Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2002 Oct 1;30(19):4176–4185. doi: 10.1093/nar/gkf532

Human Mcm proteins at a replication origin during the G1 to S phase transition

Daniel Schaarschmidt 1,a, Eva-Maria Ladenburger 1, Christian Keller 1, Rolf Knippers 1
PMCID: PMC140533  PMID: 12364596

Abstract

Previous work with yeast cells and with Xenopus egg extracts had shown that eukaryotic pre-replication complexes assemble on chromatin in a step-wise manner whereby specific loading factors promote the recruitment of essential Mcm proteins at pre-bound origin recognition complexes (ORC with proteins Orc1p–Orc6p). While the order of assembly—Mcm binding follows ORC binding—seems to be conserved in cycling mammalian cells in culture, it has not been determined whether mammalian Mcm proteins associate with ORC-bearing chromatin sites. We have used a chromatin immunoprecipitation approach to investigate the site of Mcm binding in a genomic region that has previously been shown to contain an ORC-binding site and an origin of replication. Using chromatin from HeLa cells in G1 phase, antibodies against Orc2p as well as antibodies against Mcm proteins specifically immunoprecipitate chromatin enriched for a DNA region that includes a replication origin. However, with chromatin from cells in S phase, only Orc2p-specific antibodies immunoprecipitate the origin-containing DNA region while Mcm-specific antibodies immunoprecipitate chromatin with DNA from all parts of the genomic region investigated. Thus, human Mcm proteins first assemble at or adjacent to bound ORC and move to other sites during genome replication.

INTRODUCTION

Mcm proteins were originally discovered in yeast as functions required for the autonomous replication of extrachromosomal DNA elements (Mcm, minichromosomal maintenance). They were subsequently found in all eukaryotes examined and in archaea (reviewed in 1–4). The proteins are required for the initiation of DNA replication and may also be involved in replicative chain elongation (5–10). In addition, some Mcm proteins interact with transcription factors and may therefore function in transcriptional regulation (11–14).

Mcm proteins (Mcm2p–Mcm7p) are divergent in most of their amino acid sequences, but share an approximately 200 amino acid long central region with similarities to a nucleotide-binding fold that includes variations of the Walker A and Walker B motifs, as are found in other members of the large AAA+ family of proteins (ATPase associated with various cellular activities) (15,16). In addition, Mcm2p, Mcm4p, Mcm6p and Mcm7p possess a zinc finger region of the type CX2CXnCX2C that may be involved in protein–protein interactions (17). In extracts from yeasts, mammalian cells and Xenopus eggs, Mcm proteins occur in defined subcomplexes such as stable Mcm3p–Mcm5p dimers and single or double Mcm4p–Mmc6p–Mcm7p trimers as well as single or double hexamers containing all six Mcm proteins (18–24). However, the functional complex in vivo is not yet known.

Mcm proteins are loaded on chromatin at the end of mitosis and the beginning of the G1 phase of the cell cycle. Work with yeast cells has shown that Mcm loading is contingent upon the presence on chromatin of the six subunit origin recognition complex (ORC with subunits Orc1p–Orc6p) and depends on Cdc6p which interacts with ORC (25–29). Biochemical experiments with Xenopus egg extracts support this scheme showing that ORC must first be present on chromatin, followed by the binding of the Xenopus homolog of Cdc6p and of another Mcm-loading factor, Cdt1p (also known as RLF-B), before Mcm proteins are recruited to complete the formation of pre-replication complexes on chromatin (9,22,30–33). It is quite likely that all eukaryotes use the same general pathway for the assembly of pre-replication complexes and the formation of replication-competent chromatin (34,35).

The conversion of pre-replication complexes into active replication complexes at the G1/S phase transition depends on the activities of cyclin-dependent kinases (CDK2 with cyclin A or cyclin E in mammalian cells) and of the Dbf4/Cdc7 kinase (reviewed in 2).

During S phase, Mcm proteins are gradually released from their chromatin sites (26,36–39). Their reloading appears to be prevented by several mechanisms, including the function of the S phase-specific protein geminin that binds to and neutralizes the function of the loading factor Cdt1p (40–43). This constitutes a powerful mechanism preventing the re-replication of chromatin sections that have already replicated during the same S phase.

The molecular functions of Mcm proteins on replicating chromatin in vivo are not fully understood. The conserved nucleotide-binding fold suggests that ATP binding and ATP hydrolysis are important for the replication functions of Mcm proteins (44,45). Indeed, ATP stabilizes the interaction of Mcm proteins with isolated chromatin (21,46). Importantly, the mammalian Mcm4p–Mcm6p–Mcm7p trimer has been reported to possess ATPase and DNA helicase activity in vitro (47–49), as does a hexameric archaeal protein related to the Mcm2p–Mcm7p family (50–52). Furthermore, in vivo crosslinking and chromatin immunoprecipitation (ChIP) experiments have shown that yeast Mcm proteins are associated with origin sequences in pre-replication complexes, but appear to move with replication forks after initiation, as expected for a DNA helicase (5). A participation of yeast Mcm proteins in replicative chain elongation is strongly supported by an elegant study with Mcm ‘degron’ mutants which allow the precise destruction of individual Mcm proteins during ongoing S phase resulting in a stop of replication chain elongation (8).

ChIP was used to localize Mcm proteins in mammalian systems. It was shown that Mcm proteins are localized to the Chinese hamster DHFR origin region in G1 cells and partition to more distal parts of the DHFR locus in S phase cells (53). In these experiments, DNA in immunoprecipitated chromatin was radiolabeled and hybridized to dot-blotted large cosmid-borne genome fragments, a procedure that inevitably results in low signal-to-noise ratios and low resolution. Therefore, we found it of interest to investigate Mcm loading by a procedure that involves in vivo formaldehyde crosslinking and ChIP to identify the DNA in immunoprecipitated chromatin by quantitative real-time PCR. As shown recently, this procedure allows the localization of ORC-binding sites and replication origins within regions of ∼500 bp in human HeLa cell chromatin (54,55). Here we investigate whether Mcm proteins assemble at the ORC-bearing chromatin site. We show that Mcm-specific antibodies preferentially immunoprecipitate specific origin-containing chromatin fragments from G1 cells, but not from S phase cells where Mcm proteins appear to be distributed over the entire chromatin section investigated. Thus, human Mcm proteins assemble at ORC-binding sites during G1 phase, but disperse to other chromatin sites during S phase.

MATERIALS AND METHODS

Cell culture and synchronization

Human HeLa S3 cells were grown to semiconfluency on plastic dishes in Dulbecco’s modified Eagle’s medium plus 5% fetal calf serum.

For S phase synchronization, cells were first subjected to a double thymidine block (56) and then released for 2–4 h. Cells in G1 phase were prepared in the following manner: they were first arrested by a single thymidine block, released for 9 h and then arrested again by a short treatment (3 h) with nocodazole. Mitotic cells were collected and resuspended in culture medium without nocodazole and investigated at 4 h without nocodazole. Synchronization was verified by analysis of DNA content in a flow cytometer (see Fig. 2).

Figure 2.

Figure 2

ChIP assay on crosslinked chromatin from synchronized HeLa cells. Crosslinked chromatin from G1 phase cells and S phase cells was immunoprecipitated with antibodies against Mcm3p (α-MCM3). The input, supernatant and precipitated samples were western blotted and analyzed with Mcm3p, Mcm5p and Orc2p antibodies as well as with antibodies against the large subunit of RPA (RPA70) as indicated. Synchronization was verified by analysis of DNA content on a flow cytometer (shown in the conventional manner).

In vivo crosslinking

Formaldehyde was diluted to 1% in prewarmed medium (37°C) and added to monolayers of ∼108 cells for 4 min (57). After removal of the medium, cells were washed three times on plates with cold phosphate-buffered saline (PBS) (58), scraped off, washed again twice in cold PBS and then resuspended in hypotonic RSB buffer (10 mM Tris–HCl, 3 mM MgCl2, pH 8.0). All buffers contained 10 mM sodium bisulfite as a protease inhibitor. After 10 min on ice, the swollen cells were disrupted by Dounce homogenization. Nuclear material was collected and washed twice in RSB buffer and once in high salt NSB buffer (1 M NaCl, 10 mM Tris–HCl, 0.1% NP-40, 1 mM EDTA, pH 8.0). Nuclear material was then resuspended in low salt NSB buffer (0.1 M NaCl) and loaded onto a step gradient made up of 1.75, 1.5 and 1.3 g/ml CsCl in 20 mM Tris–HCl, 0.5% sarcosyl, 1 mM EDTA, pH 8. Nucleoprotein complexes were collected after centrifugation (37 000 r.p.m., 24 h, 18°C) and dialyzed overnight against TE (10 mM Tris–HCl, 1 mM EDTA, pH 7.4) containing 10 mM sodium bisulfite. Nucleoprotein was then briefly sonicated on ice and digested with micrococcal nuclease in TE with 3 mM CaCl2 (1 U micrococcal nuclease/100 µg nucleoprotein for 15 min at 37°C) (55).

Chromatin immunoprecipitation

Affinity-purified antibodies against the human Orc2 (59), Mcm (60) and replication protein A (RPA) (large subunit) proteins (61) have been described. The control antibodies were non-specific rabbit IgG from Sigma.

Immunoprecipitations were performed in NET buffer (50 mM Tris pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40). Nuclease-digested nucleoprotein was centrifuged for 10 min at 15 000 g for clarification. Soluble nucleoprotein (1 mg) was incubated with antibodies (10 µg) for 2 h at 20°C. Then, 50 µl of protein A–Sepharose (Amersham Pharmacia Biotech) was added for an additional 2 h. Immunocomplexes were washed eight times with RIPA (50 mM Tris–HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium desoxycholate, 0.1% SDS, pH 8), three times in lithium buffer (10 mM Tris–HCl, 250 mM LiCl2, 0.5% NP-40, 0.5% sodium desoxycholate, 1 mM EDTA, pH 8) and five times in TE buffer. The washed precipitates were divided for western blotting and DNA extraction. For western blot analyses, proteins were eluted from crosslinked chromatin and processed as previously described (60). For DNA extraction, the immunoprecipitates were first washed again as described above to maximize the signal-to-noise ratio. The final pellet was then resuspended in TE with 1% SDS and incubated overnight at 37°C with 200 µg/ml proteinase K. The DNA was purified by standard phenol/chloroform extraction and ethanol precipitation. The precipitated DNA (usually between 5 and 10 ng) was dissolved in 40 µl of TE. One-twentieth was used for real-time quantitative PCR.

Quantitative real-time PCR analyses

Real-time PCR was performed with a Light Cycler instrument (Roche Diagnostics) using a ready-to-use ‘hot start’ reaction mix (FastStart DNA Master SYBR Green I; Roche Diagnostics). This mix contains Taq DNA polymerase and a fluorescent dye, SYBR Green I, for real-time detection of double-stranded DNA. Reactions were set up in 10 µl volumes including 0.5 mM each primer. PCR reactions were performed for 35 cycles routinely using standard settings as recommended by the manufacturer. Annealing temperatures for each primer pair are given in Table 1. Standard DNA samples (human genomic DNA) were serially diluted to 30 and 3 ng and 300, 30 and 3 pg. Following PCR, the x-axis crossing point of each standard sample was plotted against the logarithm of concentration to produce a standard curve. Genomic equivalents of DNA samples were determined by extrapolation from the standard curve (55).

Table 1. Sequences and amplification conditions for primers.

Primer Sequence (5′→3′) Map positions (bp) Length (bp) Annealing temperature (°C)
EX9-F ATGTCTTCCGGAGACTCCTGAAGC 6342–6365    
EX9-R GGCCTCCTATTCTCAGAATCATGC 6705–6728 387 62
EX7-F TAATCCGTCACCTTGACTACCACC 8901–8924    
EX7-R ACAGCACGTGCATGATTCTGTAGG 9277–9300 400 62
EX6-F TACCTGTGGGTAAGAGATGAGTTG 10691–10704    
EX6-R TGCCTGTTCCCAAATGCTATATGC 10998–11021 331 62
EX2-F TCTGCACTCCGTTCAGCTCCTCTG 11894–11917    
EX2-R GAGTGAGGATGCCAGGTCATCTCC 12191–12214 321 68
PROM-F AAACCAGAAGTAGGCCTCGCTCGG 12946–12969    
PROM-R GGCCAGTAAGCGCGCCTCTTTGG 13460–13482 537 68
IN1-F ATCTCGCCTAATCCCACCAGTACC 14364–14387    
IN1-R CATATTCACTACTAGACCCTCCGG 14633–14656 293 62
IN6-F GACATTCTGCTTCCATAGATGTGG 19943–19966    
IN6-R GTTGGGAAAGATGTCATCATCAGG 20265–20288 346 62
IN7-F GAGGAATGCCAGAATTTCCAGAGG 26412–26435    
IN7-R TTCCATCTGGAATGAGATCCCAGC 26118–26741 327 62

RESULTS

Immunoprecipitations of crosslinked proteins

To determine whether human Mcm proteins are preferentially associated with distinct sites on chromatin in vivo, we used a ChIP approach as described before (54,55). We first asked whether the antibodies used in this study recognize Mcm proteins in crosslinked chromatin. For that purpose, chromatin was prepared from proliferating HeLa cells treated for various lengths of time (1–10 min) with formaldehyde (1%). It could be shown that a formaldehyde treatment of 4 min was sufficient to covalently link chromatin-bound Orc2p and Mcm proteins to DNA (data not shown; but see 55). Crosslinked chromatin was treated with micrococcal nuclease to produce nucleoprotein fragments with ∼1 kb of DNA. These fragments were then incubated with monospecific antibodies for immunoprecipitation.

As a control, we used Orc2p-specific antibodies that had already been tested in previous experiments and shown to effectively immunoprecipitate chromatin with crosslinked Orc proteins (54,55,60). Interestingly, Orc2p-specific antibodies failed to co-immunoprecipitate Mcm3p (Fig. 1A) even though the chromatin sample investigated contained high amounts of crosslinked Mcm3p (input in Fig. 1B), and a close association of ORC and Mcm proteins could be expected since chromatin binding of ORC is necessary in yeast and Xenopus egg extracts for the subsequent loading of Mcm proteins (see Introduction). Results similar to those of Figure 1A were obtained when the blots were probed with antibodies against the other Mcm proteins (data not shown). An interpretation is that Orc2p (and by implication other components of ORC) (62) do not necessarily co-localize with Mcm proteins in proliferating HeLa cells (60).

Figure 1.

Figure 1

Orc2p and Mcm proteins on crosslinked chromatin. (A) Immunoprecipitations with antibodies against Orc2p (α-Orc2) and with non-specific control antibodies (IgG). Input (crosslinked, nuclease-treated chromatin before immunoprecipitation), supernatants (remaining chromatin after treatment with antibodies and protein A–Sepharose) and immunoprecipitates were analyzed in western blots with Mcm3p-specific (MCM3) and with Orc2p-specific antibodies (ORC2). (B) Immunoprecipitations with antibodies against Mcm3p (α-MCM3) and with non-specific control antibodies (IgG). The input, supernatant and precipitated samples were western blotted and analyzed with antibodies against Mcm3p (MCM3), Mcm4p (MCM4), Mcm5p (MCM5) and Mcm7p (MCM7) as well as with antibodies against Orc2p (ORC2). (C) Immunoprecipitation with antibodies against Mcm4p (α-MCM4) and with non-specific control antibodies (IgG). The input, supernatant and precipitated samples were western blotted and analyzed with Mcm4p, Mcm6p and Mcm7p antibodies as well as with antibodies against Orc2p as indicated.

Using Mcm3-specific antibodies, Mcm3p-bearing chromatin was immunoprecipitated that also contained relatively large amounts of crosslinked Mcm5p, the dimer partner of Mcm3p, but only small amounts of the other Mcm proteins, although they were present in the input sample. Interestingly, the immunoprecipitated chromatin also carried Orc2p, although in relatively small amounts (Fig. 1B).

Likewise, Mcm4-specific antibodies immunoprecipitated chromatin with crosslinked Mcm4p as well as Mcm6p and Mcm7p, components of the stable Mcm4p–Mcm6p–Mcm7p trimer (Fig. 1C, upper panels). A supernatant blot and the precipitate blot were also probed with Mcm3 and Mcm5 antibodies showing that only small amounts of the Mcm3p– Mcm5p dimer co-immunoprecipitated with the Mcm4p– Mcm6p–Mcm7p trimer (not shown). Significantly, however, Mcm4 antibodies (just like Mcm3 antibodies; see above) co-immunoprecipitated some of the crosslinked Orc2p (Fig. 1C, lower panels).

We conclude from Figure 1, first, that Mcm proteins, known to occur as stable subcomplexes in protein extracts (the Mcm3p–Mcm5p dimer and the Mcm4p–Mcm6p–Mcm7p trimer), preferentially crosslink together in chromatin and, second, that Mcm3- as well as Mcm4-specific antibodies co-immunoprecipitate small amounts of Orc2p, whereas Orc2-specific antibodies fail to co-immunoprecipitate Mcm proteins. This could mean that Orc2p and Mcm proteins do not always crosslink to the same chromatin fragment, but, when they do, Orc2p becomes inaccessible to Orc2 antibodies and may be covered by Mcm proteins (which are about 10 times more abundant in nuclei than Orc proteins; 1).

Since the experiments in Figure 1 were performed with asynchronously proliferating HeLa cells, we repeated the ChIP assay with Mcm3-specific antibodies comparing chromatin from cells in G1 phase with chromatin from cells in S phase (see Material and Methods). The data obtained with G1 chromatin were similar to those of Figure 1 and showed that immunoprecipitated chromatin carried Mcm3p and Mcm5p in addition to small amounts of Orc2p. However, S phase chromatin, immunoprecipitated with Mcm3 antibodies, contained the Mcm3p–Mcm5p dimer, but lacked detectable Orc2p (Fig. 2). Thus, according to ChIP, Mcm proteins and Orc2p may co-localize on G1 phase chromatin, but not on S phase chromatin.

We include in Figure 2 western blots performed with antibodies against the large subunit of RPA, the major eukaryotic single strand-binding protein with function at replication forks (63). We show that the RPA subunit did not detectably crosslink to Mcm3p–Mcm5p-bearing chromatin fragments indicating that Mcm proteins and RPA are not located at closely adjacent sites on chromatin.

We note though that only a fraction of the total crosslinked chromatin could be immunoprecipitated by Mcm antibodies (Figs 1 and 2 and related experiments). This fraction remained unchanged upon the addition of several-fold higher amounts of Mcm-specific antibodies indicating that a considerable fraction of crosslinked Mcm proteins did not interact with, or were inaccessible to, antibodies. However, Ritzi et al. (60) have previously used a different method, which allowed an investigation of total chromatin, namely partial digestion of native chromatin with micrococcal nuclease. They showed that Orc proteins and Mcm proteins usually occur on chromatin digestion products of different size classes and concluded that ORC and Mcm proteins are not frequently bound to neighboring sites in HeLa cell chromatin.

To summarize this section we conclude that a fraction of Mcm proteins on crosslinked chromatin is accessible to specific antibodies and can be immunoprecipitated. We therefore extracted DNA from immunoprecipitated chromatin and used the method of quantitative real-time PCR for the detection of specific DNA sequences.

The MCM4 gene locus in crosslinked chromatin

The chromatin region investigated was the human MCM4/PRKDC locus, a region of ∼25 kb that includes an ORC-binding site and an origin of replication in an ∼500 bp segment between the two divergently transcribed constitutively expressed genes (64) (Fig. 3A).

Figure 3.

Figure 3

(Opposite) Specific DNA regions in immunoprecipitated crosslinked chromatin from unsynchronized HeLa cells. (A) Genomic organization of the analyzed region encompassing human genes PRKDC and MCM4 (70). In the double line diagram, exons are shown as black boxes and arrows indicate the starts and directions of transcription. In the single line diagram, divergent arrowheads show regions complementary to the PCR primers used. (B) Input. DNA was extracted from crosslinked chromatin before immunoprecipitation and amplified by quantitative PCR using the primer sets indicated. The results are expressed in ‘genomic units’ relative to serially diluted genomic control DNA. (C) Immunoprecipitated chromatin. Quantitative real-time PCR with DNA templates extracted from chromatin precipitated with control antibodies and with antibodies against Orc2p, Mcm3p and Mcm4p as indicated.

As has been discussed before (54), DNA from different regions of crosslinked chromatin is not necessarily amplified with similar efficiencies by PCR. One reason for this is that crosslinked proteins such as transcription factors are unevenly distributed in chromatin with the consequence that some regions are better protected than others against micrococcal nuclease digestion, a routine step in the preparation of crosslinked chromatin for immunoprecipitation (see above). We indeed found that promoter-proximal DNA from crosslinked chromatin could be amplified to 2- to 3-fold higher values than promoter-distal DNA in the same preparation (Fig. 3B, input). The different abundance of amplifiable promoter-proximal and promoter-distal parts of the gene region in crosslinked chromatin prior to immunoprecipitation has to be considered when evaluating the PCR results of ChIP assays.

In Figure 3C, we prepared crosslinked chromatin from asynchronously proliferating HeLa cells. Irrelevant control antibodies (control IgG in Fig. 3C) failed to precipitate specific DNA sequences, whereas Orc2-specific antibodies preferentially immunoprecipitated DNA sequences from the intergenic region that includes upstream promoter sequences of the MCM4 gene (55) (α-Orc2 in Fig. 3C). Interestingly, Mcm3-specific as well as Mcm4-specific antibodies immunoprecipitated chromatin with the upstream promoter site, but also chromatin with DNA regions corresponding to more distal parts of the two divergent genes (Fig. 3C, α-MCM3 and α-MCM4). The distribution of Mcm4-bearing chromatin fragments seems to show a gradient-like pattern with decreased presence of fragments at increased distance from the origin. As detailed below, this distribution is most probably not significant given the fact that the origin-proximal sequences can be PCR amplified to a higher degree than origin-distal sequences.

We noted in this and related experiments (see below) that the number of total PCR-amplifiable sequences were more abundant in Orc2 precipitates than in Mcm3 or Mcm4 precipitates. One explanation is that Orc2-specific antibodies were more efficient than Mcm-specific antibodies in immunoprecipitating crosslinked chromatin, but it is also possible that DNA fragments extracted from Orc2 precipitates are more suitable as templates for PCR than DNA fragments extracted from Mcm precipitates. This could be due, for example, to an incomplete reversal of covalent linkages between protein and DNA or, and probably more likely, to breaks or other discontinuities in the DNA strands of Mcm-bearing crosslinked chromatin.

In either case, the data of Figure 3 show that Mcm3- and Mcm4-specific antibodies are able to precipitate chromatin with PCR-amplifiable DNA. We next determined whether the location of Mcm proteins varies during the cell cycle and performed experiments with cells in G1 phase and compared them with cells that were released into S phase.

Mcm proteins at the origin

We have performed several independent cell synchronization experiments and prepared crosslinked chromatin, both from cells before and after release into S phase (see Materials and Methods and Fig. 2). ChIP assays were performed with samples from each preparation and the abundance of specific DNA regions in the immunoprecpitates was evaluated by quantitative PCR using five primer pairs in some and eight primer pairs in other experiments.

As a summary of the results (Fig. 4) we note the following. First, Orc2-specific antibodies specifically precipitated chromatin fragments with sequences that could be amplified by primers corresponding to the upstream promoter region (Prom) and to the Ex2 region. These two regions are adjacent to each other (distance <1 kb) and could therefore occur on the same chromatin fragments. The results were similar for crosslinked chromatin prepared from G1 phase cells and from S phase cells (compare left and right panels in Fig. 4A). Second, Mcm3-specific antibodies preferentially immunoprecipitated promoter-proximal sequences of crosslinked chromatin from cells in G1 phase. In fact, ∼75% of the estimated total amplifiable DNA sequences (‘genomic equivalents’ in Fig. 4) in these precipitates corresponded to promoter-proximal sites (left panel in Fig. 4B). In contrast, immunoprecipitates performed with S phase chromatin yielded only ∼30% of amplifiable promoter-proximal DNA. In these immunoprecipitates most amplifiable DNA corresponded to promoter-distal regions (right panel in Fig. 4B). Third, ChIP experiments with Mcm4-specific antibodies gave results that confirmed those obtained with Mcm3-specific antibodies, showing again that Mcm antibodies preferentially immunoprecipitate chromatin with an ORC-binding site and with a replication origin from G1 phase cells, and chromatin with promoter-distal sequences from S phase cells (left and right panels in Fig. 4C). We have performed several experiments in addition to those shown in Figure 4. In these experiments, we used Mcm5- and Mcm7-specific antibodies for the immunoprecipitation of crosslinked chromatin. The data obtained were very similar to those of Figure 4 and are therefore not shown. We have also compared chromatin from cells released for 2 h into S phase and found a distribution very similar to that of immunoprecipitated chromatin fragments shown in Figure 4 (data not shown). Thus, a wave of apparently synchronous Mcm protein migration such as that described for yeast elongation (5) does either not occur in HeLa cells (due to an inherent asynchrony in origin activation) or cannot be observed under the present experimental conditions.

Figure 4.

Figure 4

Specific DNA regions in immunoprecipitated crosslinked chromatin from cells in G1 phase and S phase. HeLa cells were synchronized in G1 phase (left) or released into S phase for 4 h (right) and were subjected to ChIP analysis. Quantitative real-time PCR was performed with DNA templates extracted from chromatin precipitated with antibodies against (A) Orc2p, (B) Mcm3p and (C) Mcm4p. We show the results of three independent experiments. (Below) Schematic representation of the genomic region analyzed with the PCR-amplified segments indicated by arrowheads.

As noted above, evaluation of ChIP assays requires a comparison of the PCR results in the immunoprecipitates (Fig. 4) with those in the input crosslinked chromatin (Fig. 3B). Accordingly, we calculated the ratios of amplifiable precipitated over input DNA. The data show, for the Orc2 immunoprecipitates, that promoter-proximal sequences (amplified using primer pairs Prom and Ex2) were 10- to 20-fold enriched over promoter-distal sequences (Fig. 5A). In the Mcm3 and Mcm4 immunoprecipitates of chromatin from G1 phase cells, promoter-proximal sequences were also enriched, although more moderately (2- to 6-fold), over promoter-distal sequences (open squares in Fig. 5B and C). The preference for promoter-proximal sites was lost in immunoprecpitated chromatin from S phase cells where all regions in the MCM4/PRKDC gene locus appeared to be present in approximately similar copy numbers (closed circles in Fig. 5B and C).

Figure 5.

Figure 5

Enrichment of specific DNA sequences in immunoprecipitates. Quantitative PCR gives the results in ‘genomic units’ relative to serially diluted purified genomic DNA. The ratios of precipitated over input genomic units are multiplied by 100 and plotted against the primer sites on the analyzed region. The results of the precipitations with Orc2 antibodies are summarized in (A), with Mcm3 antibodies in (B) and with Mcm4 antibodies in (C). Open squares indicate the mean enrichment of the G1 phase samples and closed circles indicate the mean enrichment of the samples from S phase cells.

DISCUSSION

We used the ChIP technology to investigate the location of components of the pre-replication complex in the human genome. We previously identified prominent ORC-binding sites within ∼500 bp regions upstream of several constitutively expressed genes. These sites usually coincide with origins of replication as determined by the nascent strand abundance assay (54,55).

We have now used ChIP to determine the position of Mcm proteins on chromatin. This is of interest because work with cycling mammalian cells has shown that the binding of Mcm proteins to chromatin follows the binding of ORC, but, unlike the situation in yeast and Xenopus egg extracts, it has not been determined whether human ORC is required for the subsequent binding of Mcm proteins, nor is it known whether Mcm proteins assemble at ORC. While an effective in vitro system will be necessary to investigate the first point, our data contribute to the second point as they show that Mcm proteins preferentially occur at the ORC-binding region in G1 phase cells.

In our experiments, we used monospecific antibodies against Mcm3p, a component of the stable Mcm3p–Mcm5p dimer, and antibodies against Mcm4p, a member of the Mcm4p–Mcm6p–Mcm7p trimer that has been reported to function as a helicase in vitro (47,48,65,66). Immunopre cipitation results suggest that the dimer and trimer complexes seem to crosslink independently of each other (Fig. 1). However, they crosslink to the same DNA sequences, at least in the genomic region investigated, and it is therefore likely that they function together in vivo. For that purpose, we do not distinguish between Mcm3 and Mcm4 immunoprecipitates in the following discussion.

It became clear from this and earlier studies that Orc2p and possibly other Orc proteins remain bound to specific chromatin sites during the cell cycle (with the exception of Orc1p, which dissociates from chromatin and is degraded during the S phase of cycling mammalian cells; 59,67). We now show that Mcm proteins associate in G1 phase with the ORC-bearing chromatin sites.

While this conclusion is in agreement with the generally accepted scheme of pre-replication complex formation in eukaryotes, we made some observations that should be commented on.

One observation is that Orc2p-specific antibodies precipitate chromatin that carries Orc2p, bound to its upstream promoter site, but lacks Mcm proteins. Thus, a number of ORCs may not be in contact with Mcm proteins. This was not only found in ongoing S phase when ORC remains bound while Mcm proteins move away from the origin (and eventually dissociate from chromatin), but also in G1 phase. This could mean that some ORC do not recruit Mcm proteins and may remain silent during that particular cell cycle.

A second point to consider is that Mcm-specific antibodies precipitate chromatin, which, in addition to high amounts of Mcm proteins, also carries Orc2p, although in relatively small amounts. As already mentioned, the fact that Mcm antibodies co-immunoprecipitate Orc2p but Orc2 antibodies fail to co-immunoprecipitate Mcm proteins can be explained by assuming that Mcm proteins cover chromatin-bound Orc2p which thus becomes inaccessible in these complexes. That Orc2p and Mcm proteins indeed occur at identical chromatin sites was shown by PCR analyses of DNA extracted from immunoprecipitated chromatin from G1 phase cells.

In this regard we note that Mcm antibodies precipitate a considerable fraction of chromatin with crosslinked Mcm proteins (Fig. 1). However, PCR analyses resulted in rather small numbers of Mcm-associated amplifiable sequences, at least relative to Orc2-associated sequences, which are detected in 3- to 4-fold higher copy numbers in immunoprecipitated chromatin (Figs 3 and 4) even though Orc proteins are clearly less abundant in chromatin than Mcm proteins (1). Thus, Mcm-bearing DNA extracted from immunoprecipitated chromatin cannot be PCR amplified to similar extents as ORC-bearing DNA in the same preparation. This could be caused by structural features of the Mcm-bearing DNA such as single-strand regions or strand discontinuities. In fact, it has been described that chromatin with associated Mcm proteins is more readily attacked by micrococcal nuclease than bulk chromatin or chromatin with Orc proteins, suggesting that Mcm proteins normally reside in more open chromatin regions where the underlying DNA may undergo specific transitions such as helix unwinding in S phase (60,68).

This interesting point certainly deserves further investigation. However, with the present experimental approach we detect only those Mcm-bearing DNA segments that can be amplified in PCR analyses. With these reservations in mind, we conclude that Mcm proteins preferentially occur at an origin site before S phase, but distribute over more distal parts of the genes during ongoing S phase. This is similar to previous results with yeast cells (5,69) and could mean that Mcm proteins are migrating in both directions from the origin with the divergently moving replication forks, as expected if Mcm proteins constitute the replicative DNA helicases in eukaryotic cells.

However, according to biochemical experiments, only the Mcm4p–Mcm6p–Mcm7p trimer functions as a DNA helicase in vitro whereas the Mcm3p–Mcm5p dimer and the hexameric Mcm complex are enzymatically inactive (47–49). We suggest now that Mcm3p–Mcm5p dimers and Mcm4p–Mcm6p–Mcm7p trimers migrate together with replication forks and may therefore functionally interact in vivo, although it is presently unclear what their combined function could be.

Acknowledgments

ACKNOWLEDGEMENTS

We thank M. Baack and J. Baltin for assistance and W. Pfleiderer for his generosity concerning the Light Cycler usage. This work was supported by the Deutsche Forschungsgemeinschaft (DFG).

REFERENCES

  • 1.Kearsey S.E. and Labib,K. (1998) MCM proteins: evolution, properties and role in DNA replication. Biochim. Biophys. Acta, 1398, 113–136. [DOI] [PubMed] [Google Scholar]
  • 2.Lei M. and Tye,B.K. (2001) Initiating DNA synthesis: from recruiting to activating the MCM complex. J. Cell Sci., 114, 1447–1454. [DOI] [PubMed] [Google Scholar]
  • 3.Pasion S.G. and Forsburg,S.L. (2001) Deconstructing a conserved protein family: the role of MCM proteins in eukaryotic DNA replication. Genet. Eng., 23, 129–155. [DOI] [PubMed] [Google Scholar]
  • 4.Tye B.K. (1999) MCM proteins in DNA replication. Annu. Rev. Biochem., 68, 649–686. [DOI] [PubMed] [Google Scholar]
  • 5.Aparicio O.M., Weinstein,D.M. and Bell,S.P. (1997) Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase. Cell, 91, 59–69. [DOI] [PubMed] [Google Scholar]
  • 6.Chong J.P., Mahbubani,H.M., Khoo,C.Y. and Blow,J.J. (1995) Purification of an MCM-containing complex as a component of the DNA replication licensing system. Nature, 375, 418–421. [DOI] [PubMed] [Google Scholar]
  • 7.Kubota Y., Mimura,S., Nishimoto,S., Takisawa,H. and Nojima,H. (1995) Identification of the yeast MCM3-related protein as a component of Xenopus DNA replication licensing factor. Cell, 81, 601–609. [DOI] [PubMed] [Google Scholar]
  • 8.Labib K., Tercero,J.A. and Diffley,J.F. (2000) Uninterrupted MCM2-7 function required for DNA replication fork progression. Science, 288, 1643–1647. [DOI] [PubMed] [Google Scholar]
  • 9.Tanaka T., Knapp,D. and Nasmyth,K. (1997) Loading of an Mcm protein onto DNA replication origins is regulated by Cdc6p and CDKs. Cell, 90, 649–660. [DOI] [PubMed] [Google Scholar]
  • 10.Yan H., Merchant,A.M. and Tye,B.K. (1993) Cell cycle-regulated nuclear localization of MCM2 and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast. Genes Dev., 7, 2149–2160. [DOI] [PubMed] [Google Scholar]
  • 11.DaFonseca C.J., Shu,F. and Zhang,J.J. (2001) Identification of two residues in MCM5 critical for the assembly of MCM complexes and Stat1-mediated transcription activation in response to IFN-γ. Proc. Natl Acad. Sci. USA, 98, 3034–3039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sterner J.M., Dew-Knight,S., Musahl,C., Kornbluth,S. and Horowitz,J.M. (1998) Negative regulation of DNA replication by the retinoblastoma protein is mediated by its association with MCM7. Mol. Cell. Biol., 18, 2748–2757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yankulov K., Todorov,I., Romanowski,P., Licatalosi,D., Cilli,K., McCracken,S., Laskey,R. and Bentley,D.L. (1999) MCM proteins are associated with RNA polymerase II holoenzyme. Mol. Cell. Biol., 19, 6154–6163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhang J.J., Zhao,Y., Chait,B.T., Lathem,W.W., Ritzi,M., Knippers,R. and Darnell,J.E.,Jr (1998) Ser727-dependent recruitment of MCM5 by Stat1α in IFN-γ-induced transcriptional activation. EMBO J., 17, 6963–6971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Koonin E.V. (1993) A common set of conserved motifs in a vast variety of putative nucleic acid-dependent ATPases including MCM proteins involved in the initiation of eukaryotic DNA replication. Nucleic Acids Res., 21, 2541–2547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Neuwald A.F., Aravind,L., Spouge,J.L. and Koonin,E.V. (1999) AAA+: a class of chaperone-like ATPases associated with the assembly, operation and disassembly of protein complexes. Genome Res., 9, 27–43. [PubMed] [Google Scholar]
  • 17.Yan H., Gibson,S. and Tye,B.K. (1991) Mcm2 and Mcm3, two proteins important for ARS activity, are related in structure and function. Genes Dev., 5, 944–957. [DOI] [PubMed] [Google Scholar]
  • 18.Dalton S. and Hopwood,B. (1997) Characterization of Cdc47p-minichromosome maintenance complexes in Saccharomyces cerevisiae: identification of Cdc45p as a subunit. Mol. Cell. Biol., 17, 5867–5875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kubota Y., Mimura,S., Nishimoto,S., Masuda,T., Nojima,H. and Takisawa,H. (1997) Licensing of DNA replication by a multi-protein complex of MCM/P1 proteins in Xenopus eggs. EMBO J., 16, 3320–3331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lei M., Kawasaki,Y. and Tye,B.K. (1996) Physical interactions among Mcm proteins and effects of Mcm dosage on DNA replication in Saccharomyces cerevisiae. Mol. Cell. Biol., 16, 5081–5090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Richter A., Baack,M., Holthoff,H.P., Ritzi,M. and Knippers,R. (1998) Mobilization of chromatin-bound Mcm proteins by micrococcal nuclease. Biol. Chem., 379, 1181–1187. [DOI] [PubMed] [Google Scholar]
  • 22.Romanowski P., Madine,M.A. and Laskey,R.A. (1996) XMCM7, a novel member of the Xenopus MCM family, interacts with XMCM3 and colocalizes with it throughout replication. Proc. Natl Acad. Sci. USA, 93, 10189–10194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Su T.T., Feger,G. and O’Farrell,P.H. (1996) Drosophila MCM protein complexes. Mol. Biol. Cell, 7, 319–329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Thommes P. and Blow,J.J. (1997) The DNA replication licensing system. Cancer Surv., 29, 75–90. [PubMed] [Google Scholar]
  • 25.Devault A., Vallen,E.A., Yuan,T., Green,S., Bensimon,A. and Schwob,E. (2002) Identification of Tah11/Sid2 as the ortholog of the replication licensing factor Cdt1 in Saccharomyces cerevisiae. Curr. Biol., 12, 689–694. [DOI] [PubMed] [Google Scholar]
  • 26.Donovan S., Harwood,J., Drury,L.S. and Diffley,J.F. (1997) Cdc6p-dependent loading of Mcm proteins onto pre-replicative chromatin in budding yeast. Proc. Natl Acad. Sci. USA, 94, 5611–5616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Labib K., Kearsey,S.E. and Diffley,J.F. (2001) MCM2-7 proteins are essential components of prereplicative complexes that accumulate cooperatively in the nucleus during G1-phase and are required to establish, but not maintain, the S-phase checkpoint. Mol. Biol. Cell, 12, 3658–3667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Santocanale C., Sharma,K. and Diffley,J.F. (1999) Activation of dormant origins of DNA replication in budding yeast. Genes Dev., 13, 2360–2364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Seki T. and Diffley,J.F. (2000) Stepwise assembly of initiation proteins at budding yeast replication origins in vitro. Proc. Natl Acad. Sci. USA, 97, 14115–14120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Dimitrova D.S. and Gilbert,D.M. (1998) Regulation of mammalian replication origin usage in Xenopus egg extract. J. Cell Sci., 111, 2989–2998. [DOI] [PubMed] [Google Scholar]
  • 31.Li C.J., Bogan,J.A., Natale,D.A. and DePamphilis,M.L. (2000) Selective activation of pre-replication complexes in vitro at specific sites in mammalian nuclei. J. Cell Sci., 113, 887–898. [DOI] [PubMed] [Google Scholar]
  • 32.Romanowski P., Madine,M.A., Rowles,A., Blow,J.J. and Laskey,R.A. (1996) The Xenopus origin recognition complex is essential for DNA replication and MCM binding to chromatin. Curr. Biol., 6, 1416–1425. [DOI] [PubMed] [Google Scholar]
  • 33.Rowles A., Chong,J.P., Brown,L., Howell,M., Evan,G.I. and Blow,J.J. (1996) Interaction between the origin recognition complex and the replication licensing system in Xenopus. Cell, 87, 287–296. [DOI] [PubMed] [Google Scholar]
  • 34.Dimitrova D.S., Prokhorova,T.A., Blow,J.J., Todorov,I.T. and Gilbert,D.M. (2002) Mammalian nuclei become licensed for DNA replication during late telophase. J. Cell Sci., 115, 51–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Mendez J. and Stillman,B. (2000) Chromatin association of human origin recognition complex, cdc6 and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol. Cell. Biol., 20, 8602–8612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kimura H., Nozaki,N. and Sugimoto,K. (1994) DNA polymerase alpha associated protein P1, a murine homolog of yeast MCM3, changes its intranuclear distribution during the DNA synthetic period. EMBO J., 13, 4311–4320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Krude T., Musahl,C., Laskey,R.A. and Knippers,R. (1996) Human replication proteins hCdc21, hCdc46 and P1Mcm3 bind chromatin uniformly before S-phase and are displaced locally during DNA replication. J. Cell Sci., 109, 309–318. [DOI] [PubMed] [Google Scholar]
  • 38.Liang C. and Stillman,B. (1997) Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev., 11, 3375–3386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Todorov I.T., Attaran,A. and Kearsey,S.E. (1995) BM28, a human member of the MCM2-3-5 family, is displaced from chromatin during DNA replication. J. Cell Biol., 129, 1433–1445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lygerou Z. and Nurse,P. (2000) Cell cycle. License withheld—geminin blocks DNA replication. Science, 290, 2271–2273. [DOI] [PubMed] [Google Scholar]
  • 41.Madine M. and Laskey,R. (2001) Geminin bans replication licence. Nature Cell Biol., 3, E49–E50. [DOI] [PubMed] [Google Scholar]
  • 42.Tada S., Li,A., Maiorano,D., Mechali,M. and Blow,J.J. (2001) Repression of origin assembly in metaphase depends on inhibition of RLF-B/Cdt1 by geminin. Nature Cell Biol., 3, 107–113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wohlschlegel J.A., Dwyer,B.T., Dhar,S.K., Cvetic,C., Walter,J.C. and Dutta,A. (2000) Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science, 290, 2309–2312. [DOI] [PubMed] [Google Scholar]
  • 44.Gomez E.B., Catlett,M.G. and Forsburg,S.L. (2002) Different phenotypes in vivo are associated with ATPase motif mutations in Schizosaccharomyces pombe minichromosome maintenance proteins. Genetics, 160, 1305–1318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schwacha A. and Bell,S.P. (2001) Interactions between two catalytically distinct MCM subgroups are essential for coordinated ATP hydrolysis and DNA replication. Mol. Cell, 8, 1093–1104. [DOI] [PubMed] [Google Scholar]
  • 46.Fujita M., Kiyono,T., Hayashi,Y. and Ishibashi,M. (1997) In vivo interaction of human MCM heterohexameric complexes with chromatin. Possible involvement of ATP. J. Biol. Chem., 272, 10928–10935. [DOI] [PubMed] [Google Scholar]
  • 47.Ishimi Y. (1997) A DNA helicase activity is associated with an MCM4, -6 and -7 protein complex. J. Biol. Chem., 272, 24508–24513. [DOI] [PubMed] [Google Scholar]
  • 48.Ishimi Y., Komamura,Y., You,Z. and Kimura,H. (1998) Biochemical function of mouse minichromosome maintenance 2 protein. J. Biol. Chem., 273, 8369–8375. [DOI] [PubMed] [Google Scholar]
  • 49.You Z., Komamura,Y. and Ishimi,Y. (1999) Biochemical analysis of the intrinsic Mcm4-Mcm6-mcm7 DNA helicase activity. Mol. Cell. Biol., 19, 8003–8015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Chong J.P., Hayashi,M.K., Simon,M.N., Xu,R.M. and Stillman,B. (2000) A double-hexamer archaeal minichromosome maintenance protein is an ATP-dependent DNA helicase. Proc. Natl Acad. Sci. USA, 97, 1530–1535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kelman Z., Lee,J.K. and Hurwitz,J. (1999) The single minichromosome maintenance protein of Methanobacterium thermoautotrophicum ΔH contains DNA helicase activity. Proc. Natl Acad. Sci. USA, 96, 14783–14788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Shechter D.F., Ying,C.Y. and Gautier,J. (2000) The intrinsic DNA helicase activity of Methanobacterium thermoautotrophicum ΔH minichromosome maintenance protein. J. Biol. Chem., 275, 15049–15059. [DOI] [PubMed] [Google Scholar]
  • 53.Alexandrow M.G., Ritzi,M., Pemov,A. and Hamlin,J.L. (2002) A potential role for mini-chromosome maintenance (MCM) proteins in initiation at the dihydrofolate reductase replication origin. J. Biol. Chem., 277, 2702–2708. [DOI] [PubMed] [Google Scholar]
  • 54.Keller C., Ladenburger,E.M., Kremer,M. and Knippers,R. (2002) The origin recognition complex marks a replication origin in the human TOP1 gene promoter. J. Biol. Chem., 9, 9. [DOI] [PubMed] [Google Scholar]
  • 55.Ladenburger E.M., Keller,C. and Knippers,R. (2002) Identification of a binding region for human origin recognition complex proteins 1 and 2 that coincides with an origin of DNA replication. Mol. Cell. Biol., 22, 1036–1048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Johnson R.T., Downes,C.S. and Meyns,R.E. (1993) The synchronization of mammalian cells. In Fanes,P. and Brooks,R. (eds), The Cell Cycle: A Practical Approach. IRL Press/Oxford University Press, New York, NY.
  • 57.Gohring F. and Fackelmayer,F.O. (1997) The scaffold/matrix attachment region binding protein hnRNP-U (SAF-A) is directly bound to chromosomal DNA in vivo: a chemical cross-linking study. Biochemistry, 36, 8276–8283. [DOI] [PubMed] [Google Scholar]
  • 58.Dulbecco R.L. and Vogt,M. (1954) Plaque formation and isolation of pure lines with poliomyelitis virus. J. Exp. Med., 99, 167–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kreitz S., Ritzi,M., Baack,M. and Knippers,R. (2001) The human origin recognition complex protein 1 dissociates from chromatin during S phase in HeLa cells. J. Biol. Chem., 276, 6337–6342. [DOI] [PubMed] [Google Scholar]
  • 60.Ritzi M., Baack,M., Musahl,C., Romanowski,P., Laskey,R.A. and Knippers,R. (1998) Human minichromosome maintenance proteins and human origin recognition complex 2 protein on chromatin. J. Biol. Chem., 273, 24543–24549. [DOI] [PubMed] [Google Scholar]
  • 61.Treuner K., Findeisen,M., Strausfeld,U. and Knippers,R. (1999) Phosphorylation of replication protein A middle subunit (RPA32) leads to a disassembly of the RPA heterotrimer. J. Biol. Chem., 274, 15556–15561. [DOI] [PubMed] [Google Scholar]
  • 62.Fujita M., Ishimi,Y., Nakamura,H., Kiyono,T. and Tsurumi,T. (2002) Nuclear organization of DNA replication initiation proteins in mammalian cells. J. Biol. Chem., 277, 10354–10361. [DOI] [PubMed] [Google Scholar]
  • 63.Wold M.S. (1997) Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu. Rev. Biochem., 66, 61–92. [DOI] [PubMed] [Google Scholar]
  • 64.Ladenburger E.M., Fackelmayer,F.O., Hameister,H. and Knippers,R. (1997) MCM4 and PRKDC, human genes encoding proteins MCM4 and DNA-PKcs, are close neighbours located on chromosome 8q12→q13. Cytogenet. Cell Genet., 77, 268–270. [DOI] [PubMed] [Google Scholar]
  • 65.Lee J.K. and Hurwitz,J. (2000) Isolation and characterization of various complexes of the minichromosome maintenance proteins of Schizosaccharomyces pombe. J. Biol. Chem., 275, 18871–18878. [DOI] [PubMed] [Google Scholar]
  • 66.Lee J.K. and Hurwitz,J. (2001) Processive DNA helicase activity of the minichromosome maintenance proteins 4, 6 and 7 complex requires forked DNA structures. Proc. Natl Acad. Sci. USA, 98, 54–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Mendez J., Zou-Yang,X.H., Kim,S.Y., Hidaka,M., Tansey,W.P. and Stillman,B. (2002) Human origin recognition complex large subunit is degraded by ubiquitin-mediated proteolysis after initiation of DNA replication. Mol. Cell, 9, 481–491. [DOI] [PubMed] [Google Scholar]
  • 68.Holthoff H.P., Baack,M., Richter,A., Ritzi,M. and Knippers,R. (1998) Human protein MCM6 on HeLa cell chromatin. J. Biol. Chem., 273, 7320–7325. [DOI] [PubMed] [Google Scholar]
  • 69.Wyrick J.J., Aparicio,J.G., Chen,T., Barnett,J.D., Jennings,E.G., Young,R.A., Bell,S.P. and Aparicio,O.M. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science, 294, 2357–2360. [DOI] [PubMed] [Google Scholar]
  • 70.Connelly M.A., Zhang,H., Kieleczawa,J. and Anderson,C.W. (1998) The promoters for human DNA-PKcs (PRKDC) and MCM4: divergently transcribed genes located at chromosome 8 band q11. Genomics, 47, 71–83. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES