Skip to main content
PLOS One logoLink to PLOS One
. 2007 Jul 25;2(7):e650. doi: 10.1371/journal.pone.0000650

Complete Mitochondrial Genome Sequence of Three Tetrahymena Species Reveals Mutation Hot Spots and Accelerated Nonsynonymous Substitutions in Ymf Genes

Mike M Moradian 1,*, Denis Beglaryan 1, Jill M Skozylas 1, Varand Kerikorian 1
Editor: Sudhindra Gadagkar2
PMCID: PMC1919467  PMID: 17653277

Abstract

The ciliate Tetrahymena, a model organism, contains divergent mitochondrial (Mt) genome with unusual properties, where half of its 44 genes still remain without a definitive function. These genes could be categorized into two major groups of KPC (known protein coding) and Ymf (genes without an identified function). To gain insights into the mechanisms underlying gene divergence and molecular evolution of Tetrahymena (T.) Mt genomes, we sequenced three Mt genomes of T.paravorax, T.pigmentosa, and T.malaccensis. These genomes were aligned and the analyses were carried out using several programs that calculate distance, nucleotide substitution (dn/ds), and their rate ratios (ω) on individual codon sites and via a sliding window approach. Comparative genomic analysis indicated a conserved putative transcription control sequence, a GC box, in a region where presumably transcription and replication initiate. We also found distinct features in Mt genome of T.paravorax despite similar genome organization among these ∼47 kb long linear genomes. Another significant finding was the presence of at least one or more highly variable regions in Ymf genes where majority of substitutions were concentrated. These regions were mutation hotspots where elevated distances and the dn/ds ratios were primarily due to an increase in the number of nonsynonymous substitutions, suggesting relaxed selective constraint. However, in a few Ymf genes, accelerated rates of nonsynonymous substitutions may be due to positive selection. Similarly, on protein level the majority of amino acid replacements occurred in these regions. Ymf genes comprise half of the genes in Tetrahymena Mt genomes, so understanding why they have not been assigned definitive functions is an important aspect of molecular evolution. Importantly, nucleotide substitution types and rates suggest possible reasons for not being able to find homologues for Ymf genes. Additionally, comparative genomic analysis of complete Mt genomes is essential in identifying biologically significant motifs such as control regions.

Introduction

Mt genomes in diverse lineages show extensive variability in size and structural organization, despite their commonly accepted α-proteobacter ancestry. Ciliate Mt genomes are among the most rapidly evolving Mt genomes, as a result of rapid changes in their primary sequences and genome content [1]. The structural and organizational differences between Paramecium and Tetrahymena exemplify the rapid evolution of the ciliate Mt genomes where only half of the open reading frames (ORFs), for which function cannot be assigned (called Ymf based on nomenclature for Mt ORFs), have sufficient sequence similarity to strongly indicate homology [2]. Thus, almost a dozen of the unidentified ORFs in Paramecium and Tetrahymena are not unambiguously homologous. Tetrahymena cells contain close to 1000 mitochondria with a linear DNA molecule, an uncommon occurrence among eukaryotic mitochondria. Chloramphenicol resistance, determined by a mutation virtually certain to reside in the mitochondria, shows cytoplasmic inheritance [3]. Codon bias in Tetrahymena Mt genomes is different than universal code where there is just one stop codon (i.e., TAA), TGA codes for the amino acid tryptophan, yet TAG has not been found [2]. Although the previously sequenced Mt genomes of T.thermophila and T.pyriformis showed complete synteny, they had considerable differences in nucleotide and amino acid sequences. In Tetrahymena Mt genomes, there are 22 Ymf genes with unidentified functions in addition to 22 known protein-coding genes (KPC genes), 7 different tRNAs, and the small and large subunits of ribosomal RNA [2], [4]. The Ymf genes, which are conserved between Tetrahymena species, can be classified as transmembrane or ribosomal proteins based on the similarity of their hydrophobicity plots, physico-chemical properties, nucleotide composition, and codon usage biases [4]. Yet, reliable homologues for almost 50% of Tetrahymena Mt genes could not be identified in any of the available databases. This is particularly unusual given that all but one of the 97 proteins coded for by the Mt genome of the jacobid protozoan Reclinomonas americana can be assigned functions [5].

Comparisons between DNA regions in mitochondria can be useful for differentiating between genome-specific factors such as DNA substitution rates and gene-specific factors such as selection [6]. Sequences from Mt genomes from Tetrahymena are sufficiently similar allowing reliable alignment of orthologous genes and control regions, but they are sufficiently diverged to allow an estimate of the rate of evolutionary change, positive selection, and amino acid replacement and nucleotide substitution patterns. Investigating variations in Mt genes enables understanding of evolutionary forces acting at individual loci and whole genomes [7]. The dn/ds ratio is an important tool for determining the levels of selective pressure. If the dn/ds>1, then one may suspect positive selection; the lower the dn/ds ratio the more selection is acting on the protein [8]. However excess of nonsynonymous substitutions is not sufficient to demonstrate positive selection since such an increase may be due to relaxed selective constraints along certain lineages [9]. The dn/ds rate ratio (ω) produced by codon based models, which allow for variable selection intensity among sites, could detect sites under positive selection when ω>1 [10]. To determine ω these methods, in addition to previously used variables, consider two major features of DNA evolution: the transition/transversion bias and the base or codon frequency bias. Therefore ω can be estimated at each codon site using aligned sequences from several species. Alternatively, Tajima's D statistical analysis [11] is performed to detect selection and deviation from neutrality [12]. Significantly negative Tajima's D values are consistent with positive selective pressure [13], [14]. Methods for estimating dn/ds ratios usually consider whole genes. However during the course of evolution some sites are strictly conserved (for correct folding) whereas others could be subject to positive selection [15]. In several proteins that have been shown to be under positive selection only a few amino acid sites were found to be responsible for adaptive evolution [16]. To detect regions of protein that are under positive selection where the whole protein may not be, one may use a sliding window program, which analyses nucleotide substitution and dn/ds rate ratios for any desired length. Mutation hotspots with accelerated nonsynonymous substitutions could occur in regions that are under positive selection however these do not present positive selection unless they contain sites where ω>1. An explanation for the presence of these regions is that they code for parts of the protein, which do not play essential roles in its function allowing more nonsynonymous nucleotide substitutions or radical amino acid replacements. Amino acid composition and replacement frequencies and patterns are essential to identifying how forces such as selection are acting upon proteins. The evolution of Mt proteins has been studied using different classifications of amino acid replacements based on charge, polarity, and size [17]. These classifications categorize the replacements into radical (non-similar) and conservative (similar), amino acid replacements. It is generally understood that proteins with different functions or from different genomes have different amino acid replacement patterns resulting in variable radical to conservative replacement (Rad/Cons) ratios [18]. Therefore, it is valuable to demonstrate whether such replacement patterns are the product of functional constraints or relaxed selective constraints along certain lineages.

In this study we describe three linear Mt genomes of T.paravorax, T.pigmentosa, and T.malaccensis each about 47kb long and compare their differences. Comparative genomics of Mt DNA sequences from five species of Tetrahymena allowed us to identify a putative transcription control region common to all these genomes. We also report a comprehensive study and quantification of nucleotide substitution and amino acid replacement types and patterns in Mt genomes of Tetrahymena for 22 KPC and 22 Ymf genes. The purpose of this study was to present and describe three additional Tetrahymena Mt genomes, quantify and explain the amount of diversity among them, and discuss possible reasons for our inability to assign function to half of the genes in Mt genomes of ciliated protozoa, genus Tetrahymena.

Results/Discussion

We sequenced the entire Mt genomes of T.paravorax, T.pigmentosa, and T.malaccensis. These Mt genomes, along with the two previously sequenced Mt genomes of T.pyriformis and T. thermophila, are ∼47 kb long, have high A+T content (Table S1), and contain 44 genes. Definitive functions could be assigned to just 22 of them. The remaining 22 were putative proteins with either similar domains to known proteins or no similarity at all. Genome organization and gene arrangements in all five genomes were the same with the exception of an additional putative pseudo-tRNA lysine (K) in T.paravorax, which was located between the 5′ telomere and the inverted repeat region (Figure 1). Pseudo-tRNAs are pseudogenes that cannot form cloverleaf shape structures but can form stem loops (Figure S1). A putative pseudo-lysine-tRNA in T.paravorax Mt genome was located at 5′ end of the genome in the unusually long non-coding sequence (495bp) between the telomere and the large ribosomal subunit. The putative pseudo-lysine-tRNA is located 118 bp away from the telomere. The presence of pseudo-tRNAs is not an unprecedented phenomenon in Mt genomes since pseudo-tRNAs have been reported in Mt genome of plague Thrips imaginis and a few others [19]. In the T.pigmentosa Mt genome the non-coding sequence is absent at the 3′ end of the genome and the non-coding sequence at the 5′ end is only 31 bp. None of the other three species have longer than 65 bp non-coding sequences adjacent to the telomeres. Thus the presence of a long non-coding region with a pseudo-tRNA in T.paravorax may point to the process of elimination and transfer of Mt genes. It is possible that at some point during evolution there was a functional Lysine tRNA adjacent to the telomeres in Mt genome of T.paravorax. Another interesting feature of the T.paravorax Mt genome is a 1 kb sequence in Ymf77 that can be folded into a secondary structure with a very big free energy value, lowest ΔG = −125 Kcal/mole. Such a low ΔG value was not found in homologous region of the other Mt genomes. The A+T content of this T.paravorax region was 96.5% and its secondary structure made it difficult to clone or PCR amplify the region directly from intact Mt DNA. PCR amplification was eventually achieved for a restriction fragment of about 3.9 kb containing this region, after boiling the DNA in 1% SDS.

Figure 1. Gene map of the T.paravorax Mt genome.

Figure 1

Arrows denote direction of transcription. Intergenic region between Cob and Ymf77 genes is considered to contain a putative control region. The trnK* represents the pseudo tRNA in T.paravorax Mt genome.

Putative Transcription Control Region

Engberg and Nielsen mapped the origin of replication of rDNA of T.thermophila to a position close to the middle of the molecule [20]. Similarly the promoter region of the rDNA genes was shown to be located in the same region with a few conserved repeat sequences, which bind to Topoisomerase I [21]. Presence of the origin of replication and transcription in the middle of the rDNA molecule persuaded us to search for such elements in the longest intergenic region at the middle of the Tetrahymena Mt DNA. Comparative genomic analysis of the Cob and Ymf77 intergenic region, which was suspected to contain a control region since a bidirectional transcription initiates from this region, prompted us to search for a transcription control (GC box). Sequence alignments of this region, using the five Mt genomes of Tetrahymena species showed a 94 bp conserved block of sequence in this variable intergenic region (Figure S2). This conserved block contained a 27 bp highly conserved consensus sequence (AATAGCCGCACCTAAAAGAAAAAAATC). Among the 27 bases in these 5 species the consensus sequence had only 3 bases that deviated. In this region, which has 88% A+T, it is highly improbable that the putative GC control box (GCCGCACC) would occur by chance (Figure S2). When the probability of having an A or T is about 0.88 the probability of having eight nucleotides from which seven are either G or C is (0.12)7×(0.88)×8 = 2.5×E−06. Alignment of this intergenic region was littered with gaps, except for the conserved region containing the GC box. This conservation in a highly variable region suggests high selective pressure, which is common among functional elements in genomes. To further show the nucleotide conservation of this presumptive control region we plotted the G+C content and conservation at each nucleotide position (Figure 2). From left to right the genes are nad9, Ymf77, the intergenic region and the cob gene. The cob gene sequence is highly conserved and has a high G+C content, which is a bit variable. The nad9 gene is also conserved, but has a lower G+C value than even Ymf77. Most of Ymf77 is less conserved, due to the highly variable nature of this gene, than either cob or nad9 but has a relatively high G+C value in the carboxyl terminal region (to the left). The intergenic region is less conserved than the cob gene, but similar to Ymf77. The presumptive control region is evident by its conservation and high G+C value (Figure 2). A GC box in general contains the sequence GCCGCCC and is recognized by the factor SP1 [22]. SP1 presumably interacts with other transcription factors (TFs) to initiate transcription. The fact that the genes flanking this sequence are transcribed in opposite orientations increases the confidence that this sequence contains a control region. This region is the site from which bi-directional transcription of most of the Mt genes is initiated. It is likely that DNA replication also originates at this region. Although in bacterial chromosomes and plasmids initiation of DNA replication occurs at a single unique site (e.g., OriC), a consensus sequences for the origin of replication in mitochondria has not yet been established. In mammals and amphibia, some signals are located within the AT rich and variable control region for the replication initiation H-strand and for transcription of both H- and L-strands [23]. The origin of replication and transcription was suspected to be at the same region in Mt genome of P.aurelia [2]. Thus it is quite possible that the conserved block of 27 nucleotides mentioned above may also have a role in replication of Tetrahymena Mt genomes.

Figure 2. Nucleotide conservation in control region.

Figure 2

Arrow denotes the conservation of a putative transcription control, a GC box, which is illustrated by a single elevated peak in control region. Nucleotide Change and G+C content are calculated in a hamming window of size 100. X-axis is the gene length, Y-axis-arbitrary units.

Telomeres

The telomeres for T.paravorax are tandem 64 bp repeats (5′TATCCCTATTCCCTCTATATTCTATCACTTCCCATTATTATTCTAACGTCTA ATGTACTTTGTT3′) with the same sequence at each end, which is the longest known telomere for Mt genomes of Tetrahymena. Following restriction endonuclease digestion of intact Tetrahymena Mt DNA, the terminal restriction fragments were slightly “smeared” due to the variable length of the telomeres. In the case of T.paravorax the terminal restriction fragments could not be identified. The intact T.paravorax Mt DNA was digested with restriction endonuclease Tsp 509 I, which did not cleave within the telomere yet reduced the remainder of the Mt DNA to tiny fragments. After gel electrophoresis a prominent band centered at 6kb and ranging from 3 to 9 kb was observed suggesting that the length of the two telomeric repeats comprised about 22% of the Mt genome. T.paravorax apparently contained on average almost 100 telomeric repeats where the other Tetrahymena Mt genomes appeared to have about 1 or 2 dozen repeats at each end. The telomeres on each terminus of the T.pigmentosa Mt genome were different as previously found by Morin and Cech [24], [25]. The 5′ telomere was 50 bp long (AGTATAGAGTAGTATACAGTATTGGACATAAATGCAGTACATATAAAATA) and the 3′ telomere was 37 bp long (TATCATAATATCCATGTTAAGAATAGGGTTAATATAG). Nothing in the sequence of the T.pigmentosa Mt genome suggested how these telomeres maintained different sequences.

Nucleotide substitutions in KPC and Ymf genes

Ymf genes in Tetrahymena Mt genome are in conserved ORFs, and are homologous among all five Tetrahymena species based on a similarity metric test (for review see reference 4). Therefore they are certainly under selection. An incomplete cDNA library of Tetrahymena Mt genome, which contained 16 mRNA sequences, indicated that at least four of these Ymf genes were transcribed in T.pyriformis [26]. The codon usage between the KPC and Ymf genes in Tetrahymena Mt genomes was extremely similar with very little variation (ANOVA pvalue = 0.9988), however there were three exceptions in Ymf 69, 74, and 71 genes. These genes were diverging rapidly and had elevated dn/ds ratios throughout their sequence such that a few pairwise comparisons failed the Z-score test (Z-scores of <6) by a small margin. These Ymf genes were relatively short genes (average length of 110 amino acids) where the entire sequences have diverged so rapidly that they failed to indicate homology. This was also the case for most of the mutation hot spots in Ymf genes (described in the next section) where they failed to indicate strong homology, when considered separately, after a Z-score analysis.

To study the nucleotide substitution patterns we determined the relative rate of nonsynonymous substitutions for all Ymf and KPC genes using T.paravorax sequences as outgroup. The substitution rates should be similar for any mutation in these genes, the difference is in the rate at which these mutations are fixed. We found no clear division line or conclusive difference between the Ymf and KPC gene groups regarding their nonsynonymous nucleotide substitutions rates. For example Nad10, which is a very conserved KPC gene, contained extremely similar rates of substitutions close to 1, and so did the less conserved Ymf61 and Ymf68.

Analysis of dn/ds and their rate ratio (ω)

To investigate how nucleotide and amino acid replacement types correlated during the evolution of the Tetrahymena Mt genes we compared the dn/ds ratios using the entire sequence for each gene. Pairwise comparisons indicated that Ymf genes on average accumulated more nonsynonymous substitutions resulting in almost three times higher dn/ds ratios than KPC genes (0.48 vs. 0.17). None of the Ymfs had an average dn/ds>1, therefore we suspended the possibility of positive selection pending further analysis. Thus to analyze the main reasons for higher dn/ds values in Ymf genes we introduced a sliding window software program, which calculated nucleotide substitutions as distances and dn/ds ratios for each window. We confirmed our analysis with an alternative program called SWAPSC (see material and methods). These programs completed the tasks by showing the relationships between dn, ds, and their ratio. This relationship was quite clear for KPC genes where they had very low dn and much higher ds values resulting in low dn/ds ratios (Figure 3). Conversely the Ymf genes contained regions with elevated numbers of nonsynonymous substitutions resulting in higher dn/ds ratios. These regions, which were present in almost all of the Ymf genes and in small regions of a few KPC genes such as Nad5, Cox2, and Rps3, could be considered as mutation hotspots. An illustration of these hotspots in Ymf genes is shown in figure 4, where they were compared to other regions of the Ymf genes to show that dn/ds ratios in these genes ranged from almost zero to over 1.5. On the other hand, the conserved regions of Ymf genes had dn/ds ratios comparable to that of KPC genes, which could potentially represent the functional domains of their protein products.

Figure 3. Relationship between dn/ds ratios, dn, and ds values for KPC genes.

Figure 3

Values for each point are from 10 possible pairwise comparisons of five Tetrahymena species. For simplicity the values from pairwise comparison between T.thermophila and T.pyriformis are shown. They are from average window of size 180 sliding 30 nucleotides per permutation.

Figure 4. Relationship between dn/ds ratios, dn, and ds values for Ymf genes.

Figure 4

Values for each point are from 10 possible pairwise comparisons of five Tetrahymena species. For simplicity the values from pairwise comparison between T.thermophila and T.pyriformis are shown. They are from average window of size 180 sliding 30 nucleotides per permutation.

A previous study suggested that in Mt genomes of C. elegans the dn/ds ratio increased by more than five fold when the effects of natural selection were minimized [27]. Our analysis, which showed on average an almost three fold increase in the Ymf dn/ds ratios, seems to support such a conclusion. However increased dn/ds ratios in C. elegans Mt genomes occurred throughout the entire Mt genome with little spatial preference. If minimized natural selection was the reason for increased dn/ds ratios in Tetrahymena Mt genomes then these ratios should have increased in most if not all of the KPC and Ymf genes. Yet, our analysis of dn/ds ratios using a sliding window program, which revealed substitution variations in these genes in detail, did not quite support minimized natural selection throughout the Tetrahymena Mt genome. The rapid divergence of Ymf genes and elevated dn/ds ratios were primarily due to presence of regions with accelerated rates of nonsynonymous mutations (AdN), which were detected by SWAPSC. In addition to identifying regions with AdN we were able to locate regions under positive selection, mutation hot spots, regions with saturated synonymous substitution, and negative selection at specific codon regions. The significant results of SWAPSC output, which identified the variable regions in some Ymf genes that seemed to contain mutation hotspots with accelerated nonsynonymous substitutions are shown in Figure 5 and 6. SWAPSC also uses a sliding window approach yet the program itself determines the most appropriate window size with a maximum of 20 amino acids per window. Hence there are some dn/ds value differences in figure 3 vs figures 5 and 6, which are due to usage of smaller window sizes and ω in SWAPSC. There were a few small regions in some Ymf genes that suggested positive selection yet they could not be considered as a major cause for such an extensive variation. Hence we reconsidered the possibility that these variable regions of Ymf genes, could be under positive selection. To confirm our argument we determined the dn/ds rate ratios in genes with accelerated nonsynonymous substitutions for each codon site using software from PAML package (see material and method). The codonml software in this package revealed likelihood ratios of positive selection or relaxed selective constraints along lineages based on the dn/ds rate ratios (ω) per individual codon for Ymf genes from all five genomes. The significant increases in ω were observed in some Ymf genes and Nad5 (Figure S3). In sum, results from four different software packages, which determined dn/ds, ω, mutation hotspots, accelerated rates of nonsynonymous mutations, and positive selection, indicated that the primary reason for presence of variable regions in Ymf genes were accelerated rates of nonsynonymous mutations. However cases of small sites under positive selection were present in parts of the Ymf 57, 60, 61, 64, 67, 68, 71, 74, 76, and 77 where the dn/ds were elevated and ω>1. We also calculated Tajima's D values for KPC and Ymf genes to detect selection. We found negative D values in all KPC and Ymf genes. But the significantly negative D values in variable regions of Ymf 57, 60, 61, 64, 67, 68, 71, 74, 76, and 77 stood out (Figure S4). These results were consistent with the results from regions presumably under positive selective pressure based on dn/ds and ω. We also found positive selection in the 5′ region of the Nad5 gene with significant dn/ds, ω, and Tajima's D values. Such variable regions with AdN along with more substitutions in Ymf genes could be the cause for our inability to find homologues for them. Thus we conclude that substitution types, numbers, patterns, and fixation rates support the idea that variable regions with AdN in Ymf genes in Tetrahymena Mt cause them to evolve so rapidly that they could not be assigned definitive functions based on sequence similarity or homology. Also presence of sites under positive selection in some Ymf genes contributed to such rapid evolution. The presence of regions with AdN in a few KPC genes (e.g., Nad5) did not weaken our argument since, unlike in Ymf genes, the remaining regions of the aforementioned KPC genes were highly conserved and had preserved their ancestral sequence (Figure 3 and S3).

Figure 5. dn/ds rate ratio Variation in Ymf genes.

Figure 5

Y-axis represents values for dn/ds rate ratios generated by SWAPSC. These ratios are from a codon-based alignment of all five Tetrahymena species. Comparisons are from a maximum window size of 20 amino acids. X-axis indicates types of variation for each codon. Plots A, B, and F are the 5′ variable region of Ymf 64, 64, and 76 genes. Plots C, D, and E show variable regions throughout Ymf 69, 71, and 74 genes. HS- mutation hot spots, S- saturation of synonymous substitutions, NS- negative selection, AdN- accelerated rate of nonsynonymous substitutions, PS- positive selection.

Figure 6. dn/ds rate ratio Variation in Ymf genes.

Figure 6

Y-axis represents values for dn/ds rate ratios generated by SWAPSC. These ratios are from a codon-based alignment of all five Tetrahymena species. Comparisons are from a maximum window size of 20 amino acids. X-axis indicates types of variation for each codon. Plots G and H show variable regions throughout Ymf 67 and 77 genes. HS- mutation hot spots, S- saturation of synonymous substitutions, NS- negative selection, AdN- accelerated rate of nonsynonymous substitutions, PS- positive selection.

Amino acid composition and replacement patterns in Tetrahymena Mt genomes

On the amino acid level pairwise comparisons of Rad/Cons ratios for all 44 genes in Tetrahymena Mt genomes suggested that there was on average an almost two-fold increase in Rad/Cons ratios for Ymfs (1.20) compared to KPC genes (0.67). Since radical amino acid replacements are more likely to alter protein structure their presence would mean more structural variation in any protein. An independent sliding window analysis for Rad/Cons amino acid replacement patterns indicated that radical substitutions occurred with higher frequency in parts of the protein where the dn/ds ratios were elevated (data not shown). If elevated Rad/Cons ratios in Ymf genes were the result of accelerated rates of nonsynonymous substitutions in mutation hotspots then there would be a positive correlation between these ratios. Analysis of the relationship between dn/ds and Rad/Cons ratios among the Ymf genes indicated that there was a significant positive correlation (r = 0.93, pvalue<0.05) between these two ratios (Figure S5). Alternatively, when such correlation was analyzed for KPC genes the correlation coefficient (r) value dropped to 0.73 (r = 0.73, p<0.05), which suggested a weaker relationship between dn/ds and Rad/Cons ratios among KPC genes. This weaker correlation was due to the absence of regions with AdN in KPC genes. Relaxed selective constraint or nonfunctional regions in these proteins could explain this strong correlation where more nonsynonymous substitutions resulted in more radical replacements and consequently more diverged protein structure. The overall amino acid conservation in KPC genes was over 80% compared to significantly lower conservation of 57% in Ymf genes (Table 1). This difference came from the greater number of amino acid replacements in regions with AdN, hence a more detailed study of amino acid replacement types and patterns between KPC and Ymf genes was conducted. According to different amino acid replacement classifications (see materials and methods) there were far fewer radical replacements in KPC genes relative to Ymfs when orthologous proteins were compared. In classification 1 (based on charge) the KPC genes were quite conserved where 11% of accrued replacements were radical in transmembrane and 18% in ribosomal proteins. Conservation was less noticeable in classification 2 (based on polarity and size) where about 40% of the amino acid replacements in KPC genes were radical (Table 1). Insertions and deletions (indels) did not play a major role and comprised approximately 0.5% of the replacements. In Ymf genes, besides a significant increase in the number of amino acid replacements, there was a significant increase in the percentage of radical replacements. The radical amino acid replacements in Ymf genes for classification 1 and 2 were 80 and 40 percent higher respectively, relative to KPC genes. Radical replacements are assumed to be more likely than conservative replacements to alter the structure and function of a protein based on compositional factors and may not be used to infer positive selection [28].

Table 1. Total amino acid conservation and replacement percentages.

Tetrahymena Mitochondria KPC Genes Ymf Genes
AA Change Classifications\Protein Class Tm Rp Putative Tm Putative Rp
Length of AA sequences Compared 44050 12838 40690 17583
Total AA Conservation (%) 84.5 77.9 57.0 57.7
Total Conservative Changes Classification 1(%) 89 82 78.4 74.2
Total Radical Changes Classification 1(%) 11 18 21.6 25.8
Total Conservative Changes Classification 2(%) 60 56 41.3 42.8
Total Radical Changes Classification 2(%) 40 44 58.7 57.2
Positions Containing Gaps(%) 0.5 0.5 3.2 2.6
Classification 1 Conservative Changes
Positive <-> Positive changes (RHK) 1.5 5.9 2.5 5.8
Negative <-> Negative changes (DE) 1.2 1.4 1.2 1.8
Uncharged<->Uncharged changes(ANCQGILMFPTWYV) 97.3 92.6 96.3 92.4
Classification 1 Radical Changes
Positive <-> Negative changes 4.2 3.3 4.9 5.2
Positive <-> Uncharged changes 51.6 76.7 69.7 71.0
Negative <-> Uncharged changes 44.2 20.0 25.4 23.8
Classification 2 Conservative Changes
Special <-> Special changes (C) 0.0 0.0 0.0 0.0
Neutral Small <-> Neutral Small changes (AGPST) 12.8 16.7 10.8 10.4
Polar Small <-> Polar Small changes (NDQE) 7.2 6.7 9.4 13.9
Polar Large <-> Polar Large changes (RHK) 2.2 8.8 4.8 10.1
Non-Polar Small <-> Non-Polar Small changes (ILMV) 69.9 58.6 63.9 55.1
Non-Polar Large <-> Non-Polar Large changes (FWY) 7.9 9.2 11.0 10.4
Classification 2 Radical Changes
Special <-> Neutral Small changes 1.4 2.4 1.2 0.8
Special <-> Polar Small changes 0.2 0.7 0.4 0.3
Special <-> Polar Large changes 0.0 0.2 0.1 0.0
Special <-> Non-Polar Small changes 0.3 0.5 0.5 0.1
Special <-> Non-Polar Large changes 0.3 0.8 0.3 0.4
Neutral Small <-> Polar Small changes 19.2 19.4 13.2 18.6
Neutral Small <-> Polar Large changes 2.2 7.7 2.5 3.7
Neutral Small <-> Non-Polar Small changes 19.7 16.5 8.8 7.6
Neutral Small <-> Non-Polar Large changes 5.9 4.8 3.5 3.2
Polar Small <-> Polar Large changes 8.2 14.7 7.3 11.6
Polar Small <-> Non-Polar Small changes 6.9 7.3 6.8 8.1
Polar Small <-> Non-Polar Large changes 4.8 4.1 5.2 5.0
Polar Large <-> Non-Polar Small changes 2.7 5.3 10.7 9.6
Polar Large <-> Non-Polar Large changes 2.0 3.9 6.2 6.9
Non-Polar Small <-> Non-Polar Large changes 26.1 11.8 33.3 24.1

Transmembrane(Tm) and ribosomal (Rp) proteins in Tetrahemna Mt genomes.

The amino acid replacement frequencies and patterns in two classifications based on charge (classification 1), and polarity and size (classification 2).

For more detail see materials and methods.

Nonsynonymous substitutions and radical to conservative amino acid replacements

To analyze the nonsynonymous substitution patterns in each codon position in Tetrahymena Mt genomes, we compared the average frequency of radical and conservative amino acid replacements in Ymf and KPC genes in each nonsynonymous codon position (Table S2). Results for KPC genes showed that more than half (54%) of the amino acid replacements caused by a substitution at the second codon position were radical (non-similar). The third codon position had fewer, while the first had the fewest radical replacements. A similar pattern was seen for the Ymf genes however with higher (69%) radical replacement percentages (Table S2). When amino acid replacements caused by two or three nucleotide substitutions were added to the analysis, we observed an increase in radical replacement since almost all amino acid replacements caused by these codons were radical.

Although the second codon position had the fewest number of nonsynonymous transversions (data not shown), the frequency of radical replacements was higher than the other codon positions suggesting that transversions did not associate with radical replacements in Tetrahymena Mt genomes. More radical replacements occurred in Ymf genes, 51% on average, than in KPC genes (37%), which was the case for all three codon positions (Table S2). If nucleotide substitutions were to occur randomly (equally for all bases) the ratio of radical to conservative amino acid replacements for first, second, and third codon positions would be 1∶1, 8∶1, and 5∶1 respectively. Although none of the ratios for KPC and Ymf genes were close to that of random patterns, increases in radical replacements in all codon positions suggested that the majority of Ymf genes could be under relaxed selection where they accrued more radical replacements.

Conclusion and Future Plans

In sequencing and assembling of Tetrahymena Mt genomes we faced a few minor obstacles of strong secondary structures and nuclear contamination, however the overall final sequences are quite accurate and reliable. The sequence data from this study are an invaluable addition to previously available Tetrahymena Mt genomes to study evolutionary and functional genomics elements. One of our main goals was to gain insights regarding the reasons for failing to find definitive homologues for Ymf genes. Our analysis suggested that Ymf genes contain mutation hotspots and regions with accelerated rates of nonsynonymous substitutions. We also found relatively shorter regions under positive selection in some Ymf genes. Thus we concluded that a major obstacle in identifying function for Ymf genes was the presence of regions in these genes, which evolved more rapidly relative to the rest of the gene. In a few shorter Ymf genes the entire gene was evolving rapidly. A plausible explanation could be relaxed selective constraint in these variable regions portraying them as nonessential to the function of the protein. Although presence of sites under positive selection could also account for failing to identify function for Ymf genes, their relatively smaller numbers and lengths did not lay sufficient grounds to be considered as a major reason. Also, having five complete Mt genomes allowed us to find a transcription control region in Tetrahymena mitochondria through comparative genome analysis. This project allowed us to develop reliable picture for Tetrahymena Mt genome organization and conduct molecular evolution analysis. Addition of more complete Mt genomes of Tetrahymena and other closely related species genera such as Glaucoma will certainly enhance these evolutionary studies and provide more information for studying ciliate Mt genomics.

Materials and Methods

Mt DNA Isolation, Cloning, and Sequencing

T.paravorax (GenBank Acc. # DQ927304), T.malaccensis (GenBank Acc. # DQ927303), and T.pigmentosa (GenBank Acc. # DQ927305) species were obtained from ATCC and were grown in PYG medium [29], [30]. Isolation of Mt DNA was as previously described [31]. Mitochondria are isolated initially to minimize nuclear DNA contamination during the Mt DNA extraction. Extracted Mt DNA was sheared to fragments of average 2 kb long using a hydro-shear point device [32]. The ends of these fragments were polished with T4 DNA polymerase and filled with Taq DNA polymerase in an extension only reaction, which resulted in an adenine overhang used for direct TA cloning in pCRII vector [33]. The clones were sequenced from both ends using M13 reverse and forward primers (∼500 bp each) and the resulting sequences (about four fold coverage) were assembled into contigs using Phred, Phrap, and Consed [34], [35]. The gaps between the contigs were filled using PCR amplified products with primers for sequences flanking the gaps. The two long inverted repeat regions were PCR amplified, cloned, and sequenced using specific primers for telomeres and the genes adjacent to inverted repeat regions. The length of the T.paravorax telomeres was determined by digesting the Mt DNA with restriction endonuclease Tsp509 I (recognition site AATT). The Bulk of the Mt DNA (and any nuclear DNA contaminate) is reduced to tiny fragments, while the telomere remains uncut. The nucleotide conservation plot was from a triangular hamming window of 100 nucleotides. The blue plot in figure 2 is the sum of the G+C at each position, while the red plot is conservation, 1/(change+1) at each position. The black vertical lines delimit the genes (Figure2).

Gene Arrangement, Homology, Nucleotide substitution and amino acid replacement analysis

Complete Mt genomes of T.paravorax, T.pigmentosa, and T.malaccensis were aligned with the genomes of previously sequenced T.pyriformis (GenBank Acc. # AF160864), and T.thermophila (GenBank Acc. # AF396436) at both DNA and amino acid levels using CLUSTAL X [36]–[38]. The degree of similarity was shown using similarity metric (z score) calculations on ORFs from Mt genomes sequenced in this project with that of previously sequenced T.pyriformis, and T.thermophila. The z-score is obtained by comparing the original alignment score of two sequences with an average score obtained form 1000 alignments of randomized sequence of the two original sequences. The difference between the alignment scores is divided by the SD of the randomized alignment score distribution where the scores greater than 6 are indicative of homology between two sequences [39]–[41]. The z-scores were calculated via software developed in our laboratory (for more explanation of the models see reference 4). The BLAST network services provided at the National Center for Biotechnology Information, tools at the European Bioinformatics Institute, tRNAscan-SE server, and 3D protein structure prediction servers were used for sequence similarity searches to identify genes, proteins, and tRNAs [42]–[45]. DNA from Mt genes from T.paravorax, T.pigmentosa, and T.malaccensis were aligned with sequences from T.pyriformis and T.thermophila using CLUSTAL X. The CLUSTAL X gene alignments were checked by eye to obtain correct outputs in PHYLIP format. There were 10 different alignment combinations for each gene, however an average value is reported in results. The DNA and protein distances were calculated using the DNADIST and PROTDIST applications from the PHYLIP package [46], [47]. The distances were calculated based on Kimura's two-parameter model with correction of multiple substitutions [48]. For comparison, the DNA distances were alternatively obtained from LogDet, and the protein distances from JTT programs available in the PHYLIP software package [47]. The relative-rate of substitutions were calculated using pairwise distances obtained for genes from five Tetrahymena Mt genomes using T.paravorax as the outgroup [10]. The transitional and transversional differences, the Ts/Tv ratios were calculated by software developed based on the “K80” Kimura model [48]. The dn/ds ratios of nucleotide substitutions were calculated using a program from the Los Alamos National Security [49], [50]. This program was based on Nei and Gojobori methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Tajima's D statistical analysis [11] was carried out using DnaSP [51]. Tajima's test is based on the fact that under the neutral model estimates of the number of segregating/polymorphic sites and of the average number of nucleotide differences are correlated. If the value of D is too large or too small, the neutral ‘null’ hypothesis is rejected. Hence it can be used to detect rare alleles, positive selection and population bottlenecks. Positive selection is implied by negative values [14]. Above explained models and programs used here to quantify the nucleotide substitutions correct for multiple substitutions according to their authors. The amino acid replacement and conservation patterns were studied where two aligned amino acid sequences in PHYLIP format were compared and the amino acid replacements were quantified. The replacement patterns were analyzed under two different classifications based on charge, and volume and polarity. Classification 1 (by charge) divided the amino acids into three categories: positive (R,H,K), negative (D,E), and uncharged (A,N,C,Q,G,I,L,M,F,P,S,T,W,Y,V). Classification 2 (by volume and polarity) divided the amino acids into six categories: special (C), neutral and small (A,G,P,S,T), polar and relatively small (N,D,Q,E), polar and relatively large (R,H,K), nonpolar and relatively small (I,L,M,V), and nonpolar and relatively large (F,W,Y) [52]. Intra-group replacements were considered as conservative and inter-group ones as radical replacements. The Rad/Cons ratios were calculated by using the amino acid alignments and the conversion categories in classification 2 and were normalized by the length of the protein. Assuming random nucleotide substitution in all possible codons using classification 2 the ratio of radical to conservative replacements for the first, second, and third codon position changes are 17∶19, 25∶3, and 5∶1 accordingly.

PAML and Sliding window programs

The codonml software from PMAL package was used to determine the dn/ds rate ratios (ω) for individual codon site [53].

For sliding window analysis, we first developed a software program, which uses a sliding window approach to simultaneously calculate distance, dn/ds, Ts/Tv and Rad/Cons ratios. This program can accept variable window and step sizes depending on the length of the analyzed gene and return the desired ratios for that specific length. Calculated values were on average based on a window of 180 and a step size of 30 nucleotides yet in a few occasions they varied depending on the gene length. For example, the window size used for Ymf 77 (more than 4000bp in length) was 270 with a step size of 90, which considerably reduced the graph noise. On the contrary for Rps 19 (less than 300 bp) the window size 0f 90 and step size of 21 was used to obtain optimum results. With the exception of dn/ds ratio all other variables were calculated by this software using models explained above. The dn/ds ratio was calculated by calling the program developed at LANS (referenced above). All software developed for this study was coded in perl script and is available upon request. To confirm our results from sliding window analysis we used a software package called SWAPSC, which similarly uses a sliding window analysis procedure to calculate selective constraint [54]. SWAPSC automatically optimizes the window size based on a randomized sequence of the input genes with a maximum window size of 20 codons per permutation. This test detects significant selective constraints at specific codon regions of a protein alignment in single branches of a protein. The program detects positive selection, mutation hot spots, saturation of synonymous substitution, negative selection, accelerated rates of nonsynonymous substitution by calculating dn, ds, and ω. A detailed table, which could explain different mutational dynamics based on the values of dn, ds, and ω was used to determine which one of the mechanisms mentioned above explains the substitution patterns [54].

Supporting Information

Table S1

Mitochondral Genome Statistics. Length and A+T content of Tetrahymena Mt genomes. Length is in base pair, and A+T in percentages.

(0.04 MB PDF)

Table S2

Average frequencies for radical and conservative amino acid replacements. Data from pairwise comparison of Ymf and KPC genes in Tetrahymena Mt genomes; codons with one nucleotide substitution (top); codons with two and three nucleotide substitutions added (bottom).

(0.02 MB PDF)

Figure S1

Secondary structure of Lysine pseudo-tRNA in T.paravorax.

(1.09 MB TIF)

Figure S2

Nucleotide alignment of the cob and ymf77 intergenic region. GeneDoc Nucleotide alignment of the cob and ymf77 intergenic region. Sequences between position 345-371 represent the conserved region with the transcription control GC sequence starting at position 349. Alignment of flanking regions are shown for comparison.

(0.05 MB PDF)

Figure S3

The nonsyn/syn substitution rate ratios for all Ymf genes. For comparison the same is shown for Nad5 (with a highly variable region) and Nad10 (most conserved KPC gene). Rate ratios >1 represent regions, which could be under positive selection.

(0.50 MB TIF)

Figure S4

Tajima's D values for all Ymf and Nad5 genes. *** denotes significant Tajima's negative D values which represent regions under positive selection.

(0.06 MB PDF)

Figure S5

Correlation graph for dn/ds vs. Rad/Cons ratios for Ymf genes. Each point is based on average pairwise comparison of Ymf genes. Total of 10 comparisons per orthologous gene using five mt genomes.

(0.03 MB PDF)

Acknowledgments

We want to thank Clifford Brunk, Ken Jones, Jin Li, and Erik Avaniss-Aghajani for their useful comments.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: IGERT training program fellowship from NIH.

References

  • 1.Gray MW, Burger G, Lang BF. Mitochondrial Evolution. Science. 1999;283:1476–1481. doi: 10.1126/science.283.5407.1476. [DOI] [PubMed] [Google Scholar]
  • 2.Burger G, Zhu Y, Littlejohn TG, Greenwood SJ, Schnare MN, et al. Complete Sequence of the mitochondrial Genome of Tetrahymena pyriformis and Comparison with Paramecium aurelia mitochondrial DNA. J Mol Biol. 2000;297:365–380. doi: 10.1006/jmbi.2000.3529. [DOI] [PubMed] [Google Scholar]
  • 3.Bleyman LK. Ciliates. Cells as Organisms. Jena, NY: Gustav Fisher Verlag, Stuttgart; 1996. Ciliate genetics; pp. 291–324. [Google Scholar]
  • 4.Brunk CF, Lee LC, Tran AB, Li J. Complete sequence of Mt genome of Tetrahymena thermophila and comparative methods for identifying highly divergent genes. Nucl Acid Res. 2003;31:1673–1682. doi: 10.1093/nar/gkg270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lang BF, Burger G, O'Kelley CJ, Cedergren R, Golding GB, et al. An ancestral mitochondrial DNA resembling a eubacterial genome in miniature. Nature. 1997;387:493–497. doi: 10.1038/387493a0. [DOI] [PubMed] [Google Scholar]
  • 6.Gray MW, Lang BF, Cedergren R, Golding GB, Lemieux C, et al. Genome structure and gene content in protist mitochondrial DNAs. Nucl Acid Res. 1998;26:865–878. doi: 10.1093/nar/26.4.865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ballard J, William O. Comparative genomics of mitochondrial DNA in Drosophila simulans. J of Mol Evol. 2000;51:64–75. doi: 10.1007/s002390010067. [DOI] [PubMed] [Google Scholar]
  • 8.Li WH. Sunderland, MA: Sinauer associate; 1997. Molecular evolution. pp. 216–218. [Google Scholar]
  • 9.Crandall KA, Hillis DM. Rhodopsin evolution in the dark. Nature. 1997;387:667–668. doi: 10.1038/42628. [DOI] [PubMed] [Google Scholar]
  • 10.Yang Z, Nielsen R. Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary model. Mol Biol Evol. 2000;17:32–43. doi: 10.1093/oxfordjournals.molbev.a026236. [DOI] [PubMed] [Google Scholar]
  • 11.Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123:585–595. doi: 10.1093/genetics/123.3.585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chiang Y, Schaal BA, Chou CH, Huang S, Chiang TY. Contrasting selection modes at the Adh1 locus in outcrossing Miscanthus sinensis vs. inbreeding Miscanthus condensatus. (Poaceae) Am J Botany. 2003;90:561–570. doi: 10.3732/ajb.90.4.561. [DOI] [PubMed] [Google Scholar]
  • 13.Carlson CS, Thomas DJ, Eberle MA, Swanson JE, Livingston RJ, et al. Genomic regions exhibiting positive selection identified from dense genotype data. Genome Res. 2005;11:1553–1565. doi: 10.1101/gr.4326505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yu F, Sabeti PC, Hardenbol P, Fu Q, Fry B, et al. Positive Selection of a Pre-Expansion CAG Repeat of the Human SCA2 Gene. PLoS Genet. 2005;1(3):e41. doi: 10.1371/journal.pgen.0010041. doi:10.1371/journal.pgen.0010041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Siltberg J, Liberles DA. A simple covarion-based approach to analyze nucleotide substitution rates. J Evol Biol. 2002;15:588–594. [Google Scholar]
  • 16.Yokoyama S, Yokoyama R. Adaptive evolution of photoreceptors and visual pigments in vertebrates. Ann. Rev. Ecol. Syst. 1996;27:543–567. [Google Scholar]
  • 17.Blouin MS, Yowell CA, Courtney CH, Dame JB. Substitution bias, rapid saturation, and the use of mt DNA for nematode systematics. Mol Biol Evol. 1998;15:1719–1727. doi: 10.1093/oxfordjournals.molbev.a025898. [DOI] [PubMed] [Google Scholar]
  • 18.Zhang J. Rates of conservative and radical amino acid substitutions in mammalian genes. J Mol Evol. 2000;50:56–68. doi: 10.1007/s002399910007. [DOI] [PubMed] [Google Scholar]
  • 19.Shao R, Barker SC. The highly rearranged Mt genome of the plague thrips, Thrips imaginis. (Insecta: Thysanoptera): convergence of two novel gene boundaries and an extraordinary arrangement of rRNA genes. Mol Biol Evol. 2003;20:362–370. doi: 10.1093/molbev/msg045. [DOI] [PubMed] [Google Scholar]
  • 20.Engberg J, Nielsen H. Complete sequence of the extrachromosomal rDNA molecule from the ciliate Tetrahymena thermophila strain B1868VII. Nucl Acid Res. 1990;18:6915–6919. doi: 10.1093/nar/18.23.6915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Andersen AH, Gocke E, Bonven BJ, Nielsen OF, Westergaard O. Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promotor region of the rRNA gene from Tetrahymena pyriformis. Nucl Acid Res. 1985;13:1543–1557. doi: 10.1093/nar/13.5.1543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pugh BF, Tjian R. Mechanisms of transcriptional activation by Sp1: evidence for co-activators. Cell. 1990;61:1187–1197. doi: 10.1016/0092-8674(90)90683-6. [DOI] [PubMed] [Google Scholar]
  • 23.Clayton DA. Int Rev Cyto. Vol. 141. London: Academic Press; 1992. Transcription and replication of animal mitochondrial DNAs. pp. 217–232. [DOI] [PubMed] [Google Scholar]
  • 24.Morin GB, Cech TR. Mitochondrial telomeres: surprising diversity of repeated telomeric DNA sequences among six species of Tetrahymena. Cell. 1988a;52:367–374. doi: 10.1016/s0092-8674(88)80029-1. [DOI] [PubMed] [Google Scholar]
  • 25.Morin GB, Cech TR. Telomeric Repeats of Tetrahymena malaccensis mitochondrial DNA: a Multimodal Distrinbution That Fluctuates Erratically during Growth. Mol&Cell Biol. 1988b;8:4450–4458. doi: 10.1128/mcb.8.10.4450-4458.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Edqvist J, Burger G, Gray MW. Expression of mitochondrial protein-coding genes in Tetrahymena pyriformis. J Mol Biol. 2000;297:381–393. doi: 10.1006/jmbi.2000.3530. [DOI] [PubMed] [Google Scholar]
  • 27.Denver RD, Morris K, Lynch M, Vassilieva L, Thomas WK. High direct estimate of the mutation rate in mitochondrial genome of Caenorhabditis elegans. Science. 2000;289:2342–2344. doi: 10.1126/science.289.5488.2342. [DOI] [PubMed] [Google Scholar]
  • 28.Dagan T, Talmor Y, Graur D. Ratios of radical to conservative amino acid replacement are affected by mutational and compositional factors and may not be indicative of positive Darwinian selection. Mol Biol Evol. 2002;19:1022–1025. doi: 10.1093/oxfordjournals.molbev.a004161. [DOI] [PubMed] [Google Scholar]
  • 29.Orias E, Bruns PJ. Induction and isolation of mutants in Tetrahymena. Methods in Cell Biology. 1976;8:247–282. [PubMed] [Google Scholar]
  • 30.Nanny DL, Simon EM. San Diego: (Asai and Forney) Academic Press; 2000. Laboratory and Evolutionary History of Tetrahymena thermophila. Tetrahymena thermophila. pp. 4–25. [DOI] [PubMed] [Google Scholar]
  • 31.Brunk CF, Hanawalt PC. Mitochondrial DNA in Tetrahymena pyriformis. Expt Cell Res. 1969;554:143–149. doi: 10.1016/0014-4827(69)90225-0. [DOI] [PubMed] [Google Scholar]
  • 32.Thorstenson YR, Hunicke-Smith SP, Oefner PJ, Davis RW. An Automated Hydrodynamic Process for Controlled, Unbiased DNA Shearing. Genome Meth. 1998;8:848–855. doi: 10.1101/gr.8.8.848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hu YG, Carter M, Jones MGK. Direct cloning and sequencing of restricted fragments with cohesive-ends by means of TA cloning. Xibei Zhiwu Xuebao. 2003;23:875–878. [Google Scholar]
  • 34.Ewing B, Hillier L, Wendl MC, Green P. Base-Calling of Automated Sequencer Traces Using Phred I. Accuracy Assessment. Genome Res. 1998a;8:175–18. doi: 10.1101/gr.8.3.175. [DOI] [PubMed] [Google Scholar]
  • 35.Ewing B, Green P. Base-Calling of Automated Sequencer Traces Using Phred II. Error Probabilities. Genome Res. 1998b;8:186–194. [PubMed] [Google Scholar]
  • 36.Higgins DG, Sharp PM. CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene. 1988;73:237–44. doi: 10.1016/0378-1119(88)90330-7. [DOI] [PubMed] [Google Scholar]
  • 37.Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comp Appl Biosci. 1989;5:151–153. doi: 10.1093/bioinformatics/5.2.151. [DOI] [PubMed] [Google Scholar]
  • 38.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Doolittle RF. Searching through Sequence Databases. Meth in Enzymology. 1990;183:99–110. doi: 10.1016/0076-6879(90)83008-w. [DOI] [PubMed] [Google Scholar]
  • 40.Pearson WR. Rapid and sensitive sequence comparison with FASTP and FASTA. Meth in Enzymology. 1990;183:63–98. doi: 10.1016/0076-6879(90)83007-v. [DOI] [PubMed] [Google Scholar]
  • 41.Mount DW. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001. Bioinformatics: Sequence and Genome Analysis. pp. 96–118. [Google Scholar]
  • 42.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 43.Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucl Acids Res. 1997;25:955–964. doi: 10.1093/nar/25.5.955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kelley LA, MacCallum RM, Sternberg MJ. Enhanced genome annotation using structural profiles in the program 3D. J Mol Biol. 2000;299:499–520. doi: 10.1006/jmbi.2000.3741. [DOI] [PubMed] [Google Scholar]
  • 45.Lopez R, Silventoinen V, Robinson S, Kibria A, Gish W. WU-Blast2 server at the European Bioinformatics Institute. Nucl Acids Res. 2003;31:3795–3798. doi: 10.1093/nar/gkg573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Felsenstein J. PHYLIP-Phylogeny Inference Package Version 3.2. Cladistics. 1989;5:164–166. [Google Scholar]
  • 47.Felsenstein J. SA: Distributed by the author Department of Genetics, University of Washington; 1993. PHYLIP. (Phylogeny Inference Package) version 3.5c. [Google Scholar]
  • 48.Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  • 49.Nei M, Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986;3:418–426. doi: 10.1093/oxfordjournals.molbev.a040410. [DOI] [PubMed] [Google Scholar]
  • 50.Korber B. HIV Signature and Sequence Variation Analysis. Computational Analysis of HIV Molecular Sequences, Chapter. 2001;4:55–72. [Google Scholar]
  • 51.Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:2496–2497. doi: 10.1093/bioinformatics/btg359. [DOI] [PubMed] [Google Scholar]
  • 52.Yang Z, Nielsen R, Hasegawa M. Models of amino acid substitutions and applications to Mt protein evolution. J Mol Biol Evol. 1998;12:1600–1611. doi: 10.1093/oxfordjournals.molbev.a025888. [DOI] [PubMed] [Google Scholar]
  • 53.Yang Z. PAML: a program package for phylogenetic analysis by maximum likelihood. Comp Appl Biosci. 1997;13:555–556. doi: 10.1093/bioinformatics/13.5.555. [DOI] [PubMed] [Google Scholar]
  • 54.Fares MA. SWAPSC: sliding window analysis procedure to detect selective constraints. Bioinformatics. 2004;20:2867–2868. doi: 10.1093/bioinformatics/bth303. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

Mitochondral Genome Statistics. Length and A+T content of Tetrahymena Mt genomes. Length is in base pair, and A+T in percentages.

(0.04 MB PDF)

Table S2

Average frequencies for radical and conservative amino acid replacements. Data from pairwise comparison of Ymf and KPC genes in Tetrahymena Mt genomes; codons with one nucleotide substitution (top); codons with two and three nucleotide substitutions added (bottom).

(0.02 MB PDF)

Figure S1

Secondary structure of Lysine pseudo-tRNA in T.paravorax.

(1.09 MB TIF)

Figure S2

Nucleotide alignment of the cob and ymf77 intergenic region. GeneDoc Nucleotide alignment of the cob and ymf77 intergenic region. Sequences between position 345-371 represent the conserved region with the transcription control GC sequence starting at position 349. Alignment of flanking regions are shown for comparison.

(0.05 MB PDF)

Figure S3

The nonsyn/syn substitution rate ratios for all Ymf genes. For comparison the same is shown for Nad5 (with a highly variable region) and Nad10 (most conserved KPC gene). Rate ratios >1 represent regions, which could be under positive selection.

(0.50 MB TIF)

Figure S4

Tajima's D values for all Ymf and Nad5 genes. *** denotes significant Tajima's negative D values which represent regions under positive selection.

(0.06 MB PDF)

Figure S5

Correlation graph for dn/ds vs. Rad/Cons ratios for Ymf genes. Each point is based on average pairwise comparison of Ymf genes. Total of 10 comparisons per orthologous gene using five mt genomes.

(0.03 MB PDF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES