Investigating the molecular mechanisms underlying the neuroprotective potential of ellagic acid in scopolamine-induced learning and memory dysfunction

Abstract

Background and purpose:

Scopolamine-induced memory impairment is widely used as an experimental model of cognitive dysfunction. Natural compounds with antioxidant and anti-inflammatory properties, such as ellagic acid (EA), have shown neuroprotective potential; however, their effects on cholinergic signaling and neurotrophic factors remain underexplored. This study aimed to investigate the effects of EA on cognitive performance, oxidative stress, neuroinflammation, and cholinergic markers in scopolamine-treated rats.

Experimental approach:

Fifty adult male Wistar rats were divided into control, scopolamine (Scop, 2 mg/kg, i.p.), Scop + EA (25 or 50 mg/kg, orally), and Scop + donepezil (2 mg/kg, orally) groups. Cognitive functions were assessed using the MWM and PA tests. Biochemical assays measured hippocampal and cortical levels of MDA, thiols, SOD, CAT, and AChE activity. In addition, hippocampal BDNF concentration and mRNA expression of pro-inflammatory cytokines, AChE, and CHRM1 were quantified.

Results/Findings:

Scopolamine administration significantly impaired learning and memory in both MWM and PA tests, increased oxidative stress markers, reduced antioxidant enzyme activities, decreased hippocampal BDNF levels, and upregulated pro-inflammatory cytokines, AChE mRNA levels, and decreased CHRM1 mRNA expression. EA treatment (particularly at 50 mg/kg) significantly improved behavioral performance, restored antioxidant balance, enhanced BDNF expression, reduced AChE activity, and downregulated cytokine and AChE mRNA expression, while increasing CHRM1 mRNA expression, with effects comparable to those of donepezil.

Conclusion and implications:

EA attenuates scopolamine-induced memory deficits, accompanied by improvements in oxidative stress markers, neuroinflammatory gene expression, and cholinergic parameters. These findings suggest a potential neuroprotective role of EA; however, the underlying mechanisms remain speculative.

INTRODUCTION

Cognitive decline and memory impairment are among the hallmarks of neurodegenerative disorders, particularly Alzheimer’s disease (AD). A key pathological feature of AD is cholinergic dysfunction, which contributes significantly to learning and memory deficits (1,2). A severe loss of cholinergic neurons in the basal forebrain occurs in the AD brain, which is believed to contribute to memory impairment and attention deficits in AD patients (1). Experimental models frequently employ scopolamine, a non-selective muscarinic acetylcholine receptor antagonist, to induce transient memory impairment and mimic aspects of cholinergic deficits observed in AD (3,4). Beyond cholinergic deficits, scopolamine has also been shown to induce neuroinflammation and oxidative damage in brain tissue, leading to neuronal damage, impaired synaptic plasticity, and reduced neurotrophic signaling in preclinical studies (5,6,7,8).

Brain-derived neurotrophic factor (BDNF), a key neurotrophin involved in neuronal survival, synaptic plasticity, and memory consolidation, is often downregulated in neurodegenerative conditions (9). In addition, dysregulation of acetylcholinesterase (AChE) activity and alterations in muscarinic acetylcholine receptor subtypes, such as M1, further compromise cholinergic transmission and exacerbate cognitive deficits (10).

In recent years, natural compounds with antioxidant and anti-inflammatory properties have gained considerable attention as potential neuroprotective agents. Among them, ellagic acid (EA), a polyphenolic compound abundant in fruits and nuts such as pomegranates, strawberries, and walnuts, has shown strong antioxidant, anti-inflammatory, and neuroprotective effects (11,12). Previous in vivo studies demonstrated that EA can attenuate scopolamine-induced memory deficits, partly through reducing oxidative stress and modulating AChE activity (5). In addition, in vitro evidence suggests that EA prevents oxidative damage and exhibits anti-AChE activity (13). Despite this evidence, its detailed role in modulating cholinergic signaling and neurotrophic factors in scopolamine-induced memory impairment has not been thoroughly explored.

We hypothesize that treatment with EA can mitigate scopolamine-induced memory impairment by modulating key molecular and biochemical pathways. Specifically, we propose that EA exerts its neuroprotective effects through the attenuation of neuroinflammation and oxidative stress, upregulation of BDNF expression, normalization of M1 acetylcholine receptor expression, and reduction of AChE activity. By targeting these mechanisms, EA may counteract the cholinergic dysfunction and neuronal damage underlying memory deficits.

MATERIALS AND METHODS

Animals

Fifty adult male Wistar rats (200-250 g, 8-10 weeks old) were used in this study. Animals were housed under standard laboratory conditions: a 12/12-h light/dark cycle, relative humidity of 30-60%, and room temperature maintained at 21-23 °C. Rats had free access to standard rodent chow and tap water throughout the experiment. One week before the start of the experiment, rats were group-housed in the animal facility to acclimate to the environment.

All experimental procedures were reviewed and approved by the Ethics Committee of Mashhad University of Medical Sciences (Approval ID: IR.MUMS.REC.1401.195), and were conducted in accordance with the relevant institutional and international guidelines for the care and use of laboratory animals.

Experimental procedure

Figure 1 illustrates the experimental timeline. Rats were randomly assigned to five groups (n = 10 per group): control, scopolamine (Scop), Scop + EA25, Scop + EA50, and Scop + donepezil (Scop + Dnp). EA (25 or 50 mg/kg/day) was dissolved in 1% dimethyl sulfoxide (DMSO) in saline and administered orally by gavage at a volume of 2 mL/kg once daily for 14 consecutive days (5,14). Donepezil (2 mg/kg/day) was dissolved in saline containing 1% DMSO to match the vehicle used in the EA-treated groups and was administered using the same regimen (15). Control and scopolamine-treated groups received an equivalent volume of the vehicle (1% DMSO in saline) via oral gavage. From day 14 to day 21, scopolamine hydrobromide dissolved in saline (2 mg/kg/day) (16), was intraperitoneally administered to all groups except the control group, which received an equal volume of saline (1 mL/kg). Scopolamine or saline injections were given 30 min before the start of each behavioral test on the corresponding day.

Fig. 1.

Experimental timeline. EA (25 or 50 mg/kg/day) or donepezil (2 mg/kg/day) was administered orally by gavage once daily for 14 consecutive days. From days 14 to 21, scopolamine (2 mg/kg/day, i.p.) was injected 30 min before each behavioral test, while the control group received saline. PA habituation and acquisition were performed on days 14 and 15, followed by MWM learning trials and PA retention tests on subsequent days. The MWM probe test was conducted on day 21. Rats were sacrificed after completion of behavioral assessments, and brain tissues were collected for biochemical and molecular analyses. EA, Ellagic acid; PA, passive avoidance; MWM, Morris water maze.

Behavioral assessments were conducted by an experimenter who was blinded to the treatment groups. To minimize stress-induced interference with spatial learning, passive avoidance (PA) training was completed before the Morris water maze (MWM). Animals were habituated to the PA apparatus two days before MWM testing, and the foot shock was delivered one day before the start of MWM acquisition trials. No aversive stimuli were applied during the MWM testing period, and PA retention was evaluated after completion of MWM training. This experimental sequence was chosen to reduce the potential impact of acute stress on hippocampus-dependent spatial learning and has been used in previous studies employing combined behavioral paradigms (5,17). Following completion of all behavioral assessments, rats were deeply anesthetized and sacrificed. Brain tissues were rapidly collected for subsequent biochemical and molecular analyses.

Behavioral tests

MWM

Spatial learning and memory were evaluated using the MWM. The apparatus consisted of a circular pool (150 cm in diameter, 60 cm in height) filled with water (22 ± 1 °C) to a depth of 30 cm. A circular escape platform (10 cm diameter) was mounted on a vertical support and submerged 1.5 cm below the water surface, rendering it invisible. The platform was maintained in a fixed position in the southwest (SW) quadrant throughout the acquisition phase. Prominent extra-maze visual cues with geometric patterns were placed on the surrounding walls and remained constant throughout testing.

Rats underwent four acquisition trials per day for five consecutive days. A trial was defined as a single swim attempt in which the rat was released into the pool and allowed up to 60 s to locate the hidden platform. In each trial, rats were released from one of four different starting points (north, south, east, or west), in a pseudo-random order, such that all four starting positions were used once per day. Upon locating the platform, rats were allowed to remain on it for 20-30 s before being removed from the pool. If a rat failed to find the platform within 60 s, it was gently guided to the platform and allowed to remain there for 20-30 s. Inter-trial intervals were approximately 60 s. Escape latency and swim path length were recorded using automated video-tracking software (Tajhiz Gostar Omid Iranian. Co, Karaj, Iran). Probe test: On the final day, 24 h after the last learning trial, the platform was removed from the pool. Each rat was released into the water and allowed to swim freely for 60 s. The time spent and distance traveled in the target quadrant were measured as indices of spatial memory retention (18).

PA performance

PA learning and memory were evaluated using a shuttle box consisting of two adjoining compartments: one illuminated and one dark (each measuring 20 × 30 × 20 cm), separated by a sliding guillotine door. The floor of the dark compartment was fitted with stainless-steel rods connected to a shock generator.

To minimize the potential impact of foot shock-induced stress on spatial learning, PA training was completed one day before initiation of the MWM, and only retention tests were performed thereafter. On the first day, animals were allowed to freely explore both chambers for 5 min to habituate to the apparatus. On the following day (training session), each rat was placed in the illuminated compartment. Upon spontaneous entry into the dark compartment, the guillotine door was closed, and a single foot shock (2 s, 2 mA, 50 Hz) was delivered through the grid floor. Shock intensity and duration were selected based on prior studies (19) and pilot testing to reliably induce avoidance learning without causing tissue injury or excessive distress, and the shock generator was factory-calibrated to ensure consistent current delivery across animals.

For memory retention assessment, test sessions were conducted 3, 24, 48, and 72 h after the training. In each session, rats were again placed in the illuminated chamber, and their behavior was recorded for 5 min. The latency to enter the dark compartment, the number of entries, and the cumulative time spent in the dark chamber were measured as indices of avoidance learning and memory.

Biochemical and molecular assessments

Tissue collection and sample preparation

Following completion of the behavioral experiments, rats were anesthetized by intraperitoneal injection of ketamine (80 mg/kg) and xylazine (12.5 mg/kg). After deep anesthesia was confirmed, animals were sacrificed, and the brains were rapidly removed. The hippocampus and cortex were carefully dissected on ice. Left hippocampal samples were immediately immersed in RNAlater™ (Parsian Azma, Iran) solution and stored at -80 °C until analysis of gene expression. Quantitative evaluation was performed on AChE, interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), IL-6, and muscarinic acetylcholine receptor Ml (CHRM1) mRNA levels. Cortical and right hippocampal tissues were stored at -80 °C for biochemical measurements. For these assays, frozen samples were homogenized in PBS, centrifuged at 5000 g, and the resulting supernatants were collected for subsequent analyses.

Measurement of total thiol contents

Total thiol measurement involves the addition of brain homogenate to Tris-ethylenediaminetetraacetic acid (EDTA) solution. The absorbance of this mixture was recorded after addition of 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB, 10 mM) and compared to the baseline absorbance (20).

Measurement of catalase, superoxide dismutase, and AChE activities Catalase (CAT) activity was measured by mixing each sample with PBS and hydrogen peroxide (H₂O₂), followed by reading the absorbance at 412 nm (20).

Superoxide dismutase (SOD) activity was determined using the method described by Madesh (1972) with a few minor modifications. Briefly, each sample was incubated with pyrogallol and MTT solution, and the resulting absorbance was recorded (20).

AChE activity was assessed according to the method of Ellman (21). Acetylthiocholine iodide was used as a substrate. In the 96-well plates, 50 μL of tissue homogenate, 900 μL of sodium phosphate buffer, and 50 μL of DTNB (6 mM) were added, and the absorbance was measured after 10 min of incubation with a microplate reader at 412 nm. To start the reaction, acetylthiocholine iodide (20 mM) was added to each well, and the absorbance was measured again after 10 min of incubation at room temperature. Percentage of inhibition was calculated by comparing the rate of enzymatic hydrolysis of acetylthiocholine iodide during 10 min. The AChE activity rate was calculated using the following equation:

R = 5.7(10⁴)absorbance changes/C

where R stands for rate in moles of substrate hydrolyzed per min per tissue weight (g), and C is the concentration of tissue homogenate (22).

Measurement of MDA

For this purpose, the test tubes containing the supernatants (0.5 mL) and TBA reagent were mixed and kept in a bath for 30 min. Following that, the test tubes were cooled and centrifuged at 4000 g for 10 min. Finally, the absorbance of the pink-colored supernatant was measured at 412 nm. The concentration of malondialdehyde (MDA) was expressed in nmol/g of tissue (5).

Measurement of BDNF levels

Levels of BDNF in hippocampal tissue were quantified using a commercially available rat BDNF ELISA kit (MyBioSource, Cat. #MBS355345, San Diego, CA, USA). Optical density was measured at 450 nm using a microplate reader, and BDNF concentrations were calculated from a standard curve generated in each assay. The detection range of the assay is approximately 31.2-2000 pg/mL, and the sensitivity (lower limit of detection) is < 2 pg/mL.

Evaluation of AChE, IL-1β, TNF-α, IL-6, and CHRM1 mRNA expression

The mRNA expression levels of AChE, IL-1β, TNF-α, IL-6, and CHRM1 were quantified using quantitative real-time polymerase chain reaction (qRT-PCR). The specific primer sequences used for amplification are listed in Table 1. Total RNA was isolated from the hippocampal tissues using an RNA extraction kit (Yekta Tajhiz Azma, Iran) according to the manufacturer’s protocol. The purity and concentration of RNA were assessed spectrophotometrically at 260/280 nm. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using a cDNA synthesis kit (Yekta Tajhiz Azma, Iran) following the provided instructions. Quantitative PCR amplification was carried out using SYBR Green Master Mix in a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). The GAPDH gene was used as an internal control for normalization, and the relative expression levels of target genes were calculated using the 2^-ΔΔCt method.

Table 1.

Primer sequences used for the analysis of AchE, CHRM1, TNF-α, IL-1β, IL-6, and GAPDH gene expression.

Gene name (NCBI RefSeq)	Product length (bp)	Forward (5'->3')	Reverse (5'->3')
AChE (NM_172009.2)	100	AATTTTGCCCGCACAGGAGAC	GGTTCAGGCTCACGTATTGC
CHRM1 (NM_080773.2)	139	AGTCCCTCACATCCTCCGAA	TTCTTGGTGGGCCTCTTGAC
TNF-α (NM_012675.3)	100	ACACACGAGACGCTGAAGTA	TTCCGGGATCCAGTGAGTTC
IL1-β (NM_031512.2)	104	GACTTCACCATGGAACCCGT	GGAGACTGCCCATTCTCGAC
IL-6 (NM_012589.2)	100	CCTTCTTGGGACTGATGTTGTT	TATACTGGTCTGTTGTGGGTGG
GAPDH (NM_017008.4)	189	AGTGCCAGCCTCGTCTCATA	TGAACTTGCCGTGGGTAGAG

AchE, Acetylcholinesterase; CHRM1, Muscarinic acetylcholine receptor M1; TNF-α, tumor necrosis factor-α; IL, interleukin.

Randomization, blinding, and sample-size allocation

Animals were randomly assigned to experimental groups based on animal availability at the time of each experimental run. Due to logistical constraints associated with behavioral testing, experiments were conducted in two independent batches; however, group allocation within each batch was balanced to ensure comparable group sizes. All behavioral assessments and subsequent analyses were performed by investigators blinded to treatment allocation.

Sample sizes varied depending on the experimental endpoint. Behavioral tests and biochemical assays were conducted using 10 animals per group. For molecular analyses, qRT-PCR was performed on hippocampal samples from four animals per group due to tissue availability and the exploratory, mechanistic nature of these analyses. All sample sizes are indicated in the corresponding figure legends.

Statistical analyses

Data analysis and graph preparation were performed using GraphPad Prism version 8.2. The normality of data distribution was assessed using the Shapiro-Wilk test and the homogeneity of variances checked with Bartlett's test. Comparisons among groups were conducted using one-way ANOVA followed by Tukey’s post hoc test or Welch ANOVA tests with Dunnett's T3 multiple comparisons test (when the homogeneity of variances was significant). For non-parametric data, the Kruskal-Wallis test followed by multiple correction using Dunn’s test was applied. The learning trials of the MWM were analyzed using two-way repeated-measures ANOVA followed by Bonferroni’s post hoc test. Results are expressed as mean ± SEM for parametric data and as median with interquartile range for non-parametric data. P-values ≤ 0.05 were considered statistically significant. Specific statistical tests applied to each behavioral, biochemical, and molecular endpoint are indicated in the corresponding figure legends.

RESULTS

Rats’ performance in the MWM

Figure 2 illustrates the escape latency to the platform as well as distance during the first 5 days of MWM. Learning impairment was observed in rats after scopolamine injection, as indicated by a significant increase in the time (Fig. 2A) and distance (Fig. 2B) to reach the platform. Treatment with EA (25 and 50 mg/kg) or donepezil (2 mg/kg) counteracted memory deficit induced by scopolamine injection, as confirmed by a reduction in time and distance to reach the hidden platform compared to the Scop group.

Fig. 2.

Effects of EA on spatial learning in the MWM. EA improved scopolamine-induced learning impairment, as indicated by reduced (A) escape latency and (B) path length to reach the hidden platform during the acquisition phase. Data are expressed as mean ± SEM, n = 10. **P < 0.05 and ***P < 0.001 indicate significant differences compared to the control group; ⁺⁺P < 0.05 and ⁺⁺⁺P < 0.001 versus the Scop group. MWM, Morris water maze; Scop, scopolamine; EA, ellagic acid; Dnp, donepezil.

In the rats that received scopolamine, compared to the control rats, time and distance in the target quadrant were significantly reduced compared to the control group in the probe test (Fig. 3A and B). Treatment with EA at 25 and 50 mg/kg and donepezil significantly increased the time spent in the target quadrant of MWM. Accordingly, the distance traveled in the target quadrant was increased in all the treated groups. Notably, no significant differences were found among Scop + EA25, Scop + EA50, and Scop + Dnp groups.

Fig. 3.

Effects of EA on spatial memory retention in the MWM probe test. EA increased (A) time spent and (B) distance traveled in the target quadrant. Data are expressed as mean ± SEM, n = 10. *P < 0.05 and ***P < 0.001 indicate significant differences compared to the control group; ⁺⁺P < 0.01 and ⁺⁺⁺P < 0.001 versus the Scop group. MWM, Morris water maze; Scop, scopolamine; EA, ellagic acid; Dnp, donepezil.

PA behavior

Figure 4 shows the performance of rats in the PA test. In the Scop group, latency to enter the dark compartment was significantly shorter than in control rats at all time points after shock delivery. Both 25 and 50 mg/kg of EA and donepezil increased latency at all post-shock time points (Fig. 4A₁-A₄). Furthermore, both 25 and 50 mg/kg of EA and donepezil decreased the time spent in the dark compartment compared to the Scop group at all post-shock time points (Fig. 4B₁-B₄). In addition, EA and donepezil increased the time spent in the light compartment at all post-shock time points in comparison with the Scop group (Fig. 4IC₁-C₄). Notably, no significant difference was found among Scop + EA25, Scop + EA50, and Scop + Dnp groups.

Fig. 4.

Effects of EA on passive avoidance learning and memory. EA increased (A1-A4) latency to enter the dark compartment, reduced (B1-B4) time spent in the dark compartment, and increased (C1-C4) time spent in the light compartment. Data were analyzed using the Kruskal-Wallis test and are presented as median with interquartile range, n = 10. ^*P < 0.05, ^**P < 0.01, and ^***P < 0.001 indicate significant differences compared to the control group; ⁺P < 0.05, ⁺⁺P < 0.01, and ⁺⁺⁺P < 0.001 versus the Scop group. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil.

EA promoted BDNF levels

Our measurements revealed that scopolamine injection decreased the level of BDNF in the hippocampal tissue of Scop group to a lower level than that of the control group (Fig. 5). However, the level of BDNF in the hippocampus of the groups treated with 50 mg/kg of EA and donepezil was significantly increased compared to Scop group but it did not reach the level of BDNF in the hippocampus of the control group.

Fig. 5.

Effects of EA on BDNF levels in the hippocampus. EA significantly modulated hippocampal BDNF levels. Data are expressed as mean ± SEM, n = 10. ^***P < 0.001 indicates significant differences compared to the control group; ⁺⁺⁺P < 0.001 versus the Scop group; ^###P < 0.001 between the designated groups. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; BDNF, brain-derived neurotrophic factor.

EA attenuated oxidative stress in the brain

Figure 6 shows that MDA content was remarkably raised in the rats that received scopolamine for both hippocampal and cortical tissues versus the control group. In the hippocampal tissue, the content of MDA in the Scop + EA25, Scop + EA50, and Scop + Dnp groups was higher than in the control group but significantly lower than in the Scop group. There was no significant difference among the Scop + EA25, Scop + EA50, and Scop + Dnp groups (Fig. 6A). Also, the cortical content of MDA in the Scop + EA25 and Scop + Dnp groups was significantly higher than that of the control group. The concentration of MDA in the cortex of the Scop + EA25, Scop + EA50, and Scop + Dnp groups was significantly lower relative to the Scop group. Notably, no significant difference was found between the Scop + EA25, Scop + EA50, and Scop + Dnp groups (Fig. 6B).

Fig. 6.

Effects of EA on MDA levels in the (A) hippocampus and (B) cortex. EA significantly reduced lipid peroxidation. Data are expressed as mean ± SEM, n = 10. ^*P < 0.05 and ^***P < 0.001 indicate significant differences compared to the control group; ⁺P < 0.05 and ⁺⁺⁺P < 0.001 versus the Scop group. MWM, Morris water maze; Scop, scopolamine; EA, ellagic acid; Dnp, donepezil; MDA, malondialdehyde.

The results of biochemical tests revealed a drop in cortical and hippocampal thiols in the scopolamine-injected animals compared to the control group (Fig. 7A and B). Furthermore, the concentration of total thiol in the hippocampus of the group that received 25 mg/kg of EA and 2 mg/kg of donepezil was significantly lower than that of the control group. Conversely, total thiol in the Scop + EA25, Scop + EA50, and Scop + Dnp groups was significantly higher than that of the Scop group. Also, the concentration of total thiol in the cortex of EA (25 and 50 mg/kg) and donepezil-treated groups was significantly lower in comparison with the control group. In contrast, the thiol level in cortical tissue of the groups received EA (25 and 50 mg/kg) and donepezil (2 mg/kg) was significantly higher relative to the Scop group.

Fig. 7.

Effects of EA on total thiol content in the (A) hippocampus and (B) cortex. EA significantly increased total thiol levels. Data are expressed as mean ± SEM, n = 10. ^*P < 0.05, ^**P < 0.01, and ***P < 0.001 indicate significant differences compared to the control group; ⁺⁺⁺P < 0.001 versus the Scop group. MWM, Morris water maze; Scop, scopolamine; EA, ellagic acid; Dnp, donepezil.

As shown in Figs. 8 and 9, scopolamine administration disrupted the activity of antioxidant enzymes, SOD and CAT, as evidenced by a marked reduction in their levels in the cortical and hippocampal tissues of the Scop group. Moreover, a lower activity was found in terms of hippocampal SOD in the Scop + EA25 and Scop + Dnp groups as well as in the cortical tissues of Scop+EA50 compared with the Control animals (Fig. 8A and B). In addition, CAT activity of hippocampal and cortical tissues in Scop + EA25 and Scop + EA50 groups was reduced compared to the control animals (Fig. 9A). In contrast, SOD activity in both hippocampus and cortex, as well as CAT activity in the hippocampus of the Scop + EA25, Scop + EA50, and Scop + Dnp groups noticeably increased compared to the Scop group. Moreover, CAT activity significantly increased in the cortex of the animals that received donepezil compared to the Scop group. The SOD activity in the hippocampus of the group treated with the high dose of EA (50 mg/kg) was significantly higher than that of the Scop + EA25 group (Fig. 8A). Notably, the CAT level in the cortex of Scop + Dnp was higher than that of the Scop + EA25 and Scop + EA50 groups (Fig. 9B).

Fig. 8.

Effects of EA on SOD activity in the (A) hippocampus and (B) cortex. EA significantly increased SOD activity. Data are expressed as mean ± SEM, n = 10. *P < 0.05 and ***P < 0.001 indicate significant differences compared to the control group; +++P < 0.001 versus the Scop group; #P < 0.05 and ###P < 0.001 between the designated groups. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; SOD, superoxide dismutase.

Fig. 9.

Effects of EA on CAT activity in the (A) hippocampus and (B) cortex. EA significantly enhanced CAT activity. Data are expressed as mean ± SEM, n = 10. ***P < 0.001 indicates significant differences compared to the control group; ⁺⁺P < 0.01 and ⁺⁺⁺P < 0.001 versus the Scop group; ^###P < 0.001 between the designated groups. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; CAT, catalase.

EA attenuated6AChE activity in the brain

The activity of AChE enzyme in both the hippocampus and cortex of the Scop group significantly increased compared to the control rats. Also, in the groups treated with Scop + EA25, Scop + EA50, and Scop + Dnp, AChE activity was significantly higher than the control group. However, a significant decrease was observed in the activity of AChE in the hippocampus and cortex of Scop + EA25 and Scop + EA50, and Scop + Dnp groups compared to the Scop group (Fig. 10A and B). In addition, a significant difference was seen between Scop + EA25 and Scop + EA50 as well as Scop + EA25 and Scop + Dnp in terms of AChE activity in the hippocampus (Fig. 10A).

Fig. 10.

Effects of EA on AChE activity in the (A) hippocampus and (B) cortex. EA significantly modulated AChE activity. Data are expressed as mean ± SEM, n = 10. *P < 0.05 and ***P < 0.001 indicate significant differences compared to the control group; ++P < 0.01 and +++P < 0.001 versus the Scop group; ^##P < 0.01 between the designated groups. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; AChE, acetylcholinesterase.

mRNA levels of pro-inflammatory cytokines decreased by EA

A significant increase was observed in the levels of IL-6, TNF-α, and IL-1β mRNA expression in the groups that merely received scopolamine compared to the control group (Fig. 11A-C). Besides, the expression of all three pro-inflammatory factors increased in Scop + EA25 relative to the control group. Moreover, the level of TNF-α significantly increased in Scop + EA50 compared to that in the control group. On the other hand, EA (at 50 mg/kg) and donepezil were able to lower the level of the cytokines compared to the Scop group.

Fig. 11.

Effects of EA on inflammatory and cholinergic gene expression in the hippocampus. qRT -PCR analysis showing reduced mRNA expression of (A) TNF-α, (B) IL-6, and (C) IL-1β. Gene expression was normalized to GAPDH. Data are expressed as mean ± SEM, n = 10. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate significant differences compared to the control group; ⁺P < 0.05 and ⁺⁺P < 0.01 versus the Scop group. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; TNF-α, tumor necrosis factor-α; IL, interleukin; qRT-PCR, quantitative real-time polymerase chain reaction.

EA effects on CHRM1 and AChE mRNA expression

As Fig. 12A presents, CHRM1 mRNA expression significantly decreased in the Scop group compared to the control group. On the other hand, Scop + EA50 and Scop + Dnp groups exhibited greater CHRM1 expression compared to the Scop group.

Fig. 12.

Effects of EA on cholinergic receptor and AChE gene expression in the hippocampus. qRT-PCR analysis showing mRNA expression of (A) CHRM1 and (B) AChE. Gene expression was normalized to GAPDH. Data are expressed as mean ± SEM, n = 10. ^*P < 0.05, ^**P < 0.01, and ^***P < 0.001 indicate significant differences compared to the control group; ⁺P < 0.05 versus the Scop group. Scop, Scopolamine; EA, ellagic acid; Dnp, donepezil; AChE, acetylcholinesterase; CHRM1, muscarinic acetylcholine receptor M1; qRT-PCR, quantitative real-time polymerase chain reaction.

Also, the mRNA expression of AChE enzyme was measured in hippocampal tissues (Fig. 12B). Scopolamine injection significantly increased mRNA expression of AChE compared to the control group. Both EA at 50 mg/kg and donepezil were able to significantly reduce AChE mRNA expression in comparison with the Scop group, while EA at 25 mg/kg was not effective.

DISCUSSION

The present study demonstrated that EA alleviates scopolamine-induced learning and memory deficits, as evidenced by improved performance in the MWM and passive avoidance tasks. These behavioral findings suggest that EA has neuroprotective potential, likely through modulation of cholinergic activity, oxidative balance, and inflammatory mediators.

Consistent with previous reports, scopolamine administration markedly impaired spatial learning and memory, as indicated by prolonged escape latency and increased swimming distance in the MWM, as well as diminished retention in the PA test (6,23,24,25). Scopolamine-induced amnesia is a well-established pharmacological model that mimics cholinergic dysfunction observed in AD (26). Treatment with EA, at both 25 and 50 mg/kg, effectively reversed these deficits, indicating its potential as a cognitive enhancer. Comparable findings have been reported in other models of cognitive dysfunction, where EA administration improved learning performance and memory retention (27,28).

The cholinergic system plays a central role in cognitive processes, and its dysfunction is a hallmark of AD. Scopolamine exerts its amnestic effect primarily by antagonizing muscarinic acetylcholine receptors and increasing AChE activity, which accelerates acetylcholine degradation (29). In our study, scopolamine increased AChE activity and mRNA expression, while reducing CHRM1 expression in the hippocampus in accordance with previous studies (30). EA treatment normalized these changes, demonstrating an AChE-inhibitory effect comparable to donepezil. EA’s ability to restore CHRM1 expression suggests that it may enhance cholinergic signaling at both enzymatic and receptor levels, thereby improving synaptic plasticity and memory function.

In addition to cholinergic modulation, the present findings support a strong link between oxidative stress, inflammation, and memory impairment. Scopolamine administration led to elevated MDA levels and decreased thiol content, SOD, and CAT activities, confirming oxidative stress in brain tissue. EA administration significantly restored these parameters, consistent with its known antioxidant and free radical scavenging properties (31,32). The phenolic structure of EA enables it to neutralize reactive oxygen species and inhibit lipid peroxidation, thus protecting neuronal membranes from oxidative injury.

Moreover, the study revealed that EA reduced the hippocampal expression of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) elevated by scopolamine, indicating suppression of neuroinflammatory responses. These findings align with previous research demonstrating the anti-inflammatory potential of EA through inhibition of NF-κB signaling and microglial activation (27,33). Since acetylcholine also participates in the “cholinergic anti-inflammatory pathway,” restoration of cholinergic tone by EA may further contribute to its anti-inflammatory effects (34).

An additional finding of interest was the elevation of hippocampal BDNF levels following EA treatment. BDNF plays a pivotal role in synaptic plasticity and memory consolidation, and its downregulation is closely associated with cognitive decline in AD (9,35). In line with our findings, BDNF expression is reduced in scopolamine-treated animals (7). The ability of EA to restore BDNF expression suggests a neurotrophic mechanism underlying its protective effects, complementing its antioxidant and anti-inflammatory actions.

The neuroprotective potential of EA may be mediated through modulation of several intracellular signaling pathways that regulate inflammation, oxidative balance, and neuronal survival. Previous studies have demonstrated that EA can suppress activation of the NF-κB pathway, thereby reducing transcription of pro-inflammatory cytokines and attenuating microglial activation (36). Concurrently, EA has been reported to activate the Nrf2/ARE signaling cascade, which enhances the transcription of antioxidant enzymes. More specifically, EA can inhibit Keap1, a negative regulator of Nrf2, leading to Nrf2 accumulation in the nucleus and activation of ARE-dependent transcription of cytoprotective genes. The Keap1-Nrf2-ARE pathway plays a pivotal role in maintaining redox balance and neuronal resilience under oxidative stress (12). In addition, the cAMP response element-binding protein (CREB)-BDNF axis may represent another crucial target of EA (37). By promoting CREB phosphorylation, EA can upregulate BDNF expression, which plays a vital role in synaptic plasticity and memory consolidation (38). The concurrent modulation of these signaling networks could explain the observed restoration of cognitive performance in scopolamine-treated rats.

Although the present findings demonstrate consistent behavioral, biochemical, and transcriptional changes following EA treatment, the study does not establish direct causality between these molecular alterations and cognitive improvement. The observed associations between BDNF levels, cholinergic markers, and behavioral outcomes should therefore be interpreted as correlational. For instance, we only measured hippocampal BDNF concentration at the protein level, and downstream signaling pathways and region-specific cellular localization were not assessed. Future studies employing receptor antagonists, gene knockdown approaches, or protein-level analyses of CHRM1 and downstream signaling pathways (e.g., TrkB/CREB) will be necessary to confirm causal mechanisms.

Several limitations of the present study should be acknowledged. First, the absence of a group merely receiving EA limits the ability to distinguish the independent effects of EA from its interaction with scopolamine; therefore, the findings primarily reflect the modulatory effects of EA under cholinergic challenge. Second, although changes in behavioral performance, oxidative stress markers, inflammatory mediators, and cholinergic-related genes were observed, the proposed mechanisms involving BDNF modulation, cholinergic signaling, and anti-inflammatory pathways are correlative rather than causative. Future studies employing pharmacological antagonists or genetic approaches (e.g., CHRM1 or BDNF/TrkB blockade) will be required to establish direct mechanistic links.

Third, most molecular conclusions rely on mRNA expression analyses, without corresponding protein-level validation for CHRM1, inflammatory cytokines, or AChE activity at the expression level. Although hippocampal BDNF concentration was assessed, downstream signaling pathways and receptor activation were not examined. Additionally, the absence of histological or immunohistochemical analyses precludes conclusions regarding neuronal survival, synaptic integrity, or structural neuroprotection. Consequently, the observed effects of EA should be interpreted as functional and molecular correlates of neuroprotective potential rather than direct evidence of neuronal preservation.

Fourth, the relatively small sample size used for qRT-PCR analysis may limit statistical power and warrants cautious interpretation of gene expression findings. Fifth, locomotor activity was not independently assessed, which may partially influence performance in behavioral tasks. Finally, only male rats were included in this study; therefore, potential sex-specific effects and long-term outcomes of EA treatment remain to be elucidated. Future investigations incorporating both sexes, additional control groups, protein-level validation, histological assessments, and mechanistic interventions will be necessary to confirm and extend these findings.

CONCLUSION

In conclusion, EA ameliorated scopolamine-induced cognitive deficits and was accompanied by improvements in oxidative stress parameters, neuroinflammatory markers, BDNF levels, and cholinergic-related measures. While these findings support a neuroprotective potential for EA, the mechanistic relationships remain putative and warrant further investigation using targeted molecular and pharmacological approaches.

Authors’ contributions

A.H. Assaran carried out the animal treatments and the behavioral tests. A. Rajabian contributed to the biochemical measurements. A.H. Assaran and A. Rajabian contributed equally to this work and share first authorship. Both authors may present this work as first author. F. Mirzavi carried out the experiments on mRNA expression. M. Akbarian contributed to the animal treatments and biochemical measurements. H. Salmani analyzed the data and contributed to writing, reviewing, and editing of the manuscript. F. Beheshti carried out the biochemical measurements. S.H. Rastegar-Moghaddam, R. Saberi, and A. Azadmanesh contributed to the animal treatments and the behavioral tests. M. Hosseini supervised the behavioral experiments, treatments, and tissue collection and contributed to the final writing and editing. All authors have read and approved the finalized article. Each author has fulfilled the authorship criteria and affirmed that this article represents honest and original work.

Conflict of interest statement

The authors declared no conflicts of interest in this study.

AI declaration

Artificial intelligence tools (ChatGPT, OpenAI, GPT-5 model) were used to assist in improving the clarity, grammar, and overall language of the manuscript. The authors reviewed and verified all AI-assisted edits to ensure accuracy and adherence to the scientific content. No AI tool was used for data generation, analysis, or interpretation.

Data availability

The data supporting the findings of this study are documented and available from the corresponding author upon reasonable request. Researchers interested in accessing the data should contact the corresponding author to discuss the terms and conditions of access.