Capmatinib and paclitaxel combination: a novel strategy for overcoming challenges in triple-negative breast cancer treatment

Abstract

Background

Triple-negative breast cancer (TNBC) is an aggressive subtype of breast cancer (BC) with limited treatment options. Paclitaxel (PTX) is commonly used, but its effectiveness is hampered by resistance and metastasis. The c-Met receptor, which is often upregulated in TNBC, promotes tumor progression via the HGF/c-Met axis and downstream PI3K/AKT and MAPK pathways. This study explored whether Capmatinib (CAP), a selective c-Met inhibitor, can enhance PTX efficacy in TNBC.

Methods

MDA-MB-231 and 4T1 TNBC cell lines were treated with PTX and CAP, alone and in combination. Cytotoxicity, apoptosis, and cell cycle effects were assessed via MTT assays and flow cytometry. Cell migration was evaluated via scratch assays. The expression of epithelial–mesenchymal transition (EMT) markers (E-cadherin, vimentin, and Snail) was measured via real-time PCR. In vivo studies in BALB/c mice have evaluated hematological parameters, poor prognostic gene expression (BCL11, FOXC1, FOXM1), histopathology, and survival.

Results

In MDA-MB-231 cells, combination therapy increased PTX cytotoxicity, induced G2/M arrest, increased apoptosis, and suppressed migration. Co-treatment upregulated E-cadherin and downregulated vimentin and Snail. A weak synergistic effect was observed in 4T1 cells. In vivo, co-treatment improved hematological indices, reduced the expression of genes related to poor prognosis, inhibited angiogenesis and necrosis, increased lymphocyte infiltration, and prolonged survival.

Conclusion

CAP enhances the antitumor activity of PTX in TNBC by targeting c-Met-mediated pathways. This combination therapy shows potential to overcome resistance and improve treatment outcomes in TNBC.

Background

Triple-negative breast cancer (TNBC) is a subtype of breast cancer (BC) characterized by the absence of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression [1, 2]. The current standard treatment for TNBC is non-specific chemotherapy, but fewer than 30% of patients achieve a complete therapeutic response. As a result, there is a pressing need for new therapeutic targets to improve treatment outcomes [3]. The molecular heterogeneity of TNBC contributes to its complex treatment resistance, with emerging evidence suggesting that aberrant signaling pathways and tumor microenvironment interactions play critical roles in disease progression [3–5]. Recent investigations have focused on identifying targetable molecular mechanisms, such as PI3K/AKT/mTOR pathway alterations and immune checkpoint interactions, to develop more precise and effective treatment strategies.

Paclitaxel (PTX), a chemotherapeutic agent included in TNBC treatment protocols in NCCN guidelines, primarily inhibits microtubule depolymerization, thereby preventing cell division during mitosis. In addition to its anti-mitotic properties, PTX has demonstrated anti-tumor activity by activating macrophages and inducing apoptosis [6].

One potential target in TNBC is the c-Met receptor, which is more highly expressed in TNBC than in other types of BC. This makes c-Met receptor inhibitors promising options for treating TNBC [7]. c-Met receptor tyrosine kinase is overexpressed and abnormally activated in TNBC, leading to more aggressive tumor phenotypes. As an oncogenic driver in TNBC pathogenesis, the hepatocyte growth factor HGF/c-Met signaling axis represents a potential therapeutic target and molecular biomarker for this BC subtype [8]. The HGF/c-Met pathway also interacts extensively with other oncogenic signaling networks, facilitating key cancer processes such as proliferation, invasion, and angiogenesis, which further amplifies its role in cancer progression [9]. Given these findings, the HGF/c-Met axis has garnered significant attention as a potential target for the development of new cancer therapies [10].

Capmatinib (CAP), a targeted therapy that selectively inhibits aberrantly activated c-Met signaling, has shown clinical potential in Met-mutant non-small cell lung cancer. Given the overexpression of c-Met in TNBC, CAP could offer a promising therapeutic strategy for patients with TNBC harboring molecular vulnerabilities in this pathway [11]. Preclinical studies have demonstrated that CAP effectively suppresses tumor growth and metastasis by disrupting c-Met-mediated signaling cascades in cancer cell lines [12].

Moreover, combination strategies exploring CAP with conventional chemotherapeutic agents may enhance therapeutic efficacy and overcome treatment resistance in TNBC. In this study, we investigated the synergistic effect of combining CAP and PTX to enhance the TNBC treatment response. The study was carried out in two phases: an in vitro assessment using the MDA-MB-231 and 4T1 cell lines, followed by an in vivo evaluation in BALB/c mice.

Methods

Chemicals and reagents

CAP and PTX were purchased from MedChemExpress (United States). 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2 H-tetrazolium bromide (MTT), propidium iodide (PI), and FITC-conjugated Annexin V were obtained from Sigma-Aldrich (St. Louis, MO, USA). DMEM and RPMI-1640 culture media were purchased from Biowest (Nuaille, France). The Master Mix for Real-Time Polymerase Chain Reaction (RT-PCR), Tiozol reagent, and the complementary DNA (cDNA) synthesis kit were sourced from Yekta Tajhiz Azma (Iran), and the primers were synthesized by Pishgam Company (Iran).

Cell culture

The MDA-MB-231 and 4T1 cell lines were obtained from the Pasteur Institute, which serves as the National Cell Bank of Iran (NCBI) in Tehran. MDA-MB-231 (human TNBC) and 4T1 (murine TNBC) cell lines were selected for this study as both are well-established models of aggressive triple-negative breast cancer. Previous reports have shown that these cell lines exhibit high metastatic potential and active c-Met signaling, making them suitable models to investigate the therapeutic efficacy of c-Met inhibition in TNBC [13, 14]. MDA-MB-231 cells were cultured in DMEM, while 4T1 cells were cultured in RPMI-1640 media supplemented with 10% Fetal Bovine Serum (FBS)(Biowest), 100 U/mL penicillin (Biosera), and 100 µg/mL streptomycin (Biosera). The cells were maintained in a humidified atmosphere at 37 °C with 5% CO₂ and 95% humidity. The culture medium was replaced twice a week until 80–90% confluency was reached. At this point, the cells were trypsinized, subcultured for further passages, and stored. All experiments used cells between passages 3 and 6.

Cell viability assay

The antiproliferative effects of PTX, CAP, and their combination were assessed via the MTT assay. 4T1 and MDA-MB-231 cells were seeded at 1 × 10⁴ cells/well in 96-well plates and incubated overnight. The cells were then treated with nine serial dilutions of PTX (starting at 50 µM) and CAP (starting at 240 µM) for 48 h. After treatment, 20 µL of MTT solution (5 mg/mL in PBS) was added, and the mixture was incubated for 4 h. The medium was removed, and 100 µL of DMSO was added to dissolve the formazan crystals. The absorbance was measured at 570/690 nm via a Biochrom Anthos 2020 microplate reader. IC₅₀ values were calculated accordingly.

Drug combination analysis

The IC₅₀ values for each drug, both individually and in combination, were determined to assess potential synergistic effects using the Combenefit software version 2.021 (Cancer Research UK Cambridge Institute, Cambridge, UK), a tool designed to evaluate drug interactions on the basis of synergy, additivity, or antagonism. Drug combinations were tested at concentrations corresponding to 2× IC₅₀, 1× IC₅₀, 0.5× IC₅₀, and 0.25× IC₅₀. Combenefit facilitates drug combination analysis by generating visually interpretable quantitative data through color-coded graphs, tables, and mathematical models based on established reference models, including the Loewe, Bliss, and the Highest Single Agent (HAS) models.

Apoptosis assay

Apoptotic cell death was evaluated via Annexin V and Propidium Iodide (PI) staining, followed by flow cytometric analysis. 4T1 and MDA-MB-231 cells were seeded in 6-well plates at a density of 2 × 10⁵ cells per well and subjected to treatment for 48 h. After incubation, the cells from each group were harvested via trypsinization and washed twice with ice-cold phosphate-buffered saline (PBS). The resulting cell pellets were resuspended in 91 µL of binding buffer, 5 µL of Annexin V was added, and the mixture was incubated for 15 min in the dark at room temperature. Subsequently, 4 µL of PI solution (2 µg/mL) was added immediately before flow cytometric analysis via the BD FACSCalibur system.

Cell cycle analysis

The cell cycle distribution was assessed via PI staining followed by flow cytometry. 4T1 and MDA-MB-231 cells were seeded into 6-well plates at a density of 2 × 10⁵ cells per well. After overnight incubation, the cells were treated for 48 h. For the cell cycle assay, sample preparation followed a protocol similar to that used for the apoptosis assay. After washing with PBS and discarding the supernatant, the cells were fixed in 70% ethanol. To prevent cell clumping caused by ethanol, PBS was first added to prepare the 70% ethanol solution, followed by the gradual dropwise addition of ethanol. The cells were then stored at 4 °C for two h. After centrifugation, 500 µL of PI solution was added to the cell pellet of each sample and incubated at 37 °C in the dark for 30 min. The cells were subsequently washed with PBS, resuspended in 500 µL of PBS, and analyzed via a flow cytometer.

Wound healing assay

4T1 and MDA-MB-231 cells were seeded into 6-well plates at 6 × 10⁵ cells/well and grown to ~ 90% confluence. After being washed with PBS, the cells were serum-starved overnight in 0.5% FBS medium. A linear scratch was made via a sterile 100 µL pipette tip, followed by washing with PBS to remove debris. The cells were then treated with the indicated drugs in 10% FBS medium for 24 h. Images were taken at 0 and 24 h via an Olympus microscope. Wound closure was analyzed via ImageJ, and the migration rate was calculated accordingly.

Real-time PCR

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was employed to assess gene expression levels. The cells were seeded into 6-well plates and treated with PTX, CAP, or their combination for 48 h. Total RNA was isolated via TRIzol reagent, and RNA purity was determined by measuring the absorbance at wavelengths of 260 and 280 nm. For complementary DNA (cDNA) synthesis, 2 µg of RNA was reverse transcribed according to the manufacturer’s instructions. qRT‒PCR was conducted via the use of SYBR Green PCR master mix on a Mic qPCR Cycler (Bio Molecular Systems, Australia). Each reaction mixture contained 2 µM synthesized cDNA, 0.5 µL of forward primer, 0.5 µL of reverse primer, 7 µL of PCR master mix, and 4 µL of nuclease-free water. The thermal cycling conditions included an initial denaturation step at 95 °C for 5 min, followed by 40 amplification cycles consisting of denaturation at 95 °C for 20 s, annealing at 61 °C for 30 s, and extension at 72 °C for 30 s. All reactions were performed in triplicate, and gene expression was quantified via the 2^−ΔΔCT method, with untreated samples serving as the reference group. Table 1.

Table 1.

The sequences of primers for real time PCR

Target gene	Primer sequence		Size of product (bp)
In Virto
snail 1 (human)	Forward Reverse	TCGGAAGCCTAACTACAGCG AGATGAGCATTGGCAGCGAG	140
E-cadherin (human)	Forward Reverse	CATTGCAACATACACTCTCTTCTC TCTGTGGCTGTGACCTCC	192
vimentin (human)	Forward Reverse	CTAACCAACGATAAAGCCCGC ACGCATTGTCAACATCCTGTC	151
gapdh (human)	Forward Reverse	GAAGGTGAAGGTCGGAGTCAAC CAGAGTTAAAAGCAGCCCTGG	176
snail 1 (mouse)	Forward Reverse	GGACGAGTGTGTGGAGTTCA GCTTTTGCCACTGTCCTCATC	229
E-cadherin (mouse)	Forward Reverse	CTGCTGCTCCTACTGTTTCTACG TGGCTCAAATCAAAGTCCTGGTC	140
vimentin (mouse)	Forward Reverse	ACATCATACGGCTGCGAGAG GACTTGCTGTTCCTGAATCTGG	221
gapdh (mouse)	Forward Reverse	GGTCGGTGTGAACGGATTTG TCTCGGCCTTGACTGTGC	176
In Vivo
BCL11A (mouse)	Forward Reverse	CCGCAAACAGGAACACATAG GCTGGGCTCATCTTTACAAATAC	142
FOXC1 (mouse)	Forward Reverse	GCTACATCGCTCTTATCACCAT GCCCTGCTTATTGTCCCG	119
FOXM1 (mouse)	Forward Reverse	CCCAGCCTCAAGCCCACA CGCCTCACCACCAGCATAG	155
gapdh (mouse)	Forward Reverse	GGTCGGTGTGAACGGATTTG TCTCGGCCTTGACTGTGC	176

In vivo experiments

The animal experiments were approved by the Animal Research Committee of Tehran University of Medical Sciences (Ethics code: IR.TUMS.MEDICINE.REC.1400.573) and were performed in accordance with established guidelines. Forty-five female BALB/c mice (6–8 weeks old; weighing 18–20 g) were obtained from Royan Institute (Tehran, Iran), maintained for 7 days in temperature- and humidity-controlled, pathogen-free rooms under a 12:12-h light/dark cycle, and provided standard laboratory food and water ad libitum.

Mouse 4T1 tumor model

Female BALB/c mice were subcutaneously injected with 1 × 10⁶ 4T1 cells suspended in 200 µl of RPMI into the right flank. After 7 days, when the tumor volume reached approximately 100 mm³, the mice were randomly divided into five groups (n = 9/group): control, PTX (5 mg/kg, IP every 4 days), CAP (10 mg/kg, oral daily), PTX + CAP (5 mg/kg), and PTX + CAP (10 mg/kg). Five mice per group were used for the main study, and four were used for survival analysis. Body weight and tumor size were monitored every other day and every four days, respectively. The tumor volume was calculated via the following formula:

After 20 days of treatment, the mice were euthanized via CO₂ inhalation, and the tumors were harvested. The samples were fixed in 10% formalin (Merck, Germany), embedded in paraffin, and sectioned at 3 μm thickness for H&E staining. Pathological assessments and total RNA extraction were performed to analyze FOXC1, FOXM1, and BCL11 mRNA expression via RT‒PCR.

Tissue staining

Tumor tissue sections were prepared from paraffin-embedded samples of a 4T1 murine BC syngeneic model to analyze tumor morphology via H&E staining. The paraffin was removed via a graded xylene series, followed by rehydration via a graded ethanol series. Briefly, the samples were fixed, stained with Hematoxylin and Eosin (H&E), and visualized under a microscope. (Olympus, IX73). H&E staining enabled the determination of the morphological features of the tumors.

RT‒PCR

Tumor tissues were excised from BALB/c mice and processed for RNA extraction. The samples were homogenized via a tissue homogenizer in an appropriate lysis buffer containing RNase inhibitors. Total RNA was extracted according to the manufacturer’s protocol, including the steps of tissue disruption, cell lysis, and removal of proteins and genomic DNA. Total RNA was extracted for RT‒PCR analysis of FOXC1, FOXM1 and BCL11 mRNA expression. RT‒PCR was performed as described previously. (sequences provided in Table 1)

Analysis of hematological parameters

At least 100 µL of whole blood was collected from BALB/c mice via retro-orbital sinus bleeding under anesthesia. Blood samples were collected into EDTA-coated tubes and stored at 4 °C until further analysis. The samples were assayed via an MC-6500 auto hematology analyzer (Sysmex XS‑800i).

Statistical analysis

The experimental data were statistically analyzed via GraphPad Prism 8 and are presented as the means ± SDs of at least three independent experiments. Statistically significant differences were determined via one-way ANOVA followed by a Student‒Newman‒Keuls post hoc test. A P value of < 0.05 was considered statistically significant.

Results

Evaluation of PTX and CAP cytotoxicity in 4T1 and MDA-MB-231 breast cancer cells

The MTT assay results indicated that PTX inhibited the viability of BC cells in a concentration-dependent manner. The calculated IC₅₀ values for PTX after 48 h of treatment were 2.5 ± 0.3 µM for the MDA-MB-231 cells and 3.0 ± 0.4 µM for the 4T1 cells. The findings also confirmed that CAP reduced the viability of MDA-MB-231 cells in a dose-dependent manner, with an IC₅₀ value of 90 ± 2.4 µM. However, CAP did not significantly inhibit the growth of 4T1 cells. The MTT assay results for PTX and CAP are presented in Fig. 1a.

Fig. 1.

a Cytotoxic effects of PTX and CAP on the viability of 4T1 and MDA-MB-231 cells after 48 h of treatment. b Isobologram analysis and synergy determination of combination therapy for PTX and CAP on MDA-MB-231 and 4T1 cells using Combenefit software. A stronger synergistic effect was observed in MDA-MB-231, while a weaker synergy was detected in 4T1. Cell viability is plotted as percent of control (n = 3 experiments)

Effects of combined concentrations of CAP and PTX on the viability of 4T1 and MDA-MB-231 cells

Co-treatment with CAP and PTX for 48 h demonstrated differential effects on BC cell viability as assessed by MTT assay. In MDA-MB-231 cells, specific combination doses exhibited significant growth inhibition without antagonistic interactions. Notably, 0.625 µM PTX combined with 90–180 µM CAP and 1.25 µM PTX combined with 22.5–90 µM CAP significantly reduced cell viability compared with the control and single-agent PTX treatments. These findings suggest that CAP enhances chemosensitivity to PTX in MDA-MB-231 cells. Conversely, 4T1 cells showed a limited synergistic response, with only 45 µM CAP potentiating the effects of 0.75 µM PTX. Other dose combinations in 4T1 cells failed to demonstrate synergism, with some exhibiting antagonistic effects. These results indicate that cell line-specific differences in CAP-PTX combination efficacy exist. Overall, CAP has potential as a chemosensitizer for PTX in specific breast cancer models. Figure 1b.

Effect of combination treatment on apoptosis and cell cycle of 4T1 and MDA-MB-231 cells

Flow cytometric analysis via Annexin V-FITC/PI staining revealed distinct apoptotic responses between the cell lines following CAP-PTX co-treatment. In 4T1 cells, PTX (0.75 µM) alone increased the percentage of apoptotic/necrotic populations to 21.2 ± 1.5% versus 5.24 ± 0.6% in the controls. The combination treatment demonstrated complex cellular responses, showing reduced apoptosis but increased necrosis, with total cell death increasing to 37.7 ± 2.5%. In MDA-MB-231 cells, PTX (1.25 µM) induced 22.24 ± 3% apoptosis/necrosis compared with 9.37 ± 0.4% in control cells. Notably, the CAP-PTX combination dramatically increased cell death to 31.81 ± 2.5%, indicating that the combination potentiated apoptotic mechanisms in this cell line. Figure 2a and b.

Fig. 2.

Investigation of apoptosis and necrosis after 48 h of drug treatment using Annexin V–FITC/PI flow cytometry. a 4T1 cells treated with PTX (0.75 µM), CAP (45 µM), or their combination. b MDA-MB-231 cells treated with PTX (1.25 µM), CAP (45 µM), or their combination. In 4T1 cells, the combination increased total cell death (37.7 ± 2.5%) mainly through necrosis, whereas in MDA-MB-231 cells, co-treatment markedly enhanced apoptosis (31.81 ± 2.5%), indicating potentiation of PTX-induced apoptotic mechanisms. Data are presented as mean ± SD (n = 3); two-way ANOVA: ****P < 0.0001, **P < 0.01, *P < 0.05 vs. control; ####P < 0.0001, ###P < 0.001 vs. PTX

Cell cycle distribution analysis revealed differential effects of the CAP-PTX combination on G2/M arrest. In 4T1 cells, while PTX induced significant G2/M arrest, the combination resulted in similar G2/M percentages (18 ± 2% increase) without a significant difference from those of PTX alone. However, the percentage of the sub-G1 population significantly increased to 28 ± 3.4% in combination versus 16 ± 0.4% in combination with PTX alone, reflecting increased cell death. Conversely, MDA-MB-231 cells exhibited pronounced synergistic G2/M arrest with combination treatment (36.45 ± 6.55%) compared to compared with control (12.23 ± 2.4%), PTX alone (15.9 ± 3.2%), and CAP alone (11.66 ± 2.74%), demonstrating enhanced cell cycle blockade through CAP-PTX synergy. Figure 3a and b.

Fig. 3.

Investigation of the cell cycle after 48 h of drug treatment: (a) 4T1 cells treated with PTX (0.75 µM), CAP (45 µM), and their combination analyzed via PI staining; (b) MDA-MB-231 cells treated with PTX (1.25 µM), CAP (45 µM), and their combination. In 4T1 cells, PTX induced G2/M arrest, while the combination increased the sub-G1 population, indicating enhanced cell death. In MDA-MB-231 cells, the combination markedly increased G2/M arrest compared with single treatments, demonstrating synergistic cell cycle blockade. Data are shown as mean ± SD (n = 3); two-way ANOVA: ****P < 0.0001, ***P < 0.001, **P < 0.01 vs. control; ##P < 0.01, #P < 0.05 vs. PTX

Effects of combination treatment of PTX and CAP on migration of 4T1 and MDA-MB-231 cells

A scratch assay was conducted to assess cell migration, and wound closure percentages were calculated via ImageJ and analyzed via Prism software. Treatment with 0.75 µM PTX significantly reduced migration in 4T1 cells by 74.1 ± 4.6%, and the combination of PTX and CAP further reduced migration to 87.1%. In MDA-MB-231 cells, PTX alone and in combination reduced migration by 61% and 91%, respectively. CAP alone had no significant effect on 4T1 cell migration but decreased MDA-MB-231 cell migration by 16%. The results are presented in Fig. 4.

Fig. 4.

Migration analysis of cells under drug treatment. a Scratch assay of 4T1 cells treated with PTX (0.75 µM), CAP (45 µM), or their combination. b MDA-MB-231 cells treated with PTX (1.25 µM), CAP (45 µM), or their combination after 24 h. The combination treatment markedly reduced cell migration in both cell lines compared with PTX alone, while CAP alone showed minimal effect. Statistical significance was determined using two-way ANOVA: ****P < 0.0001, **P < 0.01 vs. control; ####P < 0.0001 vs. PTX. (n = 3; magnification: 100×)

Investigating the expression of EMT pathway genes in MDA-MB-231 and 4T1 cells treated with PTX and CAP

The expression of Snail, Vimentin, and E-cadherin, key genes involved in the EMT process, was evaluated via real-time PCR and normalized to GAPDH. Figure 5 shows that PTX induced the expression of mechynshimal genes (snail and vimentin) in both cell lines. However, in MDA-MB-231 cells, the combination of PTX and CAP decreased the expression of snail and vimentin and increased the expression of E-cadherin significantly. These results indicate that co-treatment of CAP and PTX improves the ability of PTX to inhibit the EMT process and thus inhibit the metastasis of MDA-MB-231 cells. In 4T1 cells, the combination showed synergism, as it reduced the mechynshimal gene levels but did not increase the expression of E-cadherin. These results suggest that combination therapy, despite not having a positive effect on the expression of E-cadherin, caused a relative improvement in EMT inhibition. As a result, it can have a weak effect on the inhibition of the metastasis ability of 4T1 BC cells.

Fig. 5.

Expression changes of EMT-related genes after 48 h of treatment. a 4T1 cells treated with PTX (0.75 µM), CAP (45 µM), or their combination. b MDA-MB-231 cells treated with PTX (1.25 µM), CAP (45 µM), or their combination. PTX increased Snail and Vimentin expression, while co-treatment with CAP reduced these genes and elevated E-cadherin in MDA-MB-231 cells, indicating enhanced EMT inhibition. In 4T1 cells, the combination reduced mesenchymal markers but did not increase E-cadherin. Data are presented as mean ± SD (n = 3); two-way ANOVA: ****P < 0.0001, ***P < 0.001, **P < 0.01 vs. control; ####P < 0.0001, ###P < 0.001 vs. PTX

Anti-tumor effects of simultaneous administration of CAP and PTX in an in-vivo model

We evaluated the effect of combination treatment with CAP and PTX in a 4T1 tumor model. The mice were weighed every other day, and the tumor size was measured every four days until day 21. As shown in Fig. 6a, statistical analysis of the tumor volume on day 21 revealed that, compared with the control, PTX significantly reduced the tumor volume (P = 0.0039). Furthermore, the addition of CAP (5 mg/kg) to PTX enhanced its ability to reduce tumor volume (P < 0.0001). Additionally, exposure to PTX and CAP alone, as well as in combination, did not affect the weight of the mice (Fig. 6b). As shown in Fig. 6c, mouse survival was monitored for 51 days across different groups, and the results indicated that the combination treatment (PTX and 10 mg/kg CAP) significantly improved survival compared with that of the control group.

Fig. 6.

Effects of PTX and CAP treatments in the 4T1 tumor model: a Tumor volume significantly decreased with PTX treatment (P = 0.0039), and further reduction was observed with PTX + CAP (5 mg/kg) (P < 0.0001). b No significant body weight changes were detected among groups. (c) Kaplan–Meier analysis showed that PTX + CAP (10 mg/kg) improved survival compared with the control. Each group included nine mice; five were used for assays and four for survival analysis

Pathological examination of cancer tissue in the studied groups

H&E staining was used to evaluate necrosis, the mitotic count, nuclear pleomorphism, and tumor angiogenesis, which are factors associated with tumor progression. An effective treatment is expected to reduce these indicators. The control group presented moderate necrosis, which was slightly reduced by PTX; CAP presented the greatest degree of necrosis, whereas the combination treatment reduced it. The mitotic count was highest in the control and CAP groups but decreased in the combination treatment groups (blue arrow). Nuclear pleomorphism was most evident in the CAP and low-dose combination groups (orange arrow). CAP also had the greatest effect on tumor angiogenesis (red arrow) and lymphocyte infiltration. The other groups showed no significant differences in these two factors. Combination treatments, particularly 10 mg/kg, effectively reduced all pathological markers. The results are illustrated in Fig. 7a.

Fig. 7.

Effect of drug treatments on cancer tissue: a Representative H&E-stained tumor sections showing necrosis, mitotic activity, nuclear pleomorphism, and angiogenesis as indicators of tumor progression. Combination treatments, particularly at 10 mg/kg, effectively reduced these pathological markers compared with the control and single-drug groups (red arrow: angiogenesis; orange arrow: nuclear pleomorphism; blue arrow: mitotic count). b Gene expression levels of BCL11, FOXC1, and FOXM1 were evaluated by qRT-PCR and normalized to GAPDH. Compared with the control, PTX increased the expression of these genes, while the combined treatment with PTX and a higher CAP dose (10 mg/kg) significantly reduced their expression, indicating that CAP, particularly at higher doses, counteracts the PTX-induced upregulation of these tumor-promoting genes (###P < 0.001 and ####P < 0.0001 compared with the PTX group)

The effect of different treatments on the expression of FOXC1, FOXM1 and BCL11 genes in cancer tissue cells

Gene expression levels of BCL11, FOXC1, and FOXM1 were evaluated by qRT-PCR and normalized to GAPDH. Compared with the control, PTX increased BCL11, FOXC1, and FOXM1 expression. However, compared with PTX alone, combined treatment with PTX and a higher CAP dose (10 mg/kg) significantly decreased the expression of these genes. (Fig. 7b). These results show that while PTX treatment alone significantly increases the expression of these genes, the addition of CAP, especially at a higher dose of 10 mg/kg, inhibits and moderates the PTX-induced effect of increasing the expression of these genes in the tumor tissue.

Hematological parameters

Hematological analysis revealed several notable findings across the experimental groups. Neutrophil counts were not significantly different among the groups. Platelet levels exhibited significant alterations, with both the PTX and CAP groups demonstrating marked reductions compared with the control group. While the combination groups also presented reduced platelet levels relative to those of the control, these changes were not statistically significant. Red blood cell (RBC) and white blood cell (WBC) counts revealed distinctive patterns. Compared with the control group and the PTX group, the PTX 5 mg/kg + CAP 5 mg/kg group presented statistically significant reductions in both RBC and WBC counts, indicating a pronounced effect of the combined treatment. Table 2.

Table 2.

Evaluation of PTX, CAP, and their combination on hematological parameters in female Balb/c mice

	Control	PTX 5 mg/kg	CAP 10 mg/kg	PTX 5 mg/kg + CAP 5 mg/kg	PTX 5 mg/kg + CAP 10 mg/kg
RBC, 106/µL	7.01 ± 0.2	7.47 ± 0.2	8.5 ± 0.5	5.45 ± 0.2	7.46 ± 0.1
WBC, 103/µL	7 ± 0.2	7 ± 0.1	7.4 ± 0.3	5.4 ± 0.3	7.4 ± 0.2
Hemoglobin, g/dL	10.1 ± 0.1	10.4 ± 0.1	12.6 ± 0.3	7.9 ± 0.1	11.2 ± 0.3
Hematocrit, %	35.1 ± 0.5	36.3 ± 0.7	44.2 ± 1.1	27.5 ± 0.2	39.3 ± 0.6
PLT, 103/µL	761 ± 31	587 ± 16	493 ± 22	646 ± 52	714 ± 15
Neutrophils, %	83 ± 8	80 ± 4	89 ± 4	87 ± 9	86 ± 3
Lymphocyte, %	18	20	10	12	15
Monocyte, %	1	*	*	*	1
M.C.V, fL	50.2 ± 1.1	48.7 ± 1.2	52.0 ± 1.0	50.5 ± 1.1	52.8 ± 0.9
M.C.H, pg	14.5 ± 0.3	14.0 ± 0.2	14.9 ± 0.3	14.6 ± 0.3	15.1 ± 0.2
M.C.H.C, g/dL	29.1 ± 0.5	28.3 ± 0.5	30.5 ± 0.4	29.5 ± 0.4	31.0 ± 0.3

PLT Platelet, M.C.V Mean Corpuscular Volume, M.C.H Mean Corpuscular Hemoglobin, M.C.H.C Mean Corpuscular Hamoglobin Concentration

*Not detected

Discussion

TNBC is an aggressive subtype characterized by the absence of ER, PR, and HER2, leading to poor prognosis and limited treatment options [15].

PTX remains a cornerstone therapy, but resistance and toxicity, such as neuropathy, hypersensitivity, and myelosuppression, hinder its efficacy [16]. By simultaneously targeting multiple survival pathways, combination therapy is a promising strategy for overcoming resistance [16, 17].

c-Met signaling pathways, including the Ras/Raf/MAPK, PI3K/AKT, and Jak/STAT pathways, play critical roles in TNBC progression by promoting EMT, metastasis, and therapeutic resistance [18]. EMT, which is partially regulated by c-Met, enhances invasion and metastasis by shifting cancer cell morphology from epithelial to mesenchymal, increasing motility and metastatic capacity [8, 19]. This transition involves E-cadherin downregulation and the upregulation of transcription factors such as Snail, Slug, Twist1, ZEB1, and ZEB2, contributing to aggressive phenotypes in TNBC models such as MDA-MB-231 [20]. Given the involvement of c-Met in tumor progression, selective inhibitors such as CAP offer therapeutic promise [9]. CAP, an FDA-approved c-Met inhibitor for lung cancer, acts at the ATP-binding site to block downstream oncogenic signaling [10]. This study assessed the potential synergy of CAP and PTX in TNBC. PTX exhibited dose-dependent cytotoxicity (IC₅₀: 2.5 ± 0.3 µM for MDA-MB-231 cells, 3 ± 0.4 µM for 4T1 cells), whereas CAP selectively reduced MDA-MB-231 viability (IC₅₀: 90 ± 2.4 µM), with limited effects on 4T1 cells.

These results underscore the molecular heterogeneity of TNBC, as not all models exhibit equal sensitivity to c-Met inhibition. Previous studies reported similar trends; for example, cabozantinib effectively inhibited MDA-MB-231 cells (IC₅₀ = 1.68 µM) but was less potent against MDA-MB-468 cells (IC₅₀ = 8.89 µM) [14]. This variability suggests that differential c-Met expression and signaling influence the therapeutic response. Studies have also shown that TNBC cells with elevated c-Met expression respond more favorably to targeted therapies, whereas others develop resistance via alternative pathways. Similarly, MDA-MB-231 cells with high c-Met activity are sensitive to CAP, whereas 4T1 cells, which are likely dependent on compensatory mechanisms, exhibit a limited response [14].

Co-treatment with CAP and PTX significantly enhanced the chemosensitivity of MDA-MB-231 cells. Compared with PTX monotherapy, combination treatments resulted in stronger inhibitory effects, reinforcing the therapeutic potential of c-Met inhibition in TNBC treatment. The effect of CAP aligns with previous studies on PTX resistance, where resistant MDA-MB-231 cells activated alternative survival pathways that could be disrupted through combination therapies [21]. These findings support our observation that CAP may increase PTX chemosensitivity by disrupting resistance mechanisms, reinforcing its therapeutic potential. However, in 4T1 cells, combination therapy showed weak synergy, with only 45 µM CAP enhancing 0.75 µM PTX, while other doses had no significant effect. Certain combinations exhibited antagonistic effects, reinforcing the variability in c-Met dependency among TNBC subtypes.

4T1 cells appear to rely on alternative survival mechanisms, including epithelial adaptation, immune evasion, and the activation of non-c-Met pathways, such as the NF-κB, STAT3, and Wnt/β-catenin signaling pathways, enabling continued proliferation and metastasis despite c-Met inhibition. This molecular plasticity could explain why CAP failed to induce strong cytotoxic effects in 4T1 cells and why only select doses exhibited weak synergy with PTX [22]. Given that 4T1 cells exhibit distinct regulatory patterns, future research should explore alternative combination therapies that target their unique resistance mechanisms.

The combination of CAP and PTX resulted in distinct cell death responses in TNBC models. Co-treatment with CAP and PTX significantly enhanced apoptosis in MDA-MB-231 cells, nearly doubling the apoptotic rate (51.81% vs. 22.24% for PTX alone). This synergistic effect highlights the ability of CAP to sensitize TNBC cells to chemotherapy-induced cell death, reinforcing the therapeutic value of c-Met inhibition in regulating apoptosis.

c-Met inhibition interferes with critical survival pathways, such as the PI3K/AKT and MAPK pathways, which are pivotal in TNBC progression and therapy resistance. The disruption of these pathways by CAP likely contributed to the observed increase in the number of apoptotic cells [23]. Similarly, doxazosin (DOXA), a dual c-Met/EGFR inhibitor, induces apoptosis by activating caspases and inhibiting AKT, MEK/ERK, and JAK/STAT3 signaling, supporting the role of c-Met in TNBC survival [24]. Notably, treatment responses varied among the cell lines: MDA-MB-231 cells exhibited increased apoptosis, whereas 4T1 cells presented increased necrosis. This difference may be due to distinct apoptotic regulation. MDA-MB-231 cells retain active apoptotic machinery, including the BAX, BNIP3, and caspase pathways. In contrast, 4T1 cells demonstrate resistance through impaired apoptosis, which is likely influenced by high CD44 levels and mitochondrial dysfunction [25].

PTX induced G2/M phase arrest in both TNBC cell lines, reflecting its role in stabilizing microtubules and disrupting mitosis [26]. The combination treatment markedly increased G2/M arrest in MDA-MB-231 cells (36.45%), indicating enhanced mitotic inhibition and the potential for improved tumor suppression. In 4T1 cells, however, the combination had a limited effect on G2/M arrest but significantly elevated the sub-G1 population (28%), suggesting that apoptosis was the primary effect. These differences align with reports of TNBC subtype-specific cell cycle responses and c-Met expression variability [27]. Oleocanthal, a natural c-Met inhibitor, disrupts the G1/S transition and inhibits TNBC invasion, supporting the role of CAP in cell cycle modulation [28]. Thus, CAP contributes to apoptosis and mitotic arrest in MDA-MB-231 cells, whereas necrosis predominates in 4T1 cells, indicating differential death pathways.

Cell migration is critical in metastasis, driving cancer dissemination. The scratch assay demonstrated significant inhibition of 4T1 (74.11%) and MDA-MB-231 (61%) cells with PTX alone, while co-treatment further reduced migration to 87.1% and 91%, respectively, indicating a strong synergistic effect. Previous studies have confirmed that c-Met inhibitors such as cabozantinib effectively reduce TNBC cell migration [14, 29].

Real-time PCR analysis elucidated the regulatory impact of PTX and CAP on EMT in breast cancer models. EMT is a pivotal process in tumor progression and metastasis and is characterized by changes in key markers such as vimentin, Snail, and E-cadherin. Vimentin supports cytoskeletal remodeling and invasion [30], Snail suppresses E-cadherin transcription, and E-cadherin loss disrupts cell‒cell adhesion, enhancing migratory potential [31]. The transcription factors FOXC1, FOXM1, and BCL11A further drive EMT by promoting cell motility and tumor aggressiveness [32–34], primarily through the Wnt/β-catenin and TGF-β signaling pathways [35–37]. In vitro, PTX monotherapy increased vimentin and Snail expression, whereas in vivo, PTX upregulated FOXC1, FOXM1, and BCL11A, suggesting paradoxical EMT induction despite its cytotoxic effects. This finding is consistent with studies linking PTX to EMT activation via NF-κB signaling, ROS generation, and TGF-β pathway engagement [38–40].

CAP co-treatment mitigated these effects by downregulating Snail and vimentin and upregulating E-cadherin in MDA-MB-231 cells, thus reversing PTX-induced EMT. In vivo, CAP (10 mg/kg) also significantly suppressed FOXC1, FOXM1, and BCL11A expression. These results align with evidence that c-Met inhibition modulates EMT; for example, procaine has been shown to reduce the expression of mesenchymal markers and restore epithelial traits via c-Met modulation [41]. In 4T1 cells, while combination therapy reduced mesenchymal gene expression, it did not significantly restore E-cadherin, possibly reflecting intrinsic EMT regulation in more aggressive TNBC phenotypes. Nonetheless, the ability of CAP to suppress mesenchymal markers underscores its value as an EMT-targeting agent and adjunct to PTX therapy in specific TNBC models.

Combination therapy with CAP and PTX in the 4T1 TNBC model significantly suppressed tumor growth and extended survival, underscoring the therapeutic value of c-Met inhibition in chemotherapy-resistant breast cancer. PTX alone reduced tumor volume (P = 0.0039), whereas CAP (5 mg/kg) further enhanced this effect (P < 0.0001), highlighting its role in sensitizing tumors to chemotherapy. Previous studies on cabozantinib confirmed that c-Met blockade disrupts key survival pathways and reduces the tumor burden with limited toxicity, supporting the utility of CAP in combined regimens [42]. Importantly, CAP + PTX did not result in significant weight loss, indicating good tolerability. Similarly, DOXA, a dual c-Met/EGFR inhibitor, suppressed TNBC metastasis and angiogenesis without hepatic or renal toxicity, reinforcing the safety of c-Met–targeted therapies [24].

Compared with those of control mice, long-term survival monitoring (up to 51 days) revealed significantly improved survival rates in mice treated with CAP + PTX (10 mg/kg). Studies analyzing TNBC drug resistance mechanisms predict that combination therapies targeting multiple pathways yield enhanced survival benefits, particularly in chemoresistant tumor models [43]. The ability of CAP to interfere with oncogenic c-Met signaling and EMT-related survival mechanisms likely contributes to its therapeutic impact, as observed in models treated with DOXA, where c-Met inhibition led to prolonged survival.

H&E staining revealed key histopathological differences among the treatment groups. CAP (10 mg/kg) induced extensive necrosis and increased the number of mitotic figures, nuclear pleomorphism, and angiogenesis, indicating significant tumor remodeling but limited therapeutic efficacy. These findings align with studies suggesting that targeted monotherapies can induce adaptive resistance, often via hypoxia-driven compensatory mechanisms [44]. CAP-induced necrosis may result from hypoxic stress caused by MET inhibition, which disrupts survival pathways but concurrently activates HIF-1α, promoting angiogenesis and selecting aggressive tumor phenotypes [45]. The associated increase in angiogenesis and nuclear atypia supports this adaptive remodeling. Moreover, MET inhibition can activate alternative RTKs and PI3K/AKT signaling, contributing to therapeutic escape and increased mitotic activity [46]. Enhanced nuclear pleomorphism likely reflects genomic instability driven by hypoxia or oxidative stress. PTX (5 mg/kg) modestly reduced necrosis and mitotic activity, supporting its cytotoxic efficacy. Combination therapy results in the most pronounced reduction in necrosis, mitotic count, and pleomorphism, suggesting that PTX mitigates CAP-induced compensatory proliferation by stabilizing microtubules and suppressing PI3K/AKT signaling [47]. Notably, elevated TILs observed in the CAP group suggest necrosis-induced immune activation [48], whereas their persistence in combination groups implies synergistic immunogenic effects without promoting inflammation-related tumor progression [49].

These findings highlight the superiority of combination therapy in reducing key tumor progression markers. Further exploration of the mechanisms underlying these effects could clarify how CAP and PTX interact at the molecular level to modulate tumor progression. Additionally, considering the role of TILs in response to treatment, future investigations may focus on the immunological aspects of tumor regression to optimize therapeutic strategies.

Hematological analysis revealed systemic effects of PTX and CAP, both individually and in combination. Platelet reduction across treatment groups suggests an impact on thrombopoiesis, which aligns with PTX-induced bone marrow suppression. However, the decrease in platelet count in the combination treatment group was not statistically significant compared with that in the PTX alone group, possibly indicating a modulating effect of CAP. The PTX 5 mg/kg + CAP 5 mg/kg group presented significant reductions in RBC and WBC counts, suggesting intensified hematological suppression. This could reflect an additive or synergistic myelosuppressive effect, potentially involving the interaction of CAP with PTX-induced bone marrow toxicity or alternative immune modulation mechanisms.

We acknowledge that our study is limited by the lack of protein-level validation of C-Met and related downstream pathways, as well as apoptosis and cell cycle markers. Moreover, the use of only two TNBC cell lines and the absence of additional in vivo validation (e.g., IHC staining of tumor progression markers) restrict the generalizability of the findings. These aspects warrant further investigation to provide a more comprehensive understanding.

Conclusion

Overall, this study highlights the synergistic potential of CAP and PTX in TNBC treatment. CAP counteracts PTX-induced EMT, restoring E-cadherin, reducing mesenchymal markers, and enhancing chemotherapy sensitivity, particularly in MDA-MB-231 cells. CAP + PTX significantly increased apoptosis, disrupted c-Met-driven survival pathways, and prolonged survival in murine models (P < 0.0001), demonstrating enhanced tumor suppression with minimal systemic toxicity. Histopathological analysis further revealed that combination therapy mitigated the expression of tumor progression markers while supporting antitumor immunity. These findings underscore the importance of tailored strategies for TNBC, where combination regimens help overcome resistance mechanisms and optimize treatment efficacy. Future research should refine targeted interventions by exploring tumor heterogeneity, survival pathways, and immunological responses to improve patient outcomes.

Abbreviations

TNBC

Triple-negative Breast Cancer

BC

Breast Cancer

PTX

Paclitaxel

CAP

Capmatinib

EMT

Epithelial–Mesenchymal Transition

ER

Estrogen Receptor

PR

Progestron Receptor

HER2

Human Epidermal Growth Factor Receptor 2

MTT

3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2 H-tetrazolium bromide

PI

Propidium Iodide

RT-PCR

Real-Time Polymerase Chain Reaction

qRT-PCR

Quantitative Real-Time Polymerase Chain Reaction

NCBI

National Cell Bank of Iran

FBS

Fetal Bovine Serum

PBS

Phosphate-buffered Saline

cDNA

Complementary DNA

H&E

Hematoxylin and Eosin

RBC

Red blood cell

WBC

Red blood cell

PLT

Platelet

M.C.V

Mean Corpuscular Volume

M.C.H

Mean Corpuscular Hemoglobin

M.C.H.C

Mean Corpuscular Hemoglobin Concentration

DOXA

Doxazosin

Authors’ contributions

Ahmad Habibian Sezavar, Fatemeh Fakhari, and Seyed Nasser Ostad were responsible for formulating the hypothesis, conducting the investigation, collecting the data, and drafting the primary sections of the manuscript. Vahideh Montazeri, Amir Shadborestan, Mohammad Abdollahi, and Omid Sabzevari contributed significantly to the investigation process, the design of figures and tables, and the content and grammatical revisions of the manuscript. Abbas Kebriaeizadeh and Ruhollah Hosseini played key roles in drafting, reviewing, and refining the final manuscript, including the design of figures and tables, alongside content and language editing. Shima Aliebrahimi and Seyed Nasser Ostad were involved in the conceptualization of the hypothesis, provided overall supervision, and ensured the accuracy and integrity of the manuscript prior to its submission.

Funding

This work was supported by Tehran University of Medical Sciences (TUMS) [grant numbers 58197, 54714, 51322]. The funding organization had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data availability

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.