Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jun 15.
Published in final edited form as: J Immunol. 2016 May 18;196(12):5130–5137. doi: 10.4049/jimmunol.1502135

Experimental anti-inflammatory drug Semapimod inhibits Toll-like receptor signaling by targeting the TLR chaperone gp961

Jin Wang *, Anatoly V Grishin *,†,2, Henri R Ford *,†
PMCID: PMC4896225  NIHMSID: NIHMS781250  PMID: 27194788

Abstract

Semapimod, a tetravalent guanylhydrazone, suppresses inflammatory cytokine production and has potential in a variety of inflammatory and autoimmune disorders. The mechanism of action of Semapimod is not well understood. Here we demonstrate that in rat IEC-6 intestinal epithelioid cells, Semapimod inhibits activation of p38 MAPK, NF-kB and induction of COX-2 by TLR ligands, but not by IL-1β or stresses. Semapimod inhibits TLR4 signaling (IC50≈0.3 μM) and acts by desensitizing cells to LPS; it fails to block responses to LPS concentrations of 5 μg/ml or higher. Inhibition of TLR signaling by Semapimod is almost instantaneous: the drug is effective when applied simultaneously with LPS. Semapimod blocks cell surface recruitment of the MyD88 adapter, one of the earliest events in TLR signaling. gp96, the ER-localized chaperone of the HSP90 family critically involved in the biogenesis of TLRs, was identified as a target of Semapimod using ATP-desthiobiotin pull-down and mass spectroscopy. Semapimod inhibits ATP-binding and ATPase activities of gp96 in vitro (IC50≈0.2-0.4 μM). On prolonged exposure, Semapimod causes accumulation of TLR4 and TLR9 in perinuclear space, consistent with ER retention, an anticipated consequence of impaired gp96 chaperone function. Our data indicate that Semapimod desensitizes TLR signaling via its effect on the TLR chaperone gp96. Fast inhibition by Semapimod is consistent with gp96 participating in high affinity sensing of TLR ligands in addition to its role as a TLR chaperone.

Keywords: Toll-like receptors, innate immune signaling, gp96 chaperone, inhibitors

Introduction

Semapimod (CNI-1493, N, N’-bis [3, 5-diacetylphenyl] decanediamide tetrakis [amidinohydrazone]) was initially designed as a bulky arginine mimetic to limit arginine transport and nitric oxide production during inflammation (1). In addition to the expected inhibition of inflammatory cytokine-induced arginine transport in macrophages, Semapimod attenuated inflammation and protected against lethal endotoxemia (1). Inhibition of arginine uptake and NO production was not the only mechanism responsible for the anti-inflammatory effect of Semapimod: the drug inhibited LPS-induced inflammatory cytokine release by macrophages at concentrations at least 10 times lower than that required for the inhibition of arginine uptake (2). Semapimod inhibits inflammatory responses not only in macrophages/monocytes, but in other cell types as well, including endothelial cells (3), dendritic cells (4), and enterocytes (5). Since its discovery, Semapimod has been reported to have a beneficial effect in a broad range of experimental and clinical inflammatory conditions, such as acute endotoxemia (6, 7), bacterial infection (8), malaria (9), arthritis (10, 11), autoimmune encephalomyelitis (12), Alzheimer's disease (13), pancreatitis (14), allograft rejection (15), cancer (16, 17), post-operative ileus (18, 19), and Crohn's disease (20, 21).

The mechanism of action of Semapimod is not well understood. It inhibits activating phosphorylation of MAPKs of p38, JNK, and ERK families in response to inflammatory stimuli (21-23), but it does not directly inhibit these kinases. Although Semapimod directly inhibits c-Raf (21), a MAPK kinase kinase upstream of ERK, this does not explain blockade of activation of p38 and JNK, which are independent of c-Raf. Semapimod has been found to directly inhibit deoxyhypusine synthase, an enzyme that catalyzes post-translational modification of the translation initiation factor 5A, which might explain the antiviral and anti-malaria effects (9, 24), but not the blockade of inflammatory cytokine production. Upon intracranial injection, Semapimod potently activates the cholinergic anti-inflammatory pathway involving the vagus nerve (25, 26), however, this does not explain the drug's anti-inflammatory effects in vitro.

The intestinal epithelium becomes largely refractory to the TLR ligands following bacterial colonization, which has been extensively demonstrated in the adult, microbiota-associated intestine. However, the naïve epithelium of the neonates possesses TLR responsiveness similar to that of the professional innate immune cells (5, 27-31). TLR signaling in the epithelium plays critical role in the pathogenesis of necrotizing enterocolitis, a disease coincident with the onset of bacterial colonization of the gut (29, 32-34). We are interested in Semapimod because it improves outcomes of experimental necrotizing enterocolitis (35). Since Semapimod is not absorbed in the intestine (19), it is an attractive drug for organ-targeted therapy of intestinal inflammatory disorders.

Here we demonstrate that in enterocytes, Semapimod inhibits TLRs by targeting their common molecular chaperone gp96.

Materials and Methods

Cell culture, reagents

IEC-6, HEK293, and SW480 cell lines were grown as recommended by the supplier (ATCC, Manassas, VA). IEC-6 cells were used at passages 17-28. For all experiments, cells were plated at 4-5×104/cm2 and grown overnight to 70-90% confluence. Cell viability was determined by Trypan Blue staining. Reagents were purchased from the following suppliers: Semapimod, Medkoo Biosciences (Chapel Hill, NC); recombinant canine gp96, catalog # ADI-SPP-766, Enzo Life Sciences (Farmingdale, NY); recombinant human HSP90, catalog # SPR-101A, StressMarq Biosciences, Victoria BC, Canada; LPS from E. coli 0127:B8, MG132, geldanamycin, radicicol, and NECA, Sigma Aldrich (St. Louis, MO); tripalmytoil – cysteine-serine-(lysine)4 (Pam3CSK4)3, Tocris Bioscience (Bristol, UK); ultrapure flagellin from S. typhimurium, InvivoGen (San Diego, CA), recombinant rat IL-1β, Peprotech (Rocky Hill, NJ), peroxynitrite, Cayman Chemical (Ann Arbor, MI) ATP-desthiobiotin kit, Thermo Scientific (Rockford, IL). Abs were from the following sources: gp96 (H-212), TLR4 (H80), Santa Cruz Biotechnology (Santa Cruz, CA); TLR9 (SAB2104136), FLAG M2, Sigma (St. Louis, MO) phospho-p38, p38, phospho-MKK3/6, IkBα, Cell Signaling Technology (Danvers, MA); cyclooxygenase-2 (COX-2), Cayman Chemical; iNOS, BD Biosciences (San Jose, CA); MyD88, Abcam (Cambridge, MA); HSP90, StressMarq Biosciences. Synthetic oligonucleotide TCGTCGTTTCGTCCGGCGCGCCGG was used as CpG DNA.

TLR4 plasmid and transient transfection

The mTLR4-Flag plasmid (constructed by R. Medzhitov, catalog # 13087) was obtained from Addgene (Cambridge, MA). HEK293 human embryonic kidney cells were transiently transfected using the calcium phosphate precipitate method. Control cells were transfected with the empty pFLAG-CMV2 vector (Sigma).

Western blots, immunofluorescence

Standard procedures were used as described previously (5). For quantitative protein measurements, band densities on underexposed Western blots were determined using GelDoc imaging system and Quantity One software (Bio-Rad, Hercules, CA). Immunofluorescence images were acquired on LSM 700 confocal system (Carl Zeiss Microimaging, Thornwood, NY). For comparisons, sections were mounted and processed on the same slide. Identical acquisition settings and image adjustments were used. Surface and 1 μm sub-surface signal intensity was measured using the ImageJ software by scanning randomly chosen cells along a horizontal line across the center of the nucleus.

Immunoprecipitation

The standard procedure was used (Santa Cruz Biotechnology), except that cells were lysed in NP40 buffer (1% NP40, 100 mM NaCl, 20 mM Tris pH8.0, 0.5 mM PMSF).

ATP-desthiobiotin pulldown and identification of gp96

IEC-6 cells were lysed with NP40 buffer containing 2.5 mM MgCl2 for 10 min at 4°C, and the lysate was cleared by high speed centrifugation. Incubation with ATP-desthiobiotin, adsorption to streptavidin-agarose beads, washing and elution were performed as recommended by the manufacturer. Eluted proteins were separated on 20 cm 10% polyacrylamide gel, and protein bands were visualized by silver staining. Protein bands were identified at CHLA Proteomics Core. Briefly, bands excised from gel were digested with trypsin, and resulting peptides were identified using liquid chromatography – mass spectroscopy. Protein identity was established by database search for matching peptides.

gp96 ATP binding

20 μl reactions (20 mM HEPES pH 7.2, 50 mM NaCl, 2.5 mM MgCl2, 0.1 mM DTT, 200 μM (100 μCi/ml) ATP-γ-35S, 100 μg/ml gp96, with or without Semapimod) were incubated 30 min at 37°C and loaded onto drained and pre-cooled 1 ml Sephadex G25 spin columns. The columns were spun for 2 min at 2,000 rpm and 4°C. Radioactivity of flow-through was determined by scintillation counting. In control reactions, gp96 was substituted for equivalent amount of autoclaved porcine collagen. Following background subtraction, data were expressed as percent of ATP-γ35S binding in the absence of the inhibitor.

ATPase

20 μl reactions (20 mM HEPES pH 7.2, 50 mM NaCl, 2.5 mM MgCl2, 0.1 mM DTT, 20 μM (100 μCi/ml) γ-32P ATP, 100 μg/ml gp96 or HSP90, with or without Semapimod) were incubated 3 h at 37°C. 0.5 ml 5% wt/vol suspension of activated charcoal (Norit A) equilibrated with 20 mM HEPES pH 7.2, 50 mM NaCl, 5 mM EDTA, 200 μM ATP was mixed with samples, and after 10 min agitation at room temperature, activated charcoal was removed by centrifugation. Radioactivity of the clear supernatant was measured by Čerenkov counting. In control reactions, gp96 was substituted for equivalent amount of autoclaved porcine collagen. Following background subtraction, data were expressed as percent of charcoal-absorbed radioactivity in the absence of inhibitor.

Statistical methods

Quantitative data were expressed as means ± SD. Data were compared using unpaired t-test.

Results

Semapimod specifically blocks responses to a subset of Toll-like receptor ligands

Since Semapimod has been reported to inhibit a variety of inflammatory responses, it was not clear what aspects of inflammation are affected. To define targets of Semapimod in the inflammatory cascade, we examined effects of this drug on inflammatory responses in intestinal epithelial cells elicited by a variety of stimuli. The IEC-6 cell line was chosen because these are primary untransformed epithelioid cells with presumably intact innate immune machinery. Pre-treatment with Semapimod blocked LPS-induced, but not IL-1β-induced activating phosphorylation of p38 MAPK and its upstream activators MAPK kinases 3/6 (Fig. 1A). These protein kinases are critical mediators of transcriptional induction of COX-2, the rate-limiting enzyme in the biosynthesis of inflammatory prostanoids. MAPK kinases 3/6 mediate inflammatory cytokine- and stress-induced, but not LPS-induced expression of COX-2 in enterocytes (5). As expected, Semapimod also blocked LPS-induced, but not IL-1β-induced expression of COX-2 (Fig. 1B). Semapimod failed to block IL-1β-induced expression of another key inflammatory factor, inducible nitric oxide synthase (iNOS). iNOS was not appreciably induced by LPS either in the presence or absence of Semapimod (Fig. 1B). Induction of COX-2 by osmotic shock, oxidative stresses, or proteasome blockade was unaffected (Fig. 1C). Semapimod blocked activating phosphorylation of p38 MAPK induced by Pam3CSK4 and CpG DNA, the agonists of TLR2 and 9, respectively (Fig. 1D), but not by the TLR5 agonist flagellin (Fig. 1F). Semapimod did not significantly affect cell viability (Fig. 1E), which rules out effects of alarmons released from dead cells. Thus, Semapimod appears to specifically block responses mediated by a subset of TLRs including TLR2, 4, and 9.

FIGURE 1.

FIGURE 1

Open in a new tab

Effects of Semapimod on pro-inflammatory responses in IEC-6 cells. (A) Activating phosphorylation of p38 MAPK and MKK3/6 MAPKK following 15 min pre-treatment with 10 μM Semapimod and 15 min treatment with 100 ng/ml LPS or 1 ng/ml IL-1β, as indicated. (B) Levels of iNOS, COX-2 and β-actin proteins following 15 min pre-treatment with 10 μM Semapimod and 12 h treatment with 100 ng/ml LPS or 1 ng/ml IL-1β, as indicated. (C) Levels of COX-2 protein following 15 min pre-treatment with (solid boxes) or without (open boxes) 10 μM Semapimod and 12 h treatment with: 1 ng/ml IL-1β; 100 ng/ml LPS; osmotic stress (Osm) with 0.5 M glycerol; oxidative stress with 200 μM H2O2 or 20 μM peroxynitrite (PN); protein misfolding stress with 3 μM proteasome inhibitor MG132. Ctrl, control, untreated cells. *p<0.01. COX-2 levels are relative to β-actin levels. (D) Activating phosphorylation of p38 MAPK after pre-treatment with or without 10 μM Semapimod for 15 min and treatment for 15 min with 100 ng/ml LPS, or 1 μg/ml Pam3CSK4, or 1 μg/ml CpG DNA, as indicated. (E) Levels of cell death following 24 h incubation of IEC-6 cells with or without 10 mM Semapimod as indicated. (F) Activating phosphorylation of p38 MAPK after pre-treatment with 10 μM Semapimod and treatment with LPS or indicated concentrations of flagellin. All data are representative of at least three independent experiments.

Semapimod blocks TLR-mediated activation of NF-kB

To elucidate whether Semapimod blocks responses mediated by pro-inflammatory signaling pathways other than p38, we examined effects of this drug on activation of the NF-kB pathway, as judged by the levels of the inhibitory subunit IkBα. IkBα is rapidly degraded in response to inflammatory stimuli, which relieves inhibition of the NF-kB and leads to transcriptional activation of inflammatory genes. Semapimod blocked LPS-induced (Fig. 2A), but not IL-1β-induced (Fig. 2B) degradation of IkBα. Semapimod also blocked degradation of IkBα induced by CpG DNA and Pam3CSK4 (Fig. 2D), but not by flagellin (Fig. 2E). Thus, Semapimod blocks TLR ligand-induced activation of both p38 MAPK and NF-kB signaling, suggesting that the blockade occurs early in the signaling cascade, before branching into the p38 and NF-kB pathways.

FIGURE 2.

FIGURE 2

Open in a new tab

Semapimod blocks activation of NF-kB by a group of TLR ligands. (A, B) Levels of IkBα in cells pre-treated with or without 10 μM Semapimod and treated with LPS or IL-1β as indicated. (C) Levels of IkBα after pre-treatment with 10 μM Semapimod and treatment with 100 ng/ml LPS, or 1 μg/ml CpG DNA, or 1 μg/ml Pam3CSK4, as indicated. (D) Levels of IkBα following pre-treatment with or without Semapimod and treatment with 100 ng/ml LPS or indicated concentrations of flagellin. Results are representative of at least three independent experiments.

Semapimod desensitizes responses to TLR ligands

According to Fig. 2A, Semapimod inhibits degradation of IkBα induced by LPS concentrations up to 1 μg/ml, but is ineffective at 5 μg/ml, suggesting that inhibition can be overcome by high concentration of LPS. To examine this effect in more detail, we studied inhibition at various concentrations of LPS and Semapimod. In the absence of Semapimod, LPS caused a dose-dependent increase in p38 phosphorylation at concentrations between 1 and 100 ng/ml (Fig. 3A). Semapimod concentrations from 0.02 to 10 μM progressively shifted the response curve to the right (Fig. 3A). At any concentration up to 10 μM, Semapimod failed to significantly inhibit response to 5 μg/ml LPS or higher. The IC50 of Semapimod for response to 20-1000 ng/ml LPS is about 0.3 μM (Fig. 3B). Similar results were obtained for inhibition of responses to CpG DNA, the agonist of TLR9 (Supporting Fig. 1). Thus, Semapimod appears to desensitize responses to TLR ligands in a dose-dependent fashion.

FIGURE 3.

FIGURE 3

Open in a new tab

Semapimod desensitizes responses to LPS. (A) Phospho-p38/p38 ratio as function of LPS concentration in the presence of 0, 0.2, 0.5, and 10 μM Semapimod. (B) Phospho-p38/p38 ratio following treatment with indicated concentrations of LPS in μg/ml as function of Semapimod concentration. Values are percentages of full activation (100 ng/ml LPS for 15 min) in the absence of Semapimod. SD of the individual points are 20% or less. (C) Time course of inhibition by 2 μM Semapimod of IkBα degradation induced by 15 min treatment with 100 ng/ml LPS. Time of addition of Semapimod is relative to the beginning of LPS treatment.

We next examined the time course of inhibition. Semapimod inhibited LPS-induced IkBα degradation when applied before or simultaneously with, but not after application of LPS (Fig. 3C). Therefore, Semapimod acts almost instantaneously, but is ineffective once the response has been initiated.

Semapimod blocks LPS-induced cell surface localization of MyD88

Recruitment of the cytosolic adapter protein MyD88 to the plasma membrane-localized TLRs is one of the earliest events in inflammatory signaling (36). To test whether Semapimod affects this event, we examined changes in intracellular localization of MyD88 following stimulation with LPS, with or without pre-treatment with Semapimod. In untreated cells, MyD88 localized to “myddosomes”, granule-like structures dispersed throughout the cell (37). LPS caused pronounced localization of MyD88 to the cell surface in the absence, but not in the presence of Semapimod (Fig. 4). Therefore, Semapimod blocks LPS-induced cell surface localization of MyD88, consistent with blockade of MyD88 recruitment to the TLR4 complexes on the cell surface.

FIGURE 4.

FIGURE 4

Open in a new tab

Semapimod blocks LPS-induced recruitment of MyD88 to cell surface. Top: Anti-MyD88 immunostaining following 10 min treatment with 100 ng/ml LPS, with or without 15 min pre-treatment with 2 μM Semapimod as indicated. Arrowheads indicate localization of MyD88 to the cell surface. Bar=5 μm. NS, normal rabbit serum. Similar results were obtained in 4 independent experiments. Bottom: Ratios of surface to sub-surface MyD88 signal in cells treated with or without LPS and Semapimod, as indicated. n=40 in each treatment group. *, significant difference from other groupss, p<0.0001.

Semapimod targets glycoprotein-96

Since TLRs associate with multiple ATP-binding proteins including protein kinases TRAF6, TAK1, RIP2 (38, 39) and heat shock proteins (40, 41), we performed a pull-down assay for ATP-binding proteins in the presence or absence of Semapimod. Cell lysates prepared from IEC-6 cells treated with or without LPS in the presence or absence of Semapimod were incubated with ATP-desthiobiotin, a reagent that covalently binds to ATP-binding sites in proteins. ATP-desthiobiotin-modified proteins were then collected on streptavidin-agarose beads, and bound proteins were analyzed by gel electrophoresis and silver staining. LPS treatment did not cause any detectable change in the spectra of bound proteins. However, Semapimod treatment resulted in disappearance of a prominent band of about 100 kDa, regardless of LPS treatment (Fig. 5A). This band was excised and the corresponding protein was identified as gp96 using trypsin digestion, liquid chromatography and database-linked mass spectroscopy. The identity of the ~100 kDa species as gp96 was further confirmed by Western blot. gp96-immunoreactive species was not recovered by ATP-desthiobiotin pull-down if cells were treated with Semapimod (Fig. 5B). Interestingly, Semapimod did not interfere with the ATP-desthiobiotin pull-down of HSP90, the cytosolic paralog of gp96 (Fig. 5B). These results demonstrate that Semapimod specifically abrogates modification of gp96 with ATP-desthiobiotin.

FIGURE 5.

FIGURE 5

Open in a new tab

Semapimod abrogates modification of gp96 with ATP-desthiobiotin. (A) Silver-stained gel of IEC-6 proteins modified by ATP-desthiobiotin and collected on streptavidin-agarose. Cells were pre-treated with 10 μM Semapimod for 15 min and then treated with LPS for 15 min as indicated. The prominent protein band that is present or absent depending on Semapimod treatment is indicated by arrowhead. (B) Immunoblot analysis of IEC-6 proteins modified by ATP-desthiobiotin. Cells were treated with or without Semapimod, and ATP-desthiobiotin-modified proteins were analyzed by Western blotting with anti-gp96, anti-HSP90, and anti-β-actin Abs. β-actin is pulled down by ATP-desthiobiotin because it is an ATP-binding protein. M, marker lanes; positions of protein size markers are indicated on the left. Data are representative of at least three independent experiments.

gp96 is a glycoprotein chaperone of the HSP90 family that facilitates folding, assembly, and trafficking of a limited number of client proteins, most notably TLR signaling complexes (42-46). gp96 resides in the endoplasmic reticulum (ER) and possesses intrinsic ATPase activity, which is required for its chaperone function (47-50). gp96 deficiency obliterates TLR signaling due to failure of trafficking of functional TLR complexes to the cell surface (44). It was therefore plausible that Semapimod inhibits multiple TLRs via its effect on gp96.

Semapimod inhibits ATP-binding and ATPase activities of gp96

Protection from modification by ATP-desthiobiotin by Semapimod indirectly indicates that the latter inhibits ATP-binding and/or ATPase activity of gp96. To test such inhibition directly, we examined effects of Semapimod on ATP binding and ATPase activities of purified gp96 in vitro. ATP binding was measured by incubating the gp96 protein with 35S-labeled ATP-γS, a nonhydrolysable analog of ATP, followed by spin column size exclusion chromatography on Sephadex G25, and determining radioactivity of the high molecular weight (flow through) fraction. Semapimod inhibited ATP binding in a dose-dependent fashion (IC50 ≈0.4 μM, Fig. 6A). ATPase activity was measured by incubating gp96 with γ-32P ATP, followed by adsorption of released inorganic phosphate on activated charcoal and determining the radioactivity of unhydrolysed ATP. Semapimod inhibited gp96 ATPase in a dose-dependent fashion (IC50 ≈0.3 μM, Fig. 6B), which is close to the IC50 for ATP binding and innate immune response inhibition in IEC-6 cells (Fig. 3, Supplemental Fig. 1). At the concentration that completely inhibits gp96 ATPase, Semapimod did not appreciably inhibit the ATPase activity of HSP90, the cytosolic paralog of gp96 (Fig. 6B, inset). Therefore, Semapimod directly and specifically inhibits ATP-binding and ATPase activities of gp96.

FIGURE 6.

FIGURE 6

Open in a new tab

Semapimod inhibits ATP-binding and ATPase activities of gp96. (A) Effect of Semapimod on ATP-binding activity of gp96. (B) Effect of Semapimod on ATPase activity of gp96. Inset, effect of Semapimod on ATPase activity of HSP90. Values are percentages of activities in the absence of Semapimod. Error bars show SD. The data are from the four independent assays.

Comparisons of Semapimod to other gp96 inhibitors

To gain an additional insight into the mechanism of action of Semapimod, we sought to elucidate whether known gp96 inhibitors block LPS signaling like Semapimod, and whether Semapimod inhibits trafficking of TLR signaling complexes similar to other gp96 inhibitors. To answer the first question, we examined LPS-induced IkBα degradation and p38 MAPK phosphorylation in IEC-6 cells pre-treated with geldanamycin, or radicicol, or N-ethyl carboxamidoadenosine (NECA). These drugs have been shown to inhibit gp96 by associating with its nucleotide-binding pocket (51-55). Geldanamycin and radicicol indeed inhibited responses to LPS, however, only upon prolonged exposure of 3 h or more (Fig. 7A). By contrast, Semapimod blocked LPS signaling almost instantaneously (Fig. 3C). NECA failed to block LPS signaling at any concentration tested up to 20 μM (Fig. 7A). Although geldanamycin and radicicol inhibit LPS signaling, their effect is slow, which implies a different mechanism of action and is consistent with the blockade of TLR trafficking to the cell surface. To answer the second question, we examined effects of Semapimod on subcellular localization of TLR4 and TLR9 in SW480 enterocytes. This cell line of human origin allowed the use of proven anti-human TLR4 and TLR9 antibodies. Responses of SW480 cells to LPS and CpG DNA are similar to those of IEC-6 cells. The bulk of TLRs localized to granules dispersed throughout the cell body, as previously reported (56, 57). Exposure to Semapimod caused dramatic accumulation of both TLRs in the perinuclear space (Fig. 7B), which is consistent with retention in the endoplasmic reticulum (ER). Thus, Semapimod affects subcellular localization of TLRs in a manner expected of an inhibitor of gp96 chaperone function. On the one hand, Semapimod is different from geldanamycin and radicicol in its rapid effect on TLR4 signaling, which is consistent with inhibition of the pre-existing TLR4 signaling complexes. On the other hand, Semapimod is similar to the other two gp96 inhibitors in its ability to block intracellular trafficking of the TLRs.

FIGURE 7.

FIGURE 7

Open in a new tab

Comparisons between Semapimod and other gp96 inhibitors. (A) IkBα and phospho-p38 levels after pre-treatment with 8 μM geldanamycin, 8 μM radicicol, or 20 μM NECA and treatment with 100 ng/ml LPS as indicated. (B) TLR4 and TLR9 immunofluorescence in SW480 cells before (left) and after (right) 3 h treatment with 2 μM Semapimod. Bar=5 μM. NS, normal rabbit serum. (C) Co-immunoprecipitation of FLAG-tagged TLR4 and gp96 from lysates of HEK293 cells transiently expressing FLAG-TLR4, with or without 10 μM Semapimod. Cells were treated as indicated with Semapimod for 2 h prior to lysis, and the drug was also added to cell lysates. All data are representative of at least three independent experiments.

Geldanamycin has been reported to disrupt gp96-TLR complexes, as judged by co-immunoprecipitation (42). To test whether Semapimod acts by dissociating gp96-TLR complexes, we transiently transfected HEK293 cells with FLAG-tagged TLR4 and examined effect of Semapimod on co-immunoprecipitation of gp96 and TLR4. Semapimod failed to block co-immunoprecipitation of these two proteins (Fig. 7C), indicating that its effects on TLR4 does not involve physical dissociation of gp96-TLR4 complexes.

Discussion

In this report we demonstrate that in primary enterocyte cell culture, Semapimod inhibits signaling by agonists of Toll-like receptors TLR2, 4 and 9, but not by TLR5 agonist, the inflammatory cytokine IL-1β, or cellular stresses. Effects of Semapimod on responses to LPS are dose-dependent with regard to concentrations of both Semapimod and LPS. In cells treated with Semapimod, higher concentrations of LPS are required to elicit the same response than in untreated cells, and Semapimod fails to block responses to LPS applied at concentrations of 5 μg/ml or higher. gp96, an ER-associated chaperone of the HSP90 family, which is critically involved in assembly and trafficking of the TLR signaling complexes, was identified as a target of Semapimod using a pull-down assay for the ATP-binding proteins. Semapimod inhibits ATP binding and ATPase activity of purified gp96 in a dose-dependent fashion in vitro. Like the known gp96 inhibitors geldanamycin and radicicol, Semapimod impedes trafficking of TLR4. However, Semapimod inhibits TLR4 signaling much faster than geldanamycin or radicicol, which is consistent with direct inhibition of TLR signaling, but not with indirect effect via impaired receptor trafficking.

The fact that Semapimod does not alter the dose-response curves for TLR ligands, but rather shifts them to higher ligand concentrations, indicates that this drug acts by reducing the affinity of TLRs to their ligands rather than by inhibiting receptor signaling. Even at highest Semapimod concentrations tested, the responses, including p38 phosphorylation or IkBα degradation, were not inhibited as long as high concentrations of TLR ligands were used. This mode of action is consistent with a model whereby the high, but not the low affinity of TLR receptor complexes to their cognate ligands depends on gp96 (Fig. 8).

FIGURE 8.

FIGURE 8

Open in a new tab

Model of Semapimod effects on TLR receptor complexes. Semapimod rapidly shifts cell surface TLR complexes into the low affinity state by inhibiting cell surface gp96. In addition, by inhibiting intracellular gp96 (dashed arrow), Semapimod blocks TLR trafficking from the ER to the cell surface.

Several lines of evidence argue that Semapimod blocks innate immune responses at the level of TLRs. First, because this drug inhibits neither IL-1β-induced activation of NF-kB or expression of iNOS, nor IL-1β- or stress-induced activation of p38 MAPK or expression of COX-2, it does not appear to directly target the intracellular NF-kB or p38 MAPK signaling cascades. The blockade of TLR ligand-induced IkBα degradation and p38 MAPK phosphorylation indicates that Semapimod targets a common upstream activator shared by NF-kB and p38 MAPK pathways, which is consistent with blockade at the receptor level. Second, Semapimod apparently decreases the affinity of the TLR4 signaling complex to its ligand, LPS. At concentrations up to 10 μM, Semapimod has no effect on responses to LPS applied at high concentrations. Such behavior is most easily explained by targeting the receptor complex, but it is inconsistent with blockade of a downstream signaling mediator. Third, Semapimod blocks recruitment of the MyD88 adapter, the earliest detectable event in TLR signaling. Since TLRs and IL-1 receptor share the key elements of their downstream signaling cascades (58), the failure of Semapimod to inhibit signaling from the IL-1 receptor also argues against a downstream signaling mediator as target.

Using a pull-down assay for ATP-binding proteins, we have identified gp96, the ER paralog of the HSP90 chaperone, as a direct target of Semapimod. Judging by abrogation of gp96 pull-down by Semapimod in the ATP-desthiobiotin-streptavidin assay, this drug interferes with modification of gp96 by ATP-desthiobiotin, an ATP derivative that covalently attaches to the ATP-binding pockets in proteins. Blockade of ATP-desthiobiotin modification indirectly indicated that Semapimod inhibits the ATP-binding activity of gp96. To corroborate inhibition of ATP binding, we examined effects of Semapimod on ATP-binding and ATPase activities of purified gp96, and found that both were inhibited in a dose-dependent fashion and with similar IC50. It remains unknown whether Semapimod inhibits ATP binding/ATPase activities of gp96 by interaction with the ATP-binding pocket or an allosteric site. X-ray crystallography is needed provide an answer to this question.

The facts that Semapimod inhibits TLR signaling at the receptor level, and that it directly targets gp96, the essential chaperone for TLRs (45, 46), strongly argue that Semapimod inhibits TLR signaling via its effect on gp96. Close IC50 values for inhibition of TLR signaling and for inhibition of gp96 ATP binding and ATPase activities provide further support for this idea. Insensitivity of IL-1β responses to Semapimod is in agreement with known independence of IL-1 receptor biogenesis from gp96 (45). Although our data strongly implicate gp96, they cannot formally rule out other targets of Semapimod in TLR signaling. However, auxiliary proteins shared by IL-1R and TLRs, as well as receptor-specific auxiliary proteins such as MD-2 or CD14 can be excluded as targets. If main receptor subunits (TLR2, 4 and 9 proteins) are targets, one would expect different IC50 for each receptor, which was not the case.

Semapimod is similar to geldanamycin and radicicol, the two known gp96 inhibitors, in its ability to block intracellular trafficking of the TLRs, and thus to act as one would expect of a true gp96 inhibitor. However, unlike the other two inhibitors whose effect on TLR4 signaling is slow, Semapimod inhibits TLR4 signaling fast. Unlike geldanamycin or radicicol, Semapimod fails to inhibit the ATPase activity of the closely related HSP90, and is thus not a generic HSP90 family inhibitor. A plausible explanation for Semapimod's fast effect on responses to LPS is inhibition by this drug of gp96 associated with cell surface high affinity TLR signaling complexes. This explanation is consistent with increased sensitivity to LPS upon surface expression of gp96 protein (43) or treatment with low concentrations of extrinsic gp96 (59), as well as competition between gp96 and LPS for cell surface binding (60).

Our results provide mechanistic explanation as to why Semapimod is effective in experimental NEC. The neonates are generally supersensitive to the TLR ligands (31). The naïve intestinal epithelium of the neonates responds to TLR ligands (27, 28, 30), and these responses may play critical role in the pathogenesis of NEC (32-34, 61). Thus, Semapimod may prevent NEC by blocking TLR ligand signaling in the neonatal intestine.

Our study provides an insight into the roles of gp96 in TLR signaling complexes. It is generally believed that gp96 participates in TLR signaling by facilitating correct folding, plasma membrane insertion, and trafficking of receptor signaling complexes to the cell surface (40). If this is true, one could expect gp96 inhibitors to block TLR signaling slowly, as pre-existing plasma membrane TLR complexes should not be affected. Slow (hours) inhibition of responses to LPS is what we indeed observed using the classic gp96 inhibitors geldanamycin and radicicol. However, unlike these two inhibitors, Semapimod desensitizes LPS responses almost instantaneously, which indicates inhibition of signaling by pre-existing TLR complexes. Therefore, if Semapimod inhibits TLR signaling via gp96, the latter somehow participates in high affinity TLR ligand sensing. The idea of gp96 participating in cell surface TLR signaling is not entirely novel. Soluble gp96 and LPS have been shown to compete with each other for binding polymorphonuclear neutrophils (60). Externally added gp96, while not an effective TLR agonist per se, enhances responses to TLR2 and TLR4 ligands in dendritic cells (59). Forced surface expression of gp96 causes TLR4 hyper-responsiveness (43). LPS responses and LPS binding to cells are inhibited by an externally added peptide inhibitor of gp96 (62, 63). All these data indicate that surface gp96 enhances TLR signaling. Although Semapimod acts like a classic gp96 chaperone inhibitor in its ability to block TLR trafficking, it possesses a novel property of rapidly inhibiting TLR signaling, presumably by targeting gp96 on the cell surface. Accordingly, Semapimod may find use as pharmacologic tool for dissecting the complex role of gp96 in TLR function.

Surprisingly, Semapimod does not affect responses to flagellin, the ligand of TLR5, despite the known dependence of TLR5 trafficking on gp96 (46). One might speculate that although TLR5 depends on gp96 for its biogenesis, gp96 may not be required for efficient flagellin sensing by the TLR5 receptor complex.

Identification of Semapimod as inhibitor of Toll-like receptor signaling may shed light on the mechanisms of action of this drug in a variety of inflammatory disorders.

Supplementary Material

1

Acknowledgments

We thank Mary Beth Amrine, Alexandria Lee, and Rudolph Davis for help with experiments and Christopher Gayer and G. Esteban Fernandez for critical reading of the manuscript.

Footnotes

1

This work was supported by NIH grant R01 AI014032 to H.R.F.

3

Abbreviations used inh this article: COX-2, cyclooxygenase-2; ER, endoplasmic reticulum; iNOS, inducible nitric oxide synthase; NECA, N-ethyl carboxamidoadenosine; Pam3CSK4, tripalmitoyl cysteine (lysine)4.

References

  • 1.Bianchi M, Ulrich P, Bloom O, Meistrell M, 3rd, Zimmerman GA, Schmidtmayerova H, Bukrinsky M, Donnelley T, Bucala R, Sherry B, et al. An inhibitor of macrophage arginine transport and nitric oxide production (CNI-1493) prevents acute inflammation and endotoxin lethality. Mol. Med. 1995;1:254–266. [PMC free article] [PubMed] [Google Scholar]
  • 2.Bianchi M, Bloom O, Raabe T, Cohen PS, Chesney J, Sherry B, Schmidtmayerova H, Calandra T, Zhang X, Bukrinsky M, Ulrich P, Cerami A, Tracey KJ. Suppression of proinflammatory cytokines in monocytes by a tetravalent guanylhydrazone. J. Exp. Med. 1996;183:927–936. doi: 10.1084/jem.183.3.927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mullins GE, Sunden-Cullberg J, Johansson AS, Rouhiainen A, Erlandsson-Harris H, Yang H, Tracey KJ, Rauvala H, Palmblad J, Andersson J, Treutiger CJ. Activation of human umbilical vein endothelial cells leads to relocation and release of high-mobility group box chromosomal protein 1. Scand. J. Immunol. 2004;60:566–573. doi: 10.1111/j.0300-9475.2004.01518.x. [DOI] [PubMed] [Google Scholar]
  • 4.Zinser E, Turza N, Steinkasserer A. CNI-1493 mediated suppression of dendritic cell activation in vitro and in vivo. Immunobiology. 2004;209:89–97. doi: 10.1016/j.imbio.2004.04.004. [DOI] [PubMed] [Google Scholar]
  • 5.Grishin AV, Wang J, Potoka DA, Hackam DJ, Upperman JS, Boyle P, Zamora R, Ford HR. Lipopolysaccharide induces cyclooxygenase-2 in intestinal epithelium via a noncanonical p38 MAPK pathway. J. Immunol. 2006;176:580–588. doi: 10.4049/jimmunol.176.1.580. [DOI] [PubMed] [Google Scholar]
  • 6.Molina PE, Qian L, Schuhlein D, Naukam R, Wang H, Tracey KJ, Abumrad NN. CNI-1493 attenuates hemodynamic and pro-inflammatory responses to LPS. Shock. 1998;10:329–334. doi: 10.1097/00024382-199811000-00004. [DOI] [PubMed] [Google Scholar]
  • 7.Oettinger CW, D'Souza MJ. Synergism in survival to endotoxic shock in rats given microencapsulated CNI-1493 and antisense oligomers to NF-kappaB. J. Microencapsulation. 2010;27:372–376. doi: 10.3109/02652040903243437. [DOI] [PubMed] [Google Scholar]
  • 8.Granert C, Abdalla H, Lindquist L, Diab A, Bahkiet M, Tracey KJ, Andersson J. Suppression of macrophage activation with CNI-1493 increases survival in infant rats with systemic Haemophilus influenzae infection. Infect. Immun. 2000;68:5329–5334. doi: 10.1128/iai.68.9.5329-5334.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Specht S, Sarite SR, Hauber I, Hauber J, Gorbig UF, Meier C, Bevec D, Hoerauf A, Kaiser A. The guanylhydrazone CNI-1493: an inhibitor with dual activity against malaria-inhibition of host cell pro-inflammatory cytokine release and parasitic deoxyhypusine synthase. Parasitol. Res. 2008;102:1177–1184. doi: 10.1007/s00436-008-0891-x. [DOI] [PubMed] [Google Scholar]
  • 10.Larsson E, Harris HE, Palmblad K, Mansson B, Saxne T, Klareskog L. CNI-1493, an inhibitor of proinflammatory cytokines, retards cartilage destruction in rats with collagen induced arthritis. Annals Rheumatic Dis. 2005;64:494–496. doi: 10.1136/ard.2004.021550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Palmblad K, Erlandsson-Harris H, Tracey KJ, Andersson U. Dynamics of early synovial cytokine expression in rodent collagen-induced arthritis : a therapeutic study using a macrophage-deactivating compound. Am. J. Pathol. 2001;158:491–500. doi: 10.1016/S0002-9440(10)63991-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Martiney JA, Rajan AJ, Charles PC, Cerami A, Ulrich PC, Macphail S, Tracey KJ, Brosnan CF. Prevention and treatment of experimental autoimmune encephalomyelitis by CNI-1493, a macrophage-deactivating agent. J. Immunol. 1998;160:5588–5595. [PubMed] [Google Scholar]
  • 13.Bacher M, Dodel R, Aljabari B, Keyvani K, Marambaud P, Kayed R, Glabe C, Goertz N, Hoppmann A, Sachser N, Klotsche J, Schnell S, Lewejohann L, Al-Abed Y. CNI-1493 inhibits Abeta production, plaque formation, and cognitive deterioration in an animal model of Alzheimer's disease. J. Exp. Med. 2008;205:1593–1599. doi: 10.1084/jem.20060467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Denham W, Fink G, Yang J, Ulrich P, Tracey K, Norman J. Small molecule inhibition of tumor necrosis factor gene processing during acute pancreatitis prevents cytokine cascade progression and attenuates pancreatitis severity. Am. Surgeon. 1997;63:1045–1049. discussion 1049-1050. [PubMed] [Google Scholar]
  • 15.Yang X, Szabolcs M, Minanov O, Ma N, Sciacca RR, Bianchi M, Tracey KJ, Michler RE, Cannon PJ. CNI-1493 prolongs survival and reduces myocyte loss, apoptosis, and inflammation during rat cardiac allograft rejection. J. Cardiovasc. Pharmacol. 1998;32:146–155. doi: 10.1097/00005344-199807000-00023. [DOI] [PubMed] [Google Scholar]
  • 16.Atkins MB, Redman B, Mier J, Gollob J, Weber J, Sosman J, MacPherson BL, Plasse T. A phase I study of CNI-1493, an inhibitor of cytokine release, in combination with high-dose interleukin-2 in patients with renal cancer and melanoma. Clin. Cancer Res. 2001;7:486–492. [PubMed] [Google Scholar]
  • 17.Kemeny MM, Botchkina GI, Ochani M, Bianchi M, Urmacher C, Tracey KJ. The tetravalent guanylhydrazone CNI-1493 blocks the toxic effects of interleukin-2 without diminishing antitumor efficacy. Proc. Natl. Acad. Sci. USA. 1998;95:4561–4566. doi: 10.1073/pnas.95.8.4561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.The F, Cailotto C, van der Vliet J, de Jonge WJ, Bennink RJ, Buijs RM, Boeckxstaens GE. Central activation of the cholinergic anti-inflammatory pathway reduces surgical inflammation in experimental post-operative ileus. Brit. J. Pharmacol. 2011;163:1007–1016. doi: 10.1111/j.1476-5381.2011.01296.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wehner S, Vilz TO, Sommer N, Sielecki T, Hong GS, Lysson M, Stoffels B, Pantelis D, Kalff JC. The novel orally active guanylhydrazone CPSI-2364 prevents postoperative ileus in mice independently of anti-inflammatory vagus nerve signaling. Langenbeck's Arch. Surg. 2012;397:1139–1147. doi: 10.1007/s00423-012-0989-6. [DOI] [PubMed] [Google Scholar]
  • 20.Dotan I, Rachmilewitz D, Schreiber S, Eliakim R, van der Woude CJ, Kornbluth A, Buchman AL, Bar-Meir S, Bokemeyer B, Goldin E, Maaser C, Mahadevan U, Seidler U, Hoffman JC, Homoky D, Plasse T, Powers B, Rutgeerts P, Hommes D, Semapimod CDCDI. A randomised placebo-controlled multicentre trial of intravenous semapimod HCl for moderate to severe Crohn's disease. Gut. 2010;59:760–766. doi: 10.1136/gut.2009.179994. [DOI] [PubMed] [Google Scholar]
  • 21.Lowenberg M, Verhaar A, van den Blink B, ten Kate F, van Deventer S, Peppelenbosch M, Hommes D. Specific inhibition of c-Raf activity by semapimod induces clinical remission in severe Crohn's disease. J. Immunol. 2005;175:2293–2300. doi: 10.4049/jimmunol.175.4.2293. [DOI] [PubMed] [Google Scholar]
  • 22.Cohen PS, Schmidtmayerova H, Dennis J, Dubrovsky L, Sherry B, Wang H, Bukrinsky M, Tracey KJ. The critical role of p38 MAP kinase in T cell HIV-1 replication. Mol. Med. 1997;3:339–346. [PMC free article] [PubMed] [Google Scholar]
  • 23.Hommes D, van den Blink B, Plasse T, Bartelsman J, Xu C, Macpherson B, Tytgat G, Peppelenbosch M, Van Deventer S. Inhibition of stress-activated MAP kinases induces clinical improvement in moderate to severe Crohn's disease. Gastroenterology. 2002;122:7–14. doi: 10.1053/gast.2002.30770. [DOI] [PubMed] [Google Scholar]
  • 24.Sommer MN, Bevec D, Klebl B, Flicke B, Holscher K, Freudenreich T, Hauber I, Hauber J, Mett H. Screening assay for the identification of deoxyhypusine synthase inhibitors. J. Biomol. Screening. 2004;9:434–438. doi: 10.1177/1087057104264031. [DOI] [PubMed] [Google Scholar]
  • 25.Bernik TR, Friedman SG, Ochani M, DiRaimo R, Ulloa L, Yang H, Sudan S, Czura CJ, Ivanova SM, Tracey KJ. Pharmacological stimulation of the cholinergic antiinflammatory pathway. J. Exp. Med. 2002;195:781–788. doi: 10.1084/jem.20011714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Borovikova LV, Ivanova S, Nardi D, Zhang M, Yang H, Ombrellino M, Tracey KJ. Role of vagus nerve signaling in CNI-1493-mediated suppression of acute inflammation. Autonomic Neurosci. 2000;85:141–147. doi: 10.1016/S1566-0702(00)00233-2. [DOI] [PubMed] [Google Scholar]
  • 27.Ganguli K, Meng D, Rautava S, Lu L, Walker WA, Nanthakumar N. Probiotics prevent necrotizing enterocolitis by modulating enterocyte genes that regulate innate immune-mediated inflammation. Am. J. Physiol. Gastrointest. Liver Physiol. 2013;304:G132–141. doi: 10.1152/ajpgi.00142.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Good M, Siggers RH, Sodhi CP, Afrazi A, Alkhudari F, Egan CE, Neal MD, Yazji I, Jia H, Lin J, Branca MF, Ma C, Prindle T, Grant Z, Shah S, Slagle D, 2nd, Paredes J, Ozolek J, Gittes GK, Hackam DJ. Amniotic fluid inhibits Toll-like receptor 4 signaling in the fetal and neonatal intestinal epithelium. Proc. Natl. Acad. Sci. USA. 2012;109:11330–11335. doi: 10.1073/pnas.1200856109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nanthakumar NN, Fusunyan RD, Sanderson I, Walker WA. Inflammation in the developing human intestine: A possible pathophysiologic contribution to necrotizing enterocolitis. Proc. Natl. Acad. Sci. USA. 2000;97:6043–6048. doi: 10.1073/pnas.97.11.6043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang J, Ouyang Y, Guner Y, Ford HR, Grishin AV. Ubiquitin-editing enzyme A20 promotes tolerance to lipopolysaccharide in enterocytes. J. Immunol. 2009;183:1384–1392. doi: 10.4049/jimmunol.0803987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhao J, Kim KD, Yang X, Auh S, Fu YX, Tang H. Hyper innate responses in neonates lead to increased morbidity and mortality after infection. Proc. Natl. Acad. Sci. USA. 2008;105:7528–7533. doi: 10.1073/pnas.0800152105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chan KL, Wong KF, Luk JM. Role of LPS/CD14/TLR4-mediated inflammation in necrotizing enterocolitis: pathogenesis and therapeutic implications. World J. Gastroenterol. 2009;15:4745–4752. doi: 10.3748/wjg.15.4745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ginzel M, Yu Y, Klemann C, Feng X, von Wasielewski R, Park JK, Hornef MW, Torow N, Vieten G, Ure BM, Kuebler JF, Lacher M. The viral dsRNA analogue poly (I:C) induces necrotizing enterocolitis in neonatal mice. Pediatr. Res. 2015 doi: 10.1038/pr.2015.261. epub ahead of print. [DOI] [PubMed] [Google Scholar]
  • 34.Hackam DJ, Afrazi A, Good M, Sodhi CP. Innate immune signaling in the pathogenesis of necrotizing enterocolitis. Clin. Dev. Immunol. 2013;2013:475415. doi: 10.1155/2013/475415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zamora R, Grishin A, Wong C, Boyle P, Wang J, Hackam D, Upperman JS, Tracey KJ, Ford HR. High-mobility group box 1 protein is an inflammatory mediator in necrotizing enterocolitis: protective effect of the macrophage deactivator semapimod. Am. J. Physiol. Gastrointest. Liver Physiol. 2005;289:G643–652. doi: 10.1152/ajpgi.00067.2005. [DOI] [PubMed] [Google Scholar]
  • 36.O'Neill LA, Bowie AG. The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nature Rev. Immunol. 2007;7:353–364. doi: 10.1038/nri2079. [DOI] [PubMed] [Google Scholar]
  • 37.Nagpal K, Plantinga TS, Sirois CM, Monks BG, Latz E, Netea MG, Golenbock DT. Natural loss-of-function mutation of myeloid differentiation protein 88 disrupts its ability to form Myddosomes. J. Biol. Chem. 2011;286:11875–11882. doi: 10.1074/jbc.M110.199653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dong W, Liu Y, Peng J, Chen L, Zou T, Xiao H, Liu Z, Li W, Bu Y, Qi Y. The IRAK-1-BCL10-MALT1-TRAF6-TAK1 cascade mediates signaling to NF-kappaB from Toll-like receptor 4. J. Biol. Chem. 2006;281:26029–26040. doi: 10.1074/jbc.M513057200. [DOI] [PubMed] [Google Scholar]
  • 39.Lu C, Wang A, Dorsch M, Tian J, Nagashima K, Coyle AJ, Jaffee B, Ocain TD, Xu Y. Participation of Rip2 in lipopolysaccharide signaling is independent of its kinase activity. J. Biol. Chem. 2005;280:16278–16283. doi: 10.1074/jbc.M410114200. [DOI] [PubMed] [Google Scholar]
  • 40.McGettrick AF, O'Neill LA. Localisation and trafficking of Toll-like receptors: an important mode of regulation. Curr. Opin. Immunol. 2010;22:20–27. doi: 10.1016/j.coi.2009.12.002. [DOI] [PubMed] [Google Scholar]
  • 41.Triantafilou M, Triantafilou K. Heat-shock protein 70 and heat-shock protein 90 associate with Toll-like receptor 4 in response to bacterial lipopolysaccharide. Biochem. Soc. Trans. 2004;32:636–639. doi: 10.1042/BST0320636. [DOI] [PubMed] [Google Scholar]
  • 42.Brooks JC, Sun W, Chiosis G, Leifer CA. Heat shock protein gp96 regulates Toll-like receptor 9 proteolytic processing and conformational stability. Biochem. Biophys. Res. Commun. 2012;421:780–784. doi: 10.1016/j.bbrc.2012.04.083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dai J, Liu B, Ngoi SM, Sun S, Vella AT, Li Z. TLR4 hyperresponsiveness via cell surface expression of heat shock protein gp96 potentiates suppressive function of regulatory T cells. J. Immunol. 2007;178:3219–3225. doi: 10.4049/jimmunol.178.5.3219. [DOI] [PubMed] [Google Scholar]
  • 44.Liu B, Yang Y, Qiu Z, Staron M, Hong F, Li Y, Wu S, Li Y, Hao B, Bona R, Han D, Li Z. Folding of Toll-like receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone. Nature Commun. 2010;1:79. doi: 10.1038/ncomms1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Randow F, Seed B. Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability. Nature Cell Biol. 2001;3:891–896. doi: 10.1038/ncb1001-891. [DOI] [PubMed] [Google Scholar]
  • 46.Yang Y, Liu B, Dai J, Srivastava PK, Zammit DJ, Lefrancois L, Li Z. Heat shock protein gp96 is a master chaperone for toll-like receptors and is important in the innate function of macrophages. Immunity. 2007;26:215–226. doi: 10.1016/j.immuni.2006.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Frey S, Leskovar A, Reinstein J, Buchner J. The ATPase cycle of the endoplasmic chaperone Grp94. J. Biol. Chem. 2007;282:35612–35620. doi: 10.1074/jbc.M704647200. [DOI] [PubMed] [Google Scholar]
  • 48.Li Z, Srivastava PK. Tumor rejection antigen gp96/grp94 is an ATPase: implications for protein folding and antigen presentation. EMBO J. 1993;12:3143–3151. doi: 10.1002/j.1460-2075.1993.tb05983.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ostrovsky O, Makarewich CA, Snapp EL, Argon Y. An essential role for ATP binding and hydrolysis in the chaperone activity of GRP94 in cells. Proc. Natl. Acad. Sci. USA. 2009;106:11600–11605. doi: 10.1073/pnas.0902626106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wearsch PA, Nicchitta CV. Purification and partial molecular characterization of GRP94, an ER resident chaperone. Protein Expression and Purification. 1996;7:114–121. doi: 10.1006/prep.1996.0015. [DOI] [PubMed] [Google Scholar]
  • 51.Chu F, Maynard JC, Chiosis G, Nicchitta CV, Burlingame AL. Identification of novel quaternary domain interactions in the Hsp90 chaperone, GRP94. Protein Sci. 2006;15:1260–1269. doi: 10.1110/ps.052065106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Immormino RM, Dollins DE, Shaffer PL, Soldano KL, Walker MA, Gewirth DT. Ligand-induced conformational shift in the N-terminal domain of GRP94, an Hsp90 chaperone. J. Biol. Chem. 2004;279:46162–46171. doi: 10.1074/jbc.M405253200. [DOI] [PubMed] [Google Scholar]
  • 53.Rosser MF, Nicchitta CV. Ligand interactions in the adenosine nucleotide-binding domain of the Hsp90 chaperone, GRP94. I. Evidence for allosteric regulation of ligand binding. J. Biol. Chem. 2000;275:22798–22805. doi: 10.1074/jbc.M001477200. [DOI] [PubMed] [Google Scholar]
  • 54.Soldano KL, Jivan A, Nicchitta CV, Gewirth DT. Structure of the N-terminal domain of GRP94. Basis for ligand specificity and regulation. J. Biol. Chem. 2003;278:48330–48338. doi: 10.1074/jbc.M308661200. [DOI] [PubMed] [Google Scholar]
  • 55.Vogen S, Gidalevitz T, Biswas C, Simen BB, Stein E, Gulmen F, Argon Y. Radicicol-sensitive peptide binding to the N-terminal portion of GRP94. J. Biol. Chem. 2002;277:40742–40750. doi: 10.1074/jbc.M205323200. [DOI] [PubMed] [Google Scholar]
  • 56.Guillot L, Medjane S, Le-Barillec K, Balloy V, Danel C, Chignard M, Si-Tahar M. Response of human pulmonary epithelial cells to lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4. J. Biol. Chem. 2004;279:2712–2718. doi: 10.1074/jbc.M305790200. [DOI] [PubMed] [Google Scholar]
  • 57.Yanagimoto S, Tatsuno K, Okugawa S, Kitazawa T, Tsukada K, Koike K, Kodama T, Kimura S, Shibasaki Y, Ota Y. A single amino acid of toll-like receptor 4 that is pivotal for its signal transduction and subcellular localization. J. Biol. Chem. 2009;284:3513–3520. doi: 10.1074/jbc.M803086200. [DOI] [PubMed] [Google Scholar]
  • 58.Ferrao R, Li J, Bergamin E, Wu H. Structural insights into the assembly of large oligomeric signalosomes in the Toll-like receptor-interleukin-1 receptor superfamily. Science Signaling. 2012;5:re3. doi: 10.1126/scisignal.2003124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Warger T, Hilf N, Rechtsteiner G, Haselmayer P, Carrick DM, Jonuleit H, von Landenberg P, Rammensee HG, Nicchitta CV, Radsak MP, Schild H. Interaction of TLR2 and TLR4 ligands with the N-terminal domain of Gp96 amplifies innate and adaptive immune responses. J. Biol. Chem. 2006;281:22545–22553. doi: 10.1074/jbc.M502900200. [DOI] [PubMed] [Google Scholar]
  • 60.Radsak MP, Hilf N, Singh-Jasuja H, Braedel S, Brossart P, Rammensee HG, Schild H. The heat shock protein Gp96 binds to human neutrophils and monocytes and stimulates effector functions. Blood. 2003;101:2810–2815. doi: 10.1182/blood-2002-07-2261. [DOI] [PubMed] [Google Scholar]
  • 61.Biesterveld BE, Koehler SM, Heinzerling NP, Rentea RM, Fredrich K, Welak SR, Gourlay DM. Intestinal alkaline phosphatase to treat necrotizing enterocolitis. J. Surg. Res. 2015;196:235–240. doi: 10.1016/j.jss.2015.02.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Kliger Y, Levy O, Oren A, Ashkenazy H, Tiran Z, Novik A, Rosenberg A, Amir A, Wool A, Toporik A, Schreiber E, Eshel D, Levine Z, Cohen Y, Nold-Petry C, Dinarello CA, Borukhov I. Peptides modulating conformational changes in secreted chaperones: from in silico design to preclinical proof of concept. Proc. Natl. Acad. Sci. USA. 2009;106:13797–13801. doi: 10.1073/pnas.0906514106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Wu S, Dole K, Hong F, Noman AS, Issacs J, Liu B, Li Z. Chaperone gp96-independent inhibition of endotoxin response by chaperone-based peptide inhibitors. J. Biol. Chem. 2012;287:19896–19903. doi: 10.1074/jbc.M112.343848. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS781250-supplement-1.pdf (78.8KB, pdf)

RESOURCES