M0245S
RNase T1	Thermo Fisher	Cat# EN0541
Tamoxifen	Sigma	Cat# T2859
Hydroxyurea	Sigma	Cat# H8627
High-Fidelity 2× Master Mix Q5 polymerase	New England Biolabs	Cat# M0492
T4 Polynucleotide Kinase	New England Biolabs	Cat# M0201
T4 ligase	New England Biolabs	Cat# M0202
DpnI	New England Biolabs	Cat# R0176
PaqCI	New England Biolabs	Cat# R0745
Quick CIP	New England Biolabs	Cat# M0525
rSAP	New England Biolabs	Cat# R0745
AscI	New England Biolabs	Cat# R0558
AgeI-HF	New England Biolabs	Cat# R3552
EcoRI-HF	New England Biolabs	Cat# R3101
NotI-HF	New England Biolabs	Cat# R3189
Stbl3 E. Coli	Thermo Fisher	Cat# C737303
Mix & Go! E.coli Transformation kit	Zymo Research	Cat# T3001
Oligo dT	Thermo Fisher	Cat# 18418012
M-MLV	Thermo Fisher	Cat# 28025013
RNaseOut	Thermo Fisher	Cat# 10777019
iTaq Universal SYBR	Bio-Rad	Cat# 1725121
Mounting medium for IF	Invitrogen	Cat# P36941
Matrigel	Corning	Cat# CB-40234A

Critical Commercial Assays

Cell Titer Glo	Promega	Cat# G7571
RNeasy RNA purification kit	Qiagen	Cat# 74104
4% paraformaldehyde solution	Thermo Fisher	Cat# J61889, AP
Duolink^® In Situ Red Starter Kit Mouse/Rabbit	Sigma-Aldrich	Cat# DUO92101
Duolink^® In Situ PLA^® Probe Anti-Mouse PLUS	Sigma-Aldrich	Cat# DUO92001
Duolink^® In Situ PLA^® Probe Anti-Mouse MINUS	Sigma-Aldrich	Cat# DUO92004
Duolink^® In Situ PLA^® Probe Anti-Rabbit PLUS	Sigma-Aldrich	Cat# DUO92002
Duolink^® In Situ PLA^® Probe Anti-Rabbit MINUS	Sigma-Aldrich	Cat# DUO92005
Duolink^® In Situ Wash Buffers, Fluorescence	Sigma-Aldrich	Cat# DUO82049
Duolink In Situ mounting medium with DAPI	Sigma-Aldrich	Cat# DUO82040
Duolink Antibody Diluent (1×)	Sigma-Aldrich	Cat# DUO82008

Deposited Data

H69 control versus GNF5 treated cells RNA-seq	This paper	GEO: GSE289452

Experimental Models: Cell Lines

NCI-H69	ATCC/Duke University Cell Culture Facility	Cat# HTB-119; RRID: CVCL_1579
NCI-H146	ATCC/Duke University Cell Culture Facility	Cat# HTB-173; RRID: CVCL_1473
NCI-H2171	ATCC/Duke University Cell Culture Facility	CAT# CRL-5929; RRID: CVCL_1536
NCI-H1048	ATCC/Duke University Cell Culture Facility	CAT# CRL-5853; RRID: CVCL_1453
NCI-H82	ATCC/Duke University Cell Culture Facility	CAT# HTP-175; RRID: CVCL_1591
DMS53	ATCC/Duke University Cell Culture Facility	Cat# CRL-2062; RRID: CVCL_1177
U2OS	ATCC	Cat# HTB-96; RRID: CVCL_0042
HEK-293T	ATCC	Cat# CRL-3216; RRID: CVCL_0063

Experimental Models: Organisms/Strains

Outbred athymic nu/nu mice	Jackson Laboratory	Cat#007850, RRID: IMSR_JAX:007850

Oligonucleotides

See Table S2 for a list of all primers and oligonucleotides

Recombinant DNA

pReceiver-M35	GeneCopoeia	Cat# EX-B0087-M35
pReceiver-Lv203 (RAD51-WT)	GeneCopoeia	Cat# EX-B0087-Lv203
CS-B0087-Lv203-01 (RAD51-Y315F)	GeneCopoeia	Cat# CS-B0087-Lv203-01
pEGFP-C1-RAD52 (WT)	a gift from the lab of Dr. Li Lan	N/A
pEGFP-C1-RAD52 (Y104F)	This paper	N/A
N174-MCS-Puro vector	a gift from the lab of Dr. Adam Karpf	Addgene Cat# 81068
N174-GFP-RAD52(WT)	This paper	N/A
N174-GFP-RAD52(Y104F)	This paper	N/A
N174-huABL1(shRNA_Res)-WT-HA-Clover-Neo	This paper	N/A
N174-huABL1(shRNA_Res)-K290R-HA-Clover-Neo	This paper	N/A
pN1-EGFP Vector	This Lab	N/A
pN1-EGFP-mABL-WT	This Lab	N/A
pN1-EGFP-mABL-PP (PPEE)	This Lab	N/A
pN1-EGFP-mABL-KM (K790M)	This Lab	N/A
pLKO-puro shRAD51 (UTR)	Duke Functional Genomics Shared Resource Facility	TRCN0000018875
pLKO-puro shRAD52 (UTR)	Sigma Mission (Shclnd)	TRCN0000271415
ER-AsiSI	Tanya T. Paull 2014 paper	-
pCDNA-ABL1 PP	(Plattner et al., 2004)	N/A

Software and Algorithms

Prism 9	Graphpad	http://graphpad.com/scientific-software/prism
ImageJ	Schneider et al., 2012	http://imagej.nih.gov
Living Image	Perkin Elmer	http://perkinelmer.com
Flowjo Portal	-	https//flowjo.com.portal
Kaplan-Meier plot	-	https://doi.org/10.1111/bph.16257
GSEA 3.0	Subramanian et al., 2005	http://software.broadinstitute.org/gsea

Open in a new tab

Highlights.

ABL inhibition elicits the downregulation of DNA repair and replication pathways in SCLC
ABL inactivation increases TRCs, compromises replication forks, and enhances DNA damage
ABL phosphorylation of RAD52 and RAD51 protects SCLC cells from TRCs
Co-inhibition of ABL and ATR synergistically inhibits SCLC cell growth in vitro and in mice

ACKNOWLEDGMENTS

We thank the Duke Flow Cytometry Shared Resource for assistance with cell sorting and analysis, and the Duke Light Microscopy Core Facility for imaging advice. We thank Tatiana Prioleau, Duke University, for the preparation of diagram illustrations. We also thank Arianna Towne, Duke University, for computational expertise. This work was supported by NIH grant R01CA246133 (A.M.P.), NIH grant 1R01CA318002 (A.M.P. and L.L.), Lung Cancer Research Foundation grant (A.M.P.), F31CA290817 (R.H.B.), F31CA301550–01 (M.W.C.), F30CA301871–01 (M.W.B.), NIH grant R01CA282939 (L.L.), and NIH grant R35CA263934 (L.Z.). This project was made possible in part through funding from the Duke Cancer Institute Cancer Center Support grant P30CA014236 (A.M.P.), and NIH S10 grant award #1S10OD034340–01A1 for the confocal microscopy used for imaging data collection.

Footnotes

DECLARATION OF INTERESTS

The authors declare no competing interests.

REFERENCES

1.Rudin CM, Brambilla E, Faivre-Finn C, and Sage J (2021). Small-cell lung cancer. Nat. Rev. Dis. Primers 7, 3. 10.1038/s41572-020-00235-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Ko J, Winslow MM, and Sage J (2021). Mechanisms of small cell lung cancer metastasis. EMBO Mol. Med. 13, e13122. 10.15252/emmm.202013122. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Saltos A, Shafique M, and Chiappori A (2020). Update on the Biology, Management, and Treatment of Small Cell Lung Cancer (SCLC). Front. Oncol. 10, 1074. 10.3389/fonc.2020.01074. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Rudin CM, Poirier JT, Byers LA, Dive C, Dowlati A, George J, Heymach JV, Johnson JE, Lehman JM, MacPherson D, et al. (2019). Molecular subtypes of small cell lung cancer: a synthesis of human and mouse model data. Nat. Rev. Cancer 19, 289–297. 10.1038/s41568-019-0133-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Sutherland KD, Ireland AS, and Oliver TG (2022). Killing SCLC: insights into how to target a shapeshifting tumor. Genes Dev. 36, 241–258. 10.1101/gad.349359.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Gay CM, Stewart CA, Park EM, Diao L, Groves SM, Heeke S, Nabet BY, Fujimoto J, Solis LM, Lu W, et al. (2021). Patterns of transcription factor programs and immune pathway activation define four major subtypes of SCLC with distinct therapeutic vulnerabilities. Cancer Cell 39, 346–360.e7. 10.1016/j.ccell.2020.12.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Nabet BY, Hamidi H, Lee MC, Banchereau R, Morris S, Adler L, Gayevskiy V, Elhossiny AM, Srivastava MK, Patil NS, et al. (2024). Immune heterogeneity in small-cell lung cancer and vulnerability to immune checkpoint blockade. Cancer Cell 42, 429–443.e4. 10.1016/j.ccell.2024.01.010. [DOI] [PubMed] [Google Scholar]
8.Thomas A, and Pommier Y (2016). Small cell lung cancer: Time to revisit DNA-damaging chemotherapy. Sci. Transl. Med. 8, 346fs12. 10.1126/scitranslmed.aaf6282. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Petermann E, Lan L, and Zou L (2022). Sources, resolution and physiological relevance of R-loops and RNA-DNA hybrids. Nat. Rev. Mol. Cell Biol. 23, 521–540. 10.1038/s41580-022-00474-x. [DOI] [PubMed] [Google Scholar]
10.García-Muse T, and Aguilera A (2016). Transcription-replication conflicts: how they occur and how they are resolved. Nat. Rev. Mol. Cell Biol. 17, 553–563. 10.1038/nrm.2016.88. [DOI] [PubMed] [Google Scholar]
11.Lalonde M, Trauner M, Werner M, and Hamperl S (2021). Consequences and Resolution of Transcription-Replication Conflicts. Life 11, 637. 10.3390/life11070637. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Gu JJ, Rouse C, Xu X, Wang J, Onaitis MW, and Pendergast AM (2016). Inactivation of ABL kinases suppresses non-small cell lung cancer metastasis. JCI Insight 1, e89647. 10.1172/jci.insight.89647. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Hoj JP, Mayro B, and Pendergast AM (2019). A TAZ-AXL-ABL2 Feed-Forward Signaling Axis Promotes Lung Adenocarcinoma Brain Metastasis. Cell Rep. 29, 3421–3434.e8. 10.1016/j.celrep.2019.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Luttman JH, Hoj JP, Lin KH, Lin J, Gu JJ, Rouse C, Nichols AG, MacIver NJ, Wood KC, and Pendergast AM (2021). ABL allosteric inhibitors synergize with statins to enhance apoptosis of metastatic lung cancer cells. Cell Rep. 37, 109880. 10.1016/j.celrep.2021.109880. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.McKernan CM, Khatri A, Hannigan M, Child J, Chen Q, Mayro B, Snyder D, Nicchitta CV, and Pendergast AM (2022). ABL kinases regulate translation in HER2+ cells through Y-box-binding protein 1 to facilitate colonization of the brain. Cell Rep. 40, 111268. 10.1016/j.celrep.2022.111268. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Greuber EK, Smith-Pearson P, Wang J, and Pendergast AM (2013). Role of ABL family kinases in cancer: from leukaemia to solid tumours. Nat. Rev. Cancer 13, 559–571. 10.1038/nrc3563. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Mayro B, Hoj JP, Cerda-Smith CG, Hutchinson HM, Caminear MW, Thrash HL, Winter PS, Wardell SE, McDonnell DP, Wu C, et al. (2023). ABL kinases regulate the stabilization of HIF-1alpha and MYC through CPSF1. Proc. Natl. Acad. Sci. USA 120, e2210418120. 10.1073/pnas.2210418120. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Zhu Y, Cui Y, Zheng X, Zhao Y, and Sun G (2022). Small-cell lung cancer brain metastasis: From molecular mechanisms to diagnosis and treatment. Biochim. Biophys. Acta. Mol. Basis Dis. 1868, 166557. 10.1016/j.bbadis.2022.166557. [DOI] [PubMed] [Google Scholar]
19.Khatri A, Gu JJ, McKernan CM, Xu X, and Pendergast AM (2019). ABL kinase inhibition sensitizes primary lung adenocarcinomas to chemotherapy by promoting tumor cell differentiation. Oncotarget 10, 1874–1886. 10.18632/oncotarget.26740. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Burslem GM, Schultz AR, Bondeson DP, Eide CA, Savage Stevens SL, Druker BJ, and Crews CM (2019). Targeting BCR-ABL1 in Chronic Myeloid Leukemia by PROTAC-Mediated Targeted Protein Degradation. Cancer Res. 79, 4744–4753. 10.1158/0008-5472.CAN-19-1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wylie AA, Schoepfer J, Jahnke W, Cowan-Jacob SW, Loo A, Furet P, Marzinzik AL, Pelle X, Donovan J, Zhu W, et al. (2017). The allosteric inhibitor ABL001 enables dual targeting of BCR-ABL1. Nature 543, 733–737. 10.1038/nature21702. [DOI] [PubMed] [Google Scholar]
22.Teng Y, Yadav T, Duan M, Tan J, Xiang Y, Gao B, Xu J, Liang Z, Liu Y, Nakajima S, et al. (2018). ROS-induced R loops trigger a transcription-coupled but BRCA1/2-independent homologous recombination pathway through CSB. Nat. Commun. 9, 4115. 10.1038/s41467-018-06586-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Ouyang J, Yadav T, Zhang JM, Yang H, Rheinbay E, Guo H, Haber DA, Lan L, and Zou L (2021). RNA transcripts stimulate homologous recombination by forming DR-loops. Nature 594, 283–288. 10.1038/s41586-021-03538-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Bhattacharya S, Srinivasan K, Abdisalaam S, Su F, Raj P, Dozmorov I, Mishra R, Wakeland EK, Ghose S, Mukherjee S, and Asaithamby A (2017). RAD51 interconnects between DNA replication, DNA repair and immunity. Nucleic Acids Res. 45, 4590–4605. 10.1093/nar/gkx126. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Wickramasinghe VO, and Venkitaraman AR (2016). RNA Processing and Genome Stability: Cause and Consequence. Mol. Cell 61, 496–505. 10.1016/j.molcel.2016.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Goehring L, Huang TT, and Smith DJ (2023). Transcription-Replication Conflicts as a Source of Genome Instability. Annu. Rev. Genet. 57, 157–179. 10.1146/annurev-genet-080320-031523. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Jalan M, Sharma A, Pei X, Weinhold N, Buechelmaier ES, Zhu Y, Ahmed-Seghir S, Ratnakumar A, Di Bona M, McDermott N, et al. (2024). RAD52 resolves transcription-replication conflicts to mitigate R-loop induced genome instability. Nat. Commun. 15, 7776. 10.1038/s41467-024-51784-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Alagia A, Ketley RF, and Gullerova M (2022). Proximity Ligation Assay for Detection of R-Loop Complexes upon DNA Damage. Methods Mol. Biol. 2528, 289–303. 10.1007/978-1-0716-2477-7_19. [DOI] [PubMed] [Google Scholar]
29.Smolka JA, Sanz LA, Hartono SR, and Chédin F (2021). Recognition of RNA by the S9.6 antibody creates pervasive artifacts when imaging RNA:DNA hybrids. J. Cell Biol. 220, e202004079. 10.1083/jcb.202004079. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Aguilera A, and García-Muse T (2012). R loops: from transcription byproducts to threats to genome stability. Mol. Cell 46, 115–124. 10.1016/j.molcel.2012.04.009. [DOI] [PubMed] [Google Scholar]
31.Leung W, Simoneau A, Saxena S, Jackson J, Patel PS, Limbu M, Vindigni A, and Zou L (2023). ATR protects ongoing and newly assembled DNA replication forks through distinct mechanisms. Cell Rep. 42, 112792. 10.1016/j.celrep.2023.112792. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Quinet A, Carvajal-Maldonado D, Lemacon D, and Vindigni A (2017). DNA Fiber Analysis: Mind the Gap. Methods Enzymol. 591, 55–82. 10.1016/bs.mie.2017.03.019. [DOI] [PubMed] [Google Scholar]
33.Subramanyam S, Ismail M, Bhattacharya I, and Spies M (2016). Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics. Proc. Natl. Acad. Sci. USA 113, E6045–E6054. 10.1073/pnas.1604807113. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Shimizu H, Popova M, Fleury F, Kobayashi M, Hayashi N, Sakane I, Kurumizaka H, Venkitaraman AR, Takahashi M, and Yamamoto K.i. (2009). c-ABL tyrosine kinase stabilizes RAD51 chromatin association. Biochem. Biophys. Res. Commun. 382, 286–291. 10.1016/j.bbrc.2009.03.020. [DOI] [PubMed] [Google Scholar]
35.Slupianek A, Schmutte C, Tombline G, Nieborowska-Skorska M, Hoser G, Nowicki MO, Pierce AJ, Fishel R, and Skorski T (2001). BCR/ABL regulates mammalian RecA homologs, resulting in drug resistance. Mol. Cell 8, 795–806. 10.1016/s1097-2765(01)00357-4. [DOI] [PubMed] [Google Scholar]
36.Kitao H, and Yuan ZM (2002). Regulation of ionizing radiation-induced Rad52 nuclear foci formation by c-Abl-mediated phosphorylation. J. Biol. Chem. 277, 48944–48948. 10.1074/jbc.M208151200. [DOI] [PubMed] [Google Scholar]
37.Liu Y, and Maizels N (2000). Coordinated response of mammalian Rad51 and Rad52 to DNA damage. EMBO Rep. 1, 85–90. 10.1093/embo-reports/kvd002. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Wray J, Liu J, Nickoloff JA, and Shen Z (2008). Distinct RAD51 associations with RAD52 and BCCIP in response to DNA damage and replication stress. Cancer Res. 68, 2699–2707. 10.1158/0008-5472.CAN-07-6505. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Zhou Y, Caron P, Legube G, and Paull TT (2014). Quantitation of DNA double-strand break resection intermediates in human cells. Nucleic Acids Res. 42, e19. 10.1093/nar/gkt1309. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Feu S, Unzueta F, Ercilla A, Pérez-Venteo A, Jaumot M, and Agell N (2022). RAD51 is a druggable target that sustains replication fork progression upon DNA replication stress. PLoS One 17, e0266645. 10.1371/journal.pone.0266645. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Slupianek A, Dasgupta Y, Ren SY, Gurdek E, Donlin M, Nieborowska-Skorska M, Fleury F, and Skorski T (2011). Targeting RAD51 phosphotyrosine-315 to prevent unfaithful recombination repair in BCR-ABL1 leukemia. Blood 118, 1062–1068. 10.1182/blood-2010-09-307256. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Saxena S, and Zou L (2022). Hallmarks of DNA replication stress. Mol. Cell 82, 2298–2314. 10.1016/j.molcel.2022.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Nagel R, Avelar AT, Aben N, Proost N, van de Ven M, van der Vliet J, Cozijnsen M, de Vries H, Wessels LFA, and Berns A (2019). Inhibition of the Replication Stress Response Is a Synthetic Vulnerability in SCLC That Acts Synergistically in Combination with Cisplatin. Mol. Cancer Ther. 18, 762–770. 10.1158/1535-7163.MCT-18-0972. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Thomas A, Takahashi N, Rajapakse VN, Zhang X, Sun Y, Ceribelli M, Wilson KM, Zhang Y, Beck E, Sciuto L, et al. (2021). Therapeutic targeting of ATR yields durable regressions in small cell lung cancers with high replication stress. Cancer Cell 39, 566–579.e7. 10.1016/j.ccell.2021.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Simoneau A, and Zou L (2021). An extending ATR-CHK1 circuitry: the replication stress response and beyond. Curr. Opin. Genet. Dev. 71, 92–98. 10.1016/j.gde.2021.07.003. [DOI] [PubMed] [Google Scholar]
46.Flynn RL, and Zou L (2011). ATR: a master conductor of cellular responses to DNA replication stress. Trends Biochem. Sci. 36, 133–140. 10.1016/j.tibs.2010.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Wang J, Rouse C, Jasper JS, and Pendergast AM (2016). ABL kinases promote breast cancer osteolytic metastasis by modulating tumor-bone interactions through TAZ and STAT5 signaling. Sci. Signal. 9, ra12. 10.1126/scisignal.aad3210. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Er EE, Valiente M, Ganesh K, Zou Y, Agrawal S, Hu J, Griscom B, Rosenblum M, Boire A, Brogi E, et al. (2018). Pericyte-like spreading by disseminated cancer cells activates YAP and MRTF for metastatic colonization. Nat. Cell Biol. 20, 966–978. 10.1038/s41556-018-0138-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Takahashi T, Yamanaka T, Seto T, Harada H, Nokihara H, Saka H, Nishio M, Kaneda H, Takayama K, Ishimoto O, et al. (2017). Prophylactic cranial irradiation versus observation in patients with extensive-disease small-cell lung cancer: a multicentre, randomised, open-label, phase 3 trial. Lancet Oncol. 18, 663–671. 10.1016/S1470-2045(17)30230-9. [DOI] [PubMed] [Google Scholar]
50.Brown PD, Ahluwalia MS, Khan OH, Asher AL, Wefel JS, and Gondi V (2018). Whole-Brain Radiotherapy for Brain Metastases: Evolution or Revolution? J. Clin. Oncol. 36, 483–491. 10.1200/JCO.2017.75.9589. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Takano K, Kinoshita M, Takagaki M, Sakai M, Tateishi S, Achiha T, Hirayama R, Nishino K, Uchida J, Kumagai T, et al. (2016). Different spatial distributions of brain metastases from lung cancer by histological subtype and mutation status of epidermal growth factor receptor. Neuro Oncol. 18, 716–724. 10.1093/neuonc/nov266. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Wang Y, Xia W, Liu B, Zhou L, Ni M, Zhang R, Shen J, Bai Y, Weng G, Yuan S, and Gao X (2021). Exploration of spatial distribution of brain metastasis from small cell lung cancer and identification of metastatic risk level of brain regions: a multicenter, retrospective study. Cancer Imaging 21, 41. 10.1186/s40644-021-00410-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Zhu D, Shao Y, Yang Z, Cheng A, Xi Q, Liang X, and Chu S (2023). Magnetic resonance imaging characteristics of brain metastases in small cell lung cancer. Cancer Med. 12, 15199–15206. 10.1002/cam4.6206. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Burger K, Schlackow M, and Gullerova M (2019). Tyrosine kinase c-Abl couples RNA polymerase II transcription to DNA double-strand breaks. Nucleic Acids Res. 47, 3467–3484. 10.1093/nar/gkz024. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Long Q, Sebesta M, Sedova K, Haluza V, Alagia A, Liu Z, Stefl R, and Gullerova M (2023). The phosphorylated trimeric SOSS1 complex and RNA polymerase II trigger liquid-liquid phase separation at double-strand breaks. Cell Rep. 42, 113489. 10.1016/j.celrep.2023.113489. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Gao B, Wang X, Long M, Zhang F, Wang Y, Kumar R, Veillard I, Rueda BR, Yeku O, and Lan L (2025). ABL1-mediated tyrosine phosphorylation of SYCP2 contributes to transcription-coupled homologous recombination and platinum resistance in ovarian cancer. NAR Cancer 7, zcaf031. 10.1093/narcan/zcaf031. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Hochhaus A, Wang J, Kim DW, Kim DDH, Mayer J, Goh YT, le Coutre P, Takahashi N, Kim I, Etienne G, et al. (2024). Asciminib in Newly Diagnosed Chronic Myeloid Leukemia. N. Engl. J. Med. 391, 885–898. 10.1056/NEJMoa2400858. [DOI] [PubMed] [Google Scholar]
58.Martorana F, Da Silva LA, Sessa C, and Colombo I (2022). Everything Comes with a Price: The Toxicity Profile of DNA-Damage Response Targeting Agents. Cancers (Basel) 14, 953. 10.3390/cancers14040953. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Sen T, Rodriguez BL, Chen L, Corte CMD, Morikawa N, Fujimoto J, Cristea S, Nguyen T, Diao L, Li L, et al. (2019). Targeting DNA Damage Response Promotes Antitumor Immunity through STING-Mediated T-cell Activation in Small Cell Lung Cancer. Cancer Discov. 9, 646–661. 10.1158/2159-8290.CD-18-1020. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Taniguchi H, Chakraborty S, Takahashi N, Banerjee A, Caeser R, Zhan YA, Tischfield SE, Chow A, Nguyen EM, Villalonga ÁQ, et al. (2024). ATR inhibition activates cancer cell cGAS/STING-interferon signaling and promotes antitumor immunity in small-cell lung cancer. Sci. Adv. 10, eado4618. 10.1126/sciadv.ado4618. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Kim D, Paggi JM, Park C, Bennett C, and Salzberg SL (2019). Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37, 907–915. 10.1038/s41587-019-0201-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Liao Y, Smyth GK, and Shi W (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. 10.1093/bioinformatics/btt656. [DOI] [PubMed] [Google Scholar]
63.Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550. 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682. 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Győrffy B, Surowiak P, Budczies J, and Lánczky A (2013). Online survival analysis software to assess the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer. PLoS One 8, e82241. 10.1371/journal.pone.0082241. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS2199975-supplement-1.pdf^{(1.9MB, pdf)}

NIHMS2199975-supplement-2.xlsx^{(9.8KB, xlsx)}

Data Availability Statement

Raw data are available upon request.
This paper does not report original code.
The RNA-sequence dataset generated during this study has been deposited in NCBI Gene Expression Omnibus (GEO) under accession no. GEO: GSE289452.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[R1] 1.Rudin CM, Brambilla E, Faivre-Finn C, and Sage J (2021). Small-cell lung cancer. Nat. Rev. Dis. Primers 7, 3. 10.1038/s41572-020-00235-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] 2.Ko J, Winslow MM, and Sage J (2021). Mechanisms of small cell lung cancer metastasis. EMBO Mol. Med. 13, e13122. 10.15252/emmm.202013122. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] 3.Saltos A, Shafique M, and Chiappori A (2020). Update on the Biology, Management, and Treatment of Small Cell Lung Cancer (SCLC). Front. Oncol. 10, 1074. 10.3389/fonc.2020.01074. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] 4.Rudin CM, Poirier JT, Byers LA, Dive C, Dowlati A, George J, Heymach JV, Johnson JE, Lehman JM, MacPherson D, et al. (2019). Molecular subtypes of small cell lung cancer: a synthesis of human and mouse model data. Nat. Rev. Cancer 19, 289–297. 10.1038/s41568-019-0133-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] 5.Sutherland KD, Ireland AS, and Oliver TG (2022). Killing SCLC: insights into how to target a shapeshifting tumor. Genes Dev. 36, 241–258. 10.1101/gad.349359.122. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] 6.Gay CM, Stewart CA, Park EM, Diao L, Groves SM, Heeke S, Nabet BY, Fujimoto J, Solis LM, Lu W, et al. (2021). Patterns of transcription factor programs and immune pathway activation define four major subtypes of SCLC with distinct therapeutic vulnerabilities. Cancer Cell 39, 346–360.e7. 10.1016/j.ccell.2020.12.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] 7.Nabet BY, Hamidi H, Lee MC, Banchereau R, Morris S, Adler L, Gayevskiy V, Elhossiny AM, Srivastava MK, Patil NS, et al. (2024). Immune heterogeneity in small-cell lung cancer and vulnerability to immune checkpoint blockade. Cancer Cell 42, 429–443.e4. 10.1016/j.ccell.2024.01.010. [DOI] [PubMed] [Google Scholar]

[R8] 8.Thomas A, and Pommier Y (2016). Small cell lung cancer: Time to revisit DNA-damaging chemotherapy. Sci. Transl. Med. 8, 346fs12. 10.1126/scitranslmed.aaf6282. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R9] 9.Petermann E, Lan L, and Zou L (2022). Sources, resolution and physiological relevance of R-loops and RNA-DNA hybrids. Nat. Rev. Mol. Cell Biol. 23, 521–540. 10.1038/s41580-022-00474-x. [DOI] [PubMed] [Google Scholar]

[R10] 10.García-Muse T, and Aguilera A (2016). Transcription-replication conflicts: how they occur and how they are resolved. Nat. Rev. Mol. Cell Biol. 17, 553–563. 10.1038/nrm.2016.88. [DOI] [PubMed] [Google Scholar]

[R11] 11.Lalonde M, Trauner M, Werner M, and Hamperl S (2021). Consequences and Resolution of Transcription-Replication Conflicts. Life 11, 637. 10.3390/life11070637. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] 12.Gu JJ, Rouse C, Xu X, Wang J, Onaitis MW, and Pendergast AM (2016). Inactivation of ABL kinases suppresses non-small cell lung cancer metastasis. JCI Insight 1, e89647. 10.1172/jci.insight.89647. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] 13.Hoj JP, Mayro B, and Pendergast AM (2019). A TAZ-AXL-ABL2 Feed-Forward Signaling Axis Promotes Lung Adenocarcinoma Brain Metastasis. Cell Rep. 29, 3421–3434.e8. 10.1016/j.celrep.2019.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Luttman JH, Hoj JP, Lin KH, Lin J, Gu JJ, Rouse C, Nichols AG, MacIver NJ, Wood KC, and Pendergast AM (2021). ABL allosteric inhibitors synergize with statins to enhance apoptosis of metastatic lung cancer cells. Cell Rep. 37, 109880. 10.1016/j.celrep.2021.109880. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] 15.McKernan CM, Khatri A, Hannigan M, Child J, Chen Q, Mayro B, Snyder D, Nicchitta CV, and Pendergast AM (2022). ABL kinases regulate translation in HER2+ cells through Y-box-binding protein 1 to facilitate colonization of the brain. Cell Rep. 40, 111268. 10.1016/j.celrep.2022.111268. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Greuber EK, Smith-Pearson P, Wang J, and Pendergast AM (2013). Role of ABL family kinases in cancer: from leukaemia to solid tumours. Nat. Rev. Cancer 13, 559–571. 10.1038/nrc3563. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Mayro B, Hoj JP, Cerda-Smith CG, Hutchinson HM, Caminear MW, Thrash HL, Winter PS, Wardell SE, McDonnell DP, Wu C, et al. (2023). ABL kinases regulate the stabilization of HIF-1alpha and MYC through CPSF1. Proc. Natl. Acad. Sci. USA 120, e2210418120. 10.1073/pnas.2210418120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] 18.Zhu Y, Cui Y, Zheng X, Zhao Y, and Sun G (2022). Small-cell lung cancer brain metastasis: From molecular mechanisms to diagnosis and treatment. Biochim. Biophys. Acta. Mol. Basis Dis. 1868, 166557. 10.1016/j.bbadis.2022.166557. [DOI] [PubMed] [Google Scholar]

[R19] 19.Khatri A, Gu JJ, McKernan CM, Xu X, and Pendergast AM (2019). ABL kinase inhibition sensitizes primary lung adenocarcinomas to chemotherapy by promoting tumor cell differentiation. Oncotarget 10, 1874–1886. 10.18632/oncotarget.26740. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R20] 20.Burslem GM, Schultz AR, Bondeson DP, Eide CA, Savage Stevens SL, Druker BJ, and Crews CM (2019). Targeting BCR-ABL1 in Chronic Myeloid Leukemia by PROTAC-Mediated Targeted Protein Degradation. Cancer Res. 79, 4744–4753. 10.1158/0008-5472.CAN-19-1236. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] 21.Wylie AA, Schoepfer J, Jahnke W, Cowan-Jacob SW, Loo A, Furet P, Marzinzik AL, Pelle X, Donovan J, Zhu W, et al. (2017). The allosteric inhibitor ABL001 enables dual targeting of BCR-ABL1. Nature 543, 733–737. 10.1038/nature21702. [DOI] [PubMed] [Google Scholar]

[R22] 22.Teng Y, Yadav T, Duan M, Tan J, Xiang Y, Gao B, Xu J, Liang Z, Liu Y, Nakajima S, et al. (2018). ROS-induced R loops trigger a transcription-coupled but BRCA1/2-independent homologous recombination pathway through CSB. Nat. Commun. 9, 4115. 10.1038/s41467-018-06586-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] 23.Ouyang J, Yadav T, Zhang JM, Yang H, Rheinbay E, Guo H, Haber DA, Lan L, and Zou L (2021). RNA transcripts stimulate homologous recombination by forming DR-loops. Nature 594, 283–288. 10.1038/s41586-021-03538-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] 24.Bhattacharya S, Srinivasan K, Abdisalaam S, Su F, Raj P, Dozmorov I, Mishra R, Wakeland EK, Ghose S, Mukherjee S, and Asaithamby A (2017). RAD51 interconnects between DNA replication, DNA repair and immunity. Nucleic Acids Res. 45, 4590–4605. 10.1093/nar/gkx126. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Wickramasinghe VO, and Venkitaraman AR (2016). RNA Processing and Genome Stability: Cause and Consequence. Mol. Cell 61, 496–505. 10.1016/j.molcel.2016.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.Goehring L, Huang TT, and Smith DJ (2023). Transcription-Replication Conflicts as a Source of Genome Instability. Annu. Rev. Genet. 57, 157–179. 10.1146/annurev-genet-080320-031523. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] 27.Jalan M, Sharma A, Pei X, Weinhold N, Buechelmaier ES, Zhu Y, Ahmed-Seghir S, Ratnakumar A, Di Bona M, McDermott N, et al. (2024). RAD52 resolves transcription-replication conflicts to mitigate R-loop induced genome instability. Nat. Commun. 15, 7776. 10.1038/s41467-024-51784-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] 28.Alagia A, Ketley RF, and Gullerova M (2022). Proximity Ligation Assay for Detection of R-Loop Complexes upon DNA Damage. Methods Mol. Biol. 2528, 289–303. 10.1007/978-1-0716-2477-7_19. [DOI] [PubMed] [Google Scholar]

[R29] 29.Smolka JA, Sanz LA, Hartono SR, and Chédin F (2021). Recognition of RNA by the S9.6 antibody creates pervasive artifacts when imaging RNA:DNA hybrids. J. Cell Biol. 220, e202004079. 10.1083/jcb.202004079. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R30] 30.Aguilera A, and García-Muse T (2012). R loops: from transcription byproducts to threats to genome stability. Mol. Cell 46, 115–124. 10.1016/j.molcel.2012.04.009. [DOI] [PubMed] [Google Scholar]

[R31] 31.Leung W, Simoneau A, Saxena S, Jackson J, Patel PS, Limbu M, Vindigni A, and Zou L (2023). ATR protects ongoing and newly assembled DNA replication forks through distinct mechanisms. Cell Rep. 42, 112792. 10.1016/j.celrep.2023.112792. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] 32.Quinet A, Carvajal-Maldonado D, Lemacon D, and Vindigni A (2017). DNA Fiber Analysis: Mind the Gap. Methods Enzymol. 591, 55–82. 10.1016/bs.mie.2017.03.019. [DOI] [PubMed] [Google Scholar]

[R33] 33.Subramanyam S, Ismail M, Bhattacharya I, and Spies M (2016). Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics. Proc. Natl. Acad. Sci. USA 113, E6045–E6054. 10.1073/pnas.1604807113. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Shimizu H, Popova M, Fleury F, Kobayashi M, Hayashi N, Sakane I, Kurumizaka H, Venkitaraman AR, Takahashi M, and Yamamoto K.i. (2009). c-ABL tyrosine kinase stabilizes RAD51 chromatin association. Biochem. Biophys. Res. Commun. 382, 286–291. 10.1016/j.bbrc.2009.03.020. [DOI] [PubMed] [Google Scholar]

[R35] 35.Slupianek A, Schmutte C, Tombline G, Nieborowska-Skorska M, Hoser G, Nowicki MO, Pierce AJ, Fishel R, and Skorski T (2001). BCR/ABL regulates mammalian RecA homologs, resulting in drug resistance. Mol. Cell 8, 795–806. 10.1016/s1097-2765(01)00357-4. [DOI] [PubMed] [Google Scholar]

[R36] 36.Kitao H, and Yuan ZM (2002). Regulation of ionizing radiation-induced Rad52 nuclear foci formation by c-Abl-mediated phosphorylation. J. Biol. Chem. 277, 48944–48948. 10.1074/jbc.M208151200. [DOI] [PubMed] [Google Scholar]

[R37] 37.Liu Y, and Maizels N (2000). Coordinated response of mammalian Rad51 and Rad52 to DNA damage. EMBO Rep. 1, 85–90. 10.1093/embo-reports/kvd002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Wray J, Liu J, Nickoloff JA, and Shen Z (2008). Distinct RAD51 associations with RAD52 and BCCIP in response to DNA damage and replication stress. Cancer Res. 68, 2699–2707. 10.1158/0008-5472.CAN-07-6505. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] 39.Zhou Y, Caron P, Legube G, and Paull TT (2014). Quantitation of DNA double-strand break resection intermediates in human cells. Nucleic Acids Res. 42, e19. 10.1093/nar/gkt1309. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Feu S, Unzueta F, Ercilla A, Pérez-Venteo A, Jaumot M, and Agell N (2022). RAD51 is a druggable target that sustains replication fork progression upon DNA replication stress. PLoS One 17, e0266645. 10.1371/journal.pone.0266645. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] 41.Slupianek A, Dasgupta Y, Ren SY, Gurdek E, Donlin M, Nieborowska-Skorska M, Fleury F, and Skorski T (2011). Targeting RAD51 phosphotyrosine-315 to prevent unfaithful recombination repair in BCR-ABL1 leukemia. Blood 118, 1062–1068. 10.1182/blood-2010-09-307256. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] 42.Saxena S, and Zou L (2022). Hallmarks of DNA replication stress. Mol. Cell 82, 2298–2314. 10.1016/j.molcel.2022.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Nagel R, Avelar AT, Aben N, Proost N, van de Ven M, van der Vliet J, Cozijnsen M, de Vries H, Wessels LFA, and Berns A (2019). Inhibition of the Replication Stress Response Is a Synthetic Vulnerability in SCLC That Acts Synergistically in Combination with Cisplatin. Mol. Cancer Ther. 18, 762–770. 10.1158/1535-7163.MCT-18-0972. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] 44.Thomas A, Takahashi N, Rajapakse VN, Zhang X, Sun Y, Ceribelli M, Wilson KM, Zhang Y, Beck E, Sciuto L, et al. (2021). Therapeutic targeting of ATR yields durable regressions in small cell lung cancers with high replication stress. Cancer Cell 39, 566–579.e7. 10.1016/j.ccell.2021.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R45] 45.Simoneau A, and Zou L (2021). An extending ATR-CHK1 circuitry: the replication stress response and beyond. Curr. Opin. Genet. Dev. 71, 92–98. 10.1016/j.gde.2021.07.003. [DOI] [PubMed] [Google Scholar]

[R46] 46.Flynn RL, and Zou L (2011). ATR: a master conductor of cellular responses to DNA replication stress. Trends Biochem. Sci. 36, 133–140. 10.1016/j.tibs.2010.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] 47.Wang J, Rouse C, Jasper JS, and Pendergast AM (2016). ABL kinases promote breast cancer osteolytic metastasis by modulating tumor-bone interactions through TAZ and STAT5 signaling. Sci. Signal. 9, ra12. 10.1126/scisignal.aad3210. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Er EE, Valiente M, Ganesh K, Zou Y, Agrawal S, Hu J, Griscom B, Rosenblum M, Boire A, Brogi E, et al. (2018). Pericyte-like spreading by disseminated cancer cells activates YAP and MRTF for metastatic colonization. Nat. Cell Biol. 20, 966–978. 10.1038/s41556-018-0138-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] 49.Takahashi T, Yamanaka T, Seto T, Harada H, Nokihara H, Saka H, Nishio M, Kaneda H, Takayama K, Ishimoto O, et al. (2017). Prophylactic cranial irradiation versus observation in patients with extensive-disease small-cell lung cancer: a multicentre, randomised, open-label, phase 3 trial. Lancet Oncol. 18, 663–671. 10.1016/S1470-2045(17)30230-9. [DOI] [PubMed] [Google Scholar]

[R50] 50.Brown PD, Ahluwalia MS, Khan OH, Asher AL, Wefel JS, and Gondi V (2018). Whole-Brain Radiotherapy for Brain Metastases: Evolution or Revolution? J. Clin. Oncol. 36, 483–491. 10.1200/JCO.2017.75.9589. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] 51.Takano K, Kinoshita M, Takagaki M, Sakai M, Tateishi S, Achiha T, Hirayama R, Nishino K, Uchida J, Kumagai T, et al. (2016). Different spatial distributions of brain metastases from lung cancer by histological subtype and mutation status of epidermal growth factor receptor. Neuro Oncol. 18, 716–724. 10.1093/neuonc/nov266. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] 52.Wang Y, Xia W, Liu B, Zhou L, Ni M, Zhang R, Shen J, Bai Y, Weng G, Yuan S, and Gao X (2021). Exploration of spatial distribution of brain metastasis from small cell lung cancer and identification of metastatic risk level of brain regions: a multicenter, retrospective study. Cancer Imaging 21, 41. 10.1186/s40644-021-00410-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] 53.Zhu D, Shao Y, Yang Z, Cheng A, Xi Q, Liang X, and Chu S (2023). Magnetic resonance imaging characteristics of brain metastases in small cell lung cancer. Cancer Med. 12, 15199–15206. 10.1002/cam4.6206. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Burger K, Schlackow M, and Gullerova M (2019). Tyrosine kinase c-Abl couples RNA polymerase II transcription to DNA double-strand breaks. Nucleic Acids Res. 47, 3467–3484. 10.1093/nar/gkz024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R55] 55.Long Q, Sebesta M, Sedova K, Haluza V, Alagia A, Liu Z, Stefl R, and Gullerova M (2023). The phosphorylated trimeric SOSS1 complex and RNA polymerase II trigger liquid-liquid phase separation at double-strand breaks. Cell Rep. 42, 113489. 10.1016/j.celrep.2023.113489. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] 56.Gao B, Wang X, Long M, Zhang F, Wang Y, Kumar R, Veillard I, Rueda BR, Yeku O, and Lan L (2025). ABL1-mediated tyrosine phosphorylation of SYCP2 contributes to transcription-coupled homologous recombination and platinum resistance in ovarian cancer. NAR Cancer 7, zcaf031. 10.1093/narcan/zcaf031. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] 57.Hochhaus A, Wang J, Kim DW, Kim DDH, Mayer J, Goh YT, le Coutre P, Takahashi N, Kim I, Etienne G, et al. (2024). Asciminib in Newly Diagnosed Chronic Myeloid Leukemia. N. Engl. J. Med. 391, 885–898. 10.1056/NEJMoa2400858. [DOI] [PubMed] [Google Scholar]

[R58] 58.Martorana F, Da Silva LA, Sessa C, and Colombo I (2022). Everything Comes with a Price: The Toxicity Profile of DNA-Damage Response Targeting Agents. Cancers (Basel) 14, 953. 10.3390/cancers14040953. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R59] 59.Sen T, Rodriguez BL, Chen L, Corte CMD, Morikawa N, Fujimoto J, Cristea S, Nguyen T, Diao L, Li L, et al. (2019). Targeting DNA Damage Response Promotes Antitumor Immunity through STING-Mediated T-cell Activation in Small Cell Lung Cancer. Cancer Discov. 9, 646–661. 10.1158/2159-8290.CD-18-1020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] 60.Taniguchi H, Chakraborty S, Takahashi N, Banerjee A, Caeser R, Zhan YA, Tischfield SE, Chow A, Nguyen EM, Villalonga ÁQ, et al. (2024). ATR inhibition activates cancer cell cGAS/STING-interferon signaling and promotes antitumor immunity in small-cell lung cancer. Sci. Adv. 10, eado4618. 10.1126/sciadv.ado4618. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] 61.Kim D, Paggi JM, Park C, Bennett C, and Salzberg SL (2019). Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37, 907–915. 10.1038/s41587-019-0201-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] 62.Liao Y, Smyth GK, and Shi W (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. 10.1093/bioinformatics/btt656. [DOI] [PubMed] [Google Scholar]

[R63] 63.Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] 64.Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550. 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R65] 65.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682. 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] 66.Győrffy B, Surowiak P, Budczies J, and Lánczky A (2013). Online survival analysis software to assess the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer. PLoS One 8, e82241. 10.1371/journal.pone.0082241. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

ABL kinase inactivation induces transcription-replication conflicts and impairs replication fork progression in metastatic small cell lung cancer

Jing Jin Gu

Kevin M Scott

Arijit Ghosh

Roberto H Barbier

Douglas C Rouse

Jacob P Hoj

Michael W Caminear

Fengqi Zhang

Boya Gao

Margaret W Barbier

Lee Zou

Li Lan

Ann Marie Pendergast

SUMMARY

In brief

Graphical Abstract

INTRODUCTION

RESULTS

ABL kinase inhibition impairs SCLC metastatic dissemination and outgrowth

Figure 1. ABL kinase inhibitors impair SCLC metastases, downregulate DNA repair and DNA replication pathways, and enhance DNA damage in SCLC cells.

Inactivation of ABL kinase in SCLC cells impairs the expression of DNA repair and DNA replication pathways, increases DNA damage, and decreases DNA repair

ABL kinase regulates transcription-replication conflicts in SCLC cells

Figure 2. ABL kinase inhibition or depletion increases transcription-replication conflicts (TRCs) in SCLC cells.

ABL inactivation compromises DNA replication forks in SCLC cells

Figure 3. Replication forks are compromised in response to ABL kinase inhibition or depletion in SCLC cells.

ABL1 kinase associates with and phosphorylates RAD51 and RAD52

Figure 4. ABL1 kinase associates with and promotes RAD51 and RAD52 tyrosine phosphorylation.

SCLC cells expressing a phospho-deficient RAD52-Y104F mutant exhibit decreased foci and increased TRCs compared to RAD52-WT-expressing cells in response to DNA damage

Figure 5. SCLC cells expressing tyrosine phosphorylation-deficient RAD52 and RAD51 mutants exhibit decreased foci, increased TRCs and decreased DNA replication fork progression in response to DNA damage.

Impaired replication fork progression in SCLC cells expressing a RAD51-Y315F mutant compared to RAD51-WT-expressing cells in response to DNA damage

Co-treatment with ABL and ATR inhibitors synergistically inhibits SCLC growth and viability and promotes DNA damage

Figure 6. Concurrent administration of ABL and ATR inhibitors synergistically inhibits SCLC growth and viability.

Co-inhibition of ABL and ATR kinases impairs replication fork progression

Figure 7. Combined inhibition of ABL and ATR kinases in SCLC impairs replication fork progression, decreases metastatic colonization, and enhances survival of tumor-bearing mice.

Combined inactivation of ABL and ATR kinases impairs SCLC metastasis

DISCUSSION

Limitations of the study

RESOURCE AVAILABILITY

Lead contact

Materials availability

Data and code availability

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Animal models

Cell lines

METHOD DETAILS

Drug and inhibitors

Mouse intra-cardiac injection and treatment

Mouse dual-flank xenograft injection and treatment

RNA-sequencing analysis

Cell viability assay

Immunoblotting assay

Proximity ligation assay

DNA fiber assay

Double-strand break (DSB) repair assay

Transient transfection and immunoprecipitation

Mutagenesis and cloning

DNA plasmids

Lentiviral transduction

DNA damage induction with endonuclease AsiSI

Kaplan-meier analysis

Real-time quantitative PCR

Immunofluorescence and confocal microscopy

Ionizing radiation experiments

QUANTIFICATION AND STATISTICAL ANALYSIS

Supplementary Material

KEY RESOURCES TABLE.

Highlights.

ACKNOWLEDGMENTS

Footnotes

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles