Skip to main content
PMC home page
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2005 Feb;187(3):1201–1205. doi: 10.1128/JB.187.3.1201-1205.2005

Expression Profiling of Virulence and Pathogenicity Genes of Xanthomonas axonopodis pv. citri

Gustavo Astua-Monge 1,*, Juliana Freitas-Astua 1,2, Gisele Bacocina 1, Juliana Roncoletta 1, Sérgio A Carvalho 1, Marcos A Machado 1
PMCID: PMC545697  PMID: 15659697

Abstract

DNA macroarrays of 279 genes of Xanthomonas axonopodis pv. citri potentially associated with pathogenicity and virulence were used to compare the transcriptional alterations of this bacterium in response to two synthetic media. Data analysis indicated that 31 genes were up-regulated by synthetic medium XVM2, while only 7 genes were repressed. The results suggest that XVM2 could be used as an in vitro system to identify candidate genes involved in pathogenesis of X. axonopodis pv. citri.

Citrus canker, caused by Xanthomonas axonopodis Starr & Garces emend. Vauterin et al. pv. citri (Hasse) Dye [syn. Xanthomonas campestris pv. citri (Hasse)], is one of the most devastating citrus diseases in the world (44).

Within the genus Xanthomonas, several genes have been found associated with pathogenicity and virulence. Of these genes, the avr (avirulence), rpf (named for regulation of pathogenicity factors), and hrp (named for hypersensitive response and pathogenicity) genes are perhaps the most widely studied elements. The avr genes encode a known group of effector proteins responsible for controlling the ability of bacteria to elicit the hypersensitive reaction in resistant hosts (26) and may also participate in pathogenicity or virulence in compatible interactions (38, 47). The rpf operon is thought to control the production of important pathogenicity factors, such as proteases, endoglucanases, polygalacturonate ligases, and extracellular polysaccharides (5, 17). Finally, the hrp genes are thought to encode proteins involved in the type III secretion system, responsible for delivering effector proteins inside the host plant cells (8, 9, 20, 21).

Even though pathogenicity and virulence of Xanthomonas axonopodis pv. citri have been traditionally associated with the activity of a single avirulence-like gene known as pthA (14, 22, 45, 46), little is known about other gene products involved in these processes. In this respect, transcription profiling under natural conditions may be a good alternative to identify all the elements involved in pathogenicity and virulence of this microbial pathogen. However, leaf spot pathogens, such as X. axonopodis pv. citri, do not reach high population levels in infected tissues and do not yield enough material (either bacterial cells or RNA) to conduct gene expression studies. Therefore, in an attempt to develop an alternative system for gene expression studies, an in vitro system was evaluated in order to determine whether it could be used to model pathogen responses to host tissues under controlled conditions. The two media selected were NB (nutrient broth), commonly used for growing this bacterium, and XVM2, suspected to mimic the environment of the plant intercellular spaces (1, 41, 51, 55).

Construction of DNA macroarrays.

To study the expression profile of X. axonopodis pv. citri, 279 candidate genes, associated with pathogenicity or virulence by sequence similarity, were selected from the genome of this bacterium (13). Specific primers were designed to amplify either the entire open reading frame or a fragment of it. PCR amplifications were performed in two rounds using 96-well plates and a Mastercycler Eppendorf (Eppendorf). The quality of amplimers was analyzed by agarose gel electrophoresis.

Prior to the construction of the DNA macroarray, dried and purified PCR products were resuspended in a 50% dimethyl sulfoxide solution, adjusting the concentration of each product to 100 ng/μl. PCR products were spotted onto positively charged nylon membranes (Genetix) using a Q-Bot robot (Genetix) in a 3 × 3 arrangement, where each spot was replicated eight times.

Transcription measurements.

In order to examine the gene expression profiles under in vitro conditions, a single cell culture of X. axonopodis pv. citri strain 306 (kindly provided by Rui P. Leite, IAPAR, Brazil) was grown in NB and the hrp-inducing medium XVM2 (41) at 28°C with shaking at 100 rpm. The NB and XVM2 cultures were grown at 28°C for 12 and 20 h, respectively, until they reached an optical density at 600 nm of 0.3. Bacterial cells were harvested by centrifugation at 4°C and then stored at −80°C for further manipulations. These experiments were repeated three times using different single cell cultures.

Total RNA from X. axonopodis pv. citri cells was extracted using the RNeasy kit (QIAGEN) according to the recommendations of the manufacturer. In order to specifically label the cDNA of the selected genes, a set of 41 octamers was designed using the genome-directed primer approach described by Talaat and coworkers (48). cDNA was labeled with [33P]dCTP during reverse transcription. Labeled cDNA was hybridized to the membranes using standard procedures. After hybridization and washes, membranes were dried by blotting, wrapped in a plastic film, and exposed to a general-purpose screen (Amersham Biosciences) for 96 h.

Images were captured using a STORM phosphorimager (Amersham Biosciences). Signal strength and local background were quantified using the ImaGene software (BioDiscovery). Spots with signal/background ratios of less than two were flagged and excluded from the analysis. Local background was subtracted, and the data of each array were normalized by the total signal strength method as implemented in the GeneSight software (BioDiscovery).

Differentially expressed genes were identified by three methods, fold change (TF), significance analysis of microarrays (SAM), and analysis of variance (ANOVA). For the TF method, the normalized signal intensity for each spot of the treatment condition (T) was divided by that of the control condition (C) to calculate the ratio (R = T/C). Final ratios were calculated as the average of all individual hybridizations. Genes with R of ≥2 or ≤0.5 (twofold) were considered significantly up- and down-regulated, respectively.

The SAM method identifies significant relationships between gene expression and the response variable using a significance limit Δ (delta), a false discovery rate, and an induction or repression threshold defined by the user. The SAM analysis was performed using a Microsoft Excel add-in as described by Tusher et al. (52).

ANOVA was performed using the software package GeneANOVA (16). We used a completely randomized design in which the number of spot replicates per sample, the number of experiments performed, and genes and culture media were considered treatments. Only genes with P values of ≤1% were considered significantly induced or repressed (http://citest.centrodecitricultura.br/gamo/JB00701-04/).

The experiments were performed under the conditions described above. After three independent biological replications of each treatment, results indicated that most X. axonopodis pv. citri genes (87%) exhibited similar levels of expression in the culture media, while only 13% of the genes were differentially expressed. Few differentially expressed genes were found when expression profiles were compared in Escherichia coli growing in rich and minimal media (50).

The low number of differentially expressed genes may be due to several possible causes. First of all, the induction of some genes could depend on one or more host-specific conditions that may not be provided by the media. Also, some of the genes may just be constitutively expressed and may not respond to alterations in the environment. Finally, it is important to consider the fact that some of the individual expression levels observed in this study may be errors caused by technical problems, such as annotation errors, cross-hybridization, misapplied DNA spots on the arrays, or scatter in the data. Therefore, the data presented here must be taken as a general trend that could be used as a guide for further research.

Comparison of the three methods of analysis indicated that SAM identified the largest number of differentially expressed genes, 32, while ANOVA and TF recognized approximately the same number, 25 and 27, respectively (Table 1). When the identities of the genes recognized by each method were compared, SAM and TF exhibited 82% agreement, while ANOVA showed an identical low level of agreement with SAM and TF (61%). Since none of the methods used in this study was better than the others, we decided to use a combination of all genes identified by the three methods, resulting in 37 differentially expressed genes.

TABLE 1.

Up- and down-regulated genes from X. axonopodis pv. citri in the XVM2 medium as determined by three different methods

Gene group and protein Gene tag gi no. FCa No. of differentially expressed genesb by:
SAM TF ANOVA
Up-regulated genes
    Avirulence protein (avrBs2-like) XAC0076 gi21240850 3.98 x x x
    Avirulence protein (avrXacE1) XAC0286 gi21241060 3.45 x ND ND
    Avirulence protein (avrXacE2) XAC3224 gi21243950 2.79 x ND x
    Beta-lactamase (bla) XAC3057 gi21243784 2.38 x ND ND
    Catalase/peroxidase (katG) XAC1301 gi21242054 3.90 x x x
    Cellulase (egl) endo-1,4-beta-glucanase XAC0028 gi21240802 4.99 x x x
    Cellulase (egl) endo-1,4-beta-glucanase XAC0029 gi21240803 5.68 x x x
    Filamentous hemagglutinin (fhaB) XAC1815 gi21242559 4.58 x x x
    General stress protein XAC2369 gi21243103 4.39 x x x
    Glutathione peroxidase (btuE) XAC1549 gi21242300 5.30 x x x
    Glutathione peroxidase-like protein (gpo) XAC1457 gi21242209 7.08 x x x
    Hemagglutinin/hemolysin-related protein XAC1816 gi21242560 6.53 x x ND
    HrcJ protein (hrcJ) XAC0409 gi21241182 (1.06) ND ND x
    HrcR protein (hrcR) XAC0402 gi21241175 4.48 x x x
    HrcU protein (hrcU) XAC0406 gi21241179 2.76 x ND ND
    HrcV protein (hrcV) XAC0405 gi21241178 7.89 x x ND
    HrpB2 protein (hrpB2) XAC0408 gi21241181 4.42 x x x
    HrpB4 protein (hrpB4) XAC0410 gi21241183 6.85 x x x
    HrpB5 protein (hrpB5) XAC0411 gi21241184 (2.00) ND x ND
    Methicillin resistance protein (mecI) XAC0069 gi21240843 4.82 x x x
    Nuclease (nucH) XAC0447 gi21241220 6.99 x x x
    Pectate lyase (degenerated) (pel) XAC2373 gi21243107 7.98 x x x
    Periplasmic glucan biosynthesis protein (mdoG) XAC4284 gi21245001 13.61 x x ND
    Superoxide dismutase (sodC2) XAC0210 gi21240984 7.93 x x ND
    Superoxide dismutase-like protein (yojM) XAC0209 gi21240983 10.73 x x x
    Thiophene and furan oxidation protein (thdF) XAC4370 gi21245082 2.92 x x ND
    Trehalose-6-phosphate synthase (ostA) XAC3211 gi21243937 2.42 x ND x
    VirB11 protein (virB11), chromosomalc XAC2618 gi21243349 4.56 x x x
    VirK protein (virK), chromosomal XAC0435 gi21241208 2.17 x ND ND
    YapH protein (yapH) XAC4113 gi21244830 (1.28) ND ND x
Down-regulated genes
    Cellulase (egl2) XAC2522 gi21243255 0.18 x x ND
    GumD protein (gumD) XAC2583 gi21243315 (0.96) ND ND x
    HrpB1 protein (hrpB1) XAC0407 gi21241180 0.17 x x x
    Periplasmic glucan biosynthesis protein (hrpM) XAC0618 gi21241389 0.19 x x x
    Phosphoglucomutase/phosphomannomutase (xanA) XAC3579 gi21244304 0.15 x x ND
    RpfG protein (rpfG) XAC1877 gi21242621 (0.79) ND ND x
    RpfC protein (rpfC) XAC1878 gi21242622 0.16 x x x
Open in a new tab
a

FC, average fold change as calculated by SAM. The results represent the mean of the three biological replications. Values in parentheses were calculated by using raw data and not SAM estimations.

b

x, a differentially expressed gene; ND, not considered a diffentially expressed gene.

Gene expression profile in XVM2 medium.

Most differentially expressed genes (Table 1) included known pathogenicity or virulence factors, such as avirulence proteins, cell wall-degrading enzymes, proteins involved in adhesion to surfaces, peptidases, proteins associated with secretion, nucleases, putative extracellular polysaccharide (EPS) and lipopolysaccharide (LPS) synthesis proteins, and other proteins associated with oxidative stress responses and synthesis of osmoregulated periplasmic glucans (OPGs).

The ability of XVM2 medium to induce the expression of avr genes has been reported for other xanthomonads (1). From the eight avr gene candidates annotated in the genome of X. axonopodis pv. citri (13), only avrXacE1, avrXacE2, and XAC0076 (an avrBs2-like gene) were found to be induced by XVM2 medium. The four members of the pthA family and avrXacE3 exhibited constitutive expression in both culture media. Other avr genes from Xanthomonas spp., including the pthA-like gene avrBs3, have been found to be constitutively expressed under different conditions including growth on XVM2 medium (11, 25, 36). Our results support the hypothesis of Ciesiolka et al. (11) who proposed that there might be at least two regulation systems that control the expression of avr genes in xanthomonads.

When X. axonopodis pv. citri was grown in XVM2 medium, eight hrp genes were found to be up-regulated. This result was expected, since it is already known that the expression of hrp genes is induced by XVM2 in Xanthomonas campestris pv. vesicatoria (41, 55). Interestingly, all induced hrp genes are similar to either structural components of the type III core apparatus or proteins required for secretion in X. campestris pv. vesicatoria (40). In contrast, the protein encoded by hrpB1, repressed in XVM2, is known to be located in the cytoplasm of the bacterial cell in X. campestris pv. vesicatoria (40).

When X. axonopodis pv. citri was grown in XVM2 medium, the rpfG and rpfC genes, four genes potentially involved in the synthesis of EPS or LPS, and one encoding a putative cell wall-degrading enzyme (CWDE) were found to be down-regulated. These results could be expected, since RpfG, RpfH, and RpfC are known to be part of a signal transduction system that indirectly induces the synthesis of EPS and extracellular enzymes in other xanthomonads (42).

However, at least three other genes encoding putative CWDEs seemed to be up-regulated by XVM2 medium (XAC0028, XAC0029, and XAC2373), suggesting that an alternative signaling system may also exist to regulate the expression of CWDEs in X. axonopodis pv. citri. On the other hand, it is known that EPS or LPS biosynthesis in Ralstonia solanacearum and Xanthomonas campestris pv. campestris is activated only at late stages of infection (23, 53). This late induction would allow adherence of bacterial colonies to cell surfaces, promoting the establishment of biofilms and the proper functioning of the type III secretion system (15). Our results may reflect the fact that a richer medium (NB) may induce the activation of the EPS or LPS biosynthesis earlier than a minimal medium like XVM2.

Five genes putatively associated with oxidative stress responses were found to be induced by XVM2 medium (Table 1). This defense mechanism consists of the rapid generation of highly reactive oxygen species (ROS) that can kill the invading bacterium (27). Bacterial pathogens may protect themselves by degrading ROS using catalases, peroxidases, and superoxide dismutases, by detoxifying these compounds, or by maintaining reduced environments accomplished by glutathione-associated enzymes (24, 27). The expression of stress-associated genes in minimal medium has also been reported for E. coli as a result of its need to synthesize all its building blocks from a single carbon and energy source (50).

OPGs have been shown to play an important role in bacterium-plant interactions involving both symbionts and pathogens (6, 7, 12, 19, 28, 29, 30, 31, 35, 37, 49). Two genes similar to those involved in the biosynthesis of OPGs were found to be differentially expressed in XVM2 medium: an mdoG-like gene (XAC4284) appeared to be up-regulated, while an mdoH-like gene (XAC0618) was down-regulated. In E. coli, mdoG and mdoH are located side by side, forming an operon, while in X. axonopodis pv. citri, these two genes are located in different areas of the genome. Therefore, it is possible to speculate that this structural difference may be associated with the different regulatory strategies observed for these two species.

At least four genes encoding surface proteins seemed to be up-regulated by XVM2 medium. Of these genes, the filamentous hemagglutinin gene (XAC1815) and a hemagglutinin-related protein gene (XAC1816) may be involved in attachment to host tissues. As already shown for several bacterial plant pathogens, attachment of bacterial cells to the plant cell wall is required for successful infection (39, 43).

One of the interesting genes induced by XVM2 medium is an ostA-like gene (XAC3211). This gene codes for the enzyme trehalose-6-phosphate synthase involved in the synthesis of trehalose, a typical microbial sugar known to accumulate in a variety of symbiotic or pathogenic interactions of microorganisms with plants, as well as in response to salt stress (10, 33). Trehalose-producing organisms could affect the carbon metabolism of infected plants by converting the products of photosynthesis into trehalose and diverting carbon away from plant metabolism or by releasing trehalose into the plant in order to affect plant metabolism by interfering with the plant's sugar-sensing system (32, 34, 54). The role of trehalose in citrus canker development is still unknown, but induction of its biosynthetic machinery in a plant-like environment suggests that this sugar may be involved at some point in pathogenesis of X. axonopodis pv. citri.

Conserved upstream sequences.

Regulation of genes induced by XVM2 medium has been suggested to be associated with the presence of a conserved plant-inducible promoter sequence motif known as the PIP box (TTCGCN15TTCGC, where N is any nucleotide) upstream of the putative start codon of these genes (18). Even though this conserved sequence has already been found upstream of a large number of pathogenicity or virulence genes, such as hrpB pathogenicity operon, avrXv3, avrXv4, and avrRxv, all from X. campestris pv. vesicatoria (1, 2, 11, 18), its functionality has been questioned (11).

To determine conserved DNA sequence motifs potentially associated with the promoter region of genes induced by XVM2 medium, PERL script was used to construct a database of upstream sequences by extracting 300 nucleotides upstream of the start codon of each gene identified in the genome of X. axonopodis pv. citri. The sequences upstream of the regions of the XVM2-induced genes (300 bp) were used as a training set for the program MEME version 3.0.10 with a minimum significance E value of 10−3 (3). Analysis of the data indicated the presence of an 8-bp conserved motif (ATCGATGC; E value = 1.6 × 10−4) in the promoter region of all genes induced by XVM2 medium (Table 2). This conserved sequence is probably the binding site of a transcription activator protein. The conserved motif was used to scan across the promoter regions of those genes encoding hypothetical proteins in the X. axonopodis pv. citri genome using the MAST version 3.0.10 software with a P value of <1 × 10−4 (4). The global search indicated the presence of this motif in the promoter regions of 125 genes encoding proteins with unknown functions. Research is under way to identify the correlation between the presence of this conserved motif and the roles of these unknown proteins in pathogenicity or virulence of this bacterial pathogen.

TABLE 2.

Occurrences (sites) of the conserved motif in the promoter regions of all genes induced by XVM2 medium

Gene Starta P valueb Sequencec
hrcJ 147 1.14e-05 CGCCGAGCATATCGATGCCTTCAGCATG
btuE 173 1.14e-05 GACGCCATCAATCGATGCACAACGCCGC
katG 145 3.18e-05 CGCCTCGGTTGTCGATGCTAGCGCCTGC
gpo 77 3.18e-05 CATGGTACGAGTCGATGCAAGCGGAGCA
bla 214 4.51e-05 CATCAATAGGATCAATGCGATGCCCATT
egl 91 4.51e-05 ATCGGTCTGAATCAATGCATCAGCCGTG
ostA 280 6.46e-05 TGATCATCGCAGCGATGCGCTTGTCGCG
hrpB5 269 6.46e-05 AGACGGTGCGAGCGATGCATTCCTGGCC
hrpB4 126 6.46e-05 CGGAGCGGAGAGCGATGCGCAGTTCACC
yapH 199 7.69e-05 AGCCGGGGGCGTCGATGTGGTATTCAAG
yojM 214 8.88e-05 GTCGCCCACGATCGTTGCCCTCACCGCG
pel 203 9.97e-05 CTGACTTGGGAACGATGCCAGAAAGATC
virB11 199 9.97e-05 GTTGCTGGGTAACGATGCCGGAGCCCAC
hrcU 34 1.50e-04 TCCTTCCGCGATCGCTGCGCCCCCGATT
virK 70 1.50e-04 GCGGCGCGAGGTCAATGCGCGCCTGTAG
nucH 71 1.50e-04 GCTCGATGAAATCGCTGCGGAGGGTGGC
mdoG 7 2.44e-04 AGTGGCGTCGTTGCATGCGCATCG
hrpB2 151 3.46e-04 CGAAGAAGACGCCGATGCCGACGCGGTG
hrcR 78 3.46e-04 TCACTAACCTGCCGATGCCGATGGTCTG
fhaB 96 3.88e-04 CGCCGGCCGCATCGATGGCACCAGCGCC
mecI 173 4.16e-04 TCCAGGGGCGGGCGATGTGTCCAGGCTG
avrBs2 141 4.16e-04 CGTCATGCGCGGCGATGTGCGCGCCAAG
sodC2 43 5.17e-04 CCAGCCCAGCGGCAATGCCGGTGCGCGC
avrXacE1 58 5.17e-04 TTTGGCAAGCAGCGCTGCGAACGTTGTT
egl 89 5.31e-04 TATGAGCTCGTTCGATGTACGACAGCAA
hrcV 34 6.36e-04 CTCCATCGCCGTCGCTGTGGTCGCGACC
thdF 110 6.88e-04 TGAGTCGCCTACCGTTGCGACAATCGCG
Open in a new tab
a

Start position of the conserved sequence within the 300 bases extracted. The start codon of each gene would be at position 301.

b

The P value gives the probability of a random string (generated from the background letter frequencies) having the same match score or higher.

c

The conserved motif is shown in bold type.

Acknowledgments

This work was supported in part by the Conselho Nacional de Pesquisa (CNPq/MCT), the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP), and the PRODETAB program.

We thank Luiz L. Coutinho and Carlos Alberto Labate from ESALQ/USP for sharing equipment and laboratory space with us and Erica Jorge for technical assistance.

REFERENCES

  • 1.Astua-Monge, G., G. V. Minsavage, R. E. Stall, M. J. Davis, U. Bonas, and J. B. Jones. 2000. Resistance of tomato and pepper to T3 strains of Xanthomonas campestris pv. vesicatoria is specified by a plant-inducible avirulence gene. Mol. Plant-Microbe Interact. 13:911-921. [DOI] [PubMed] [Google Scholar]
  • 2.Astua-Monge, G., G. V. Minsavage, R. E. Stall, C. E. Vallejos, and J. B. Jones. 2000. Xv4-avrXv4: a new gene-for-gene interaction identified between Xanthomonas campestris pv. vesicatoria race T3 and the wild tomato relative Lycopersicon pennellii. Mol. Plant-Microbe Interact. 13:1346-1355. [DOI] [PubMed] [Google Scholar]
  • 3.Bailey, T. L., and C. Elkan. 1994. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. University of California at San Diego (UCSD) technical report CS94-351, March, 1994. University of California at San Diego, San Diego. [PubMed]
  • 4.Bailey, T. L., and M. Gribskov. 1998. Methods and statistics for combining motif match scores. J. Comput. Biol. 5:211-221. [DOI] [PubMed] [Google Scholar]
  • 5.Barber, C. E., J.-L. Tang, J.-X. Feng, M.-Q. Pan, T. J. G. Wilson, H. Slater, J. M. Dow, P. Williams, and M. J. Daniels. 1997. A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol. Microbiol. 24:555-566. [DOI] [PubMed] [Google Scholar]
  • 6.Bhagwat, A. A., A. Mitöfer, P. E. Pfeffer, C. Kraus, N. Spickers, A. Hotchkiss, J. Ebel, and D. L. Keister. 1999. Further studies on the role of cyclic β-glucans in symbiosis: an ndvC mutant of Bradyrhizobium japonicum synthesizes cyclodecakis-(1-3)-β-glucosyl. Plant Physiol. 119:1057-1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bohin, J. P. 2000. Osmoregulated periplasmic glucans in proteobacteria. FEMS Microbiol. Lett. 186:11-19. [DOI] [PubMed] [Google Scholar]
  • 8.Bonas, U. 1994. Hrp genes of phytopathogenic bacteria. Curr. Top. Microbiol. Immunol. 192:79-98. [DOI] [PubMed] [Google Scholar]
  • 9.Bonas, U., and G. Van den Ackerveken. 1997. Recognition of bacterial avirulence proteins occurs inside the plant cell: a general phenomenon in resistance to bacterial diseases? Plant J. 12:1-7. [DOI] [PubMed] [Google Scholar]
  • 10.Brodmann, D., A. Schuller, J. Ludwig-Müller, R. A. Aeschbacher, A. Wiemken, T. Boller, and A. Wingler. 2002. Induction of trehalase in Arabidopsis plants infected with the trehalose-producing pathogen Plasmodiophora brassicae. Mol. Plant-Microbe Interact. 15:693-700. [DOI] [PubMed] [Google Scholar]
  • 11.Ciesiolka, L. D., T. Hwin, J. D. Gearlds, G. V. Minsavage, R. Saenz, M. Bravo, V. Handley, S. M. Conover, H. Zhang, J. Caporgno, N. B. Phengrasamy, A. O. Toms, R. E. Stall, and M. C. Whalen. 1999. Regulation of expression of avirulence gene avrRxv and identification of a family of host interaction factors by sequence analysis of avrBst. Mol. Plant-Microbe Interact. 12:35-44. [DOI] [PubMed] [Google Scholar]
  • 12.Cogez, V., P. Talaga, J. Lemoine, and J.-P. Bohin. 2001. Osmoregulated periplasmic glucans of Erwinia chrysanthemi. J. Bacteriol. 183:3127-3133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Da Silva, A. C. R., J. A. Ferro, F. C. Reinach, C. S. Farah, L. R. Furlan, R. B. Quaggio, C. B. Monteiro-Vitorello, M. A. V. Sluys, N. F. Almeida, L. M. C. Alves, A. M. do Amaral, M. C. Bertolini, L. E. A. Camargo, G. Camarotte, F. Cannavan, L. Cardozo, F. Chambergo, L. C. Ciapina, R. M. B. Cicarelli, L. L. Coutinho, J. R. Cursino-Santos, H. El-Dorry, J. B. Faria, A. J. S. Ferreira, R. C. C. Ferreira, M. I. T. Ferro, E. F. Formighieri, M. C. Franco, C. C. Greggio, A. Gruber, A. M. Katsuyama, L. T. Kishi, R. P. Leite, E. G. M. Lemos, M. V. F. Lemos, E. C. Locali, M. A. Machado, A. M. B. N. Madeira, N. M. Martinez-Rossi, E. C. Martins, J. Meidanis, C. F. M. Menck, C. Y. Miyaki, H. Moon, L. M. Moreira, M. T. M. Novo, V. K. Okura, M. C. Oliveira, V. R. Oliveira, H. A. Pereira, A. Rossi, J. A. D. Sena, C. Silva, R. F. de Souza, L. A. F. Spinoa, M. A. Takita, R. E. Tamura, E. C. Teixeira, R. I. D. Tezza, M. T. dos Santos, D. Truffi, S. M. Tsai, F. F. White, J. C. Setubal, and J. P. Kitajima. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417:459-463. [DOI] [PubMed] [Google Scholar]
  • 14.De Feyter, R., Y. Yang, and D. W. Gabriel. 1993. Gene-for-gene interactions between cotton R genes and Xanthomonas campestris pv. malvacearum avr genes. Mol. Plant-Microbe Interact. 6:225-237. [DOI] [PubMed] [Google Scholar]
  • 15.Denny, T. P. 1999. Autoregulator-dependent control of extracellular polysaccharide production in phytopathogenic bacteria. Eur. J. Plant Pathol. 105:417-430. [Google Scholar]
  • 16.Didier, G., P. Brezellec, E. Remy, and A. Henaut. 2002. GeneANOVA—gene expression analysis of variance. Bioinformatics 18:490-491. [DOI] [PubMed] [Google Scholar]
  • 17.Dow, M., M. Newman, and E. von Roepenack. 2000. The induction and modulation of plant defense responses by bacterial lipopolysaccharides. Annu. Rev. Phytopathol. 38:241-261. [DOI] [PubMed] [Google Scholar]
  • 18.Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854. [DOI] [PubMed] [Google Scholar]
  • 19.Geremia, R. A., S. Cavaignac, A. Zorreguieta, N. Toro, J. Olivares, and R. A. Ugalde. 1987. A Rhizobium meliloti mutant that forms ineffective pseudonodules in alfalfa produces exopolysaccharides but fails to form β-(1→2) glucans. J. Bacteriol. 169:880-884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hyun-Ham, J., D. W. Bauer, D. E. Fouts, and A. Collmer. 1998. A cloned Erwinia chrysanthemi Hrp (type III protein secretion system) functions in Escherichia coli to deliver Pseudomonas syringae Avr signals to plant cell and to secrete Avr proteins in culture. Proc. Natl. Acad. Sci. USA 95:10206-10211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kanamori, H., and S. Tsuyumu. 1998. Comparison of nucleotide sequence of canker-forming and non-canker-forming pthA homologues in Xanthomonas campestris pv. citri. Ann. Phytopathol. Soc. Jpn. 64:462-470. [Google Scholar]
  • 23.Kang, Y., E. Saile, M. A. Schell, and T. P. Denny. 1999. Quantitative immunofluorescence of regulated eps gene expression in single cells of Ralstonia solanacearum. Appl. Environ. Microbiol. 65:2356-2362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Katsuwon, J., and A. J. Anderson. 1989. Response of plant-colonizing pseudomonads to hydrogen peroxide. Appl. Environ. Microbiol. 55:2985-2989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Knoop, V., B. Staskawicz, and U. Bonas. 1991. Expression of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria is not under the control of hrp genes and is independent of plant factors. J. Bacteriol. 173:7142-7150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Leach, J. E., and F. F. White. 1996. Bacterial avirulence genes. Annu. Rev. Phytopathol. 34:153-179. [DOI] [PubMed] [Google Scholar]
  • 27.Lushchak, V. I. 2001. Oxidative stress and mechanisms of protection against it in bacteria. Biochemistry (Moscow) 66:476-489. [DOI] [PubMed] [Google Scholar]
  • 28.Mahajan-Miklos, S., M.-W. Tan, L. G. Rahme, and F. M. Ausubel. 1999. Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa-Caenorhabditis elegans pathogenesis model. Cell 96:47-56. [DOI] [PubMed] [Google Scholar]
  • 29.Mills, D., and P. Mukhopadhyay. 1990. Organization of the hrpM locus of Pseudomonas syringae pv. syringae and its potential function in pathogenesis, p. 47-57. In S. Silver, A. M. Chakrabarty, B. Iglewski, and S. Kaplan (ed.), Pseudomonas: biotransformation, pathogenesis, and evolving biotechnology. American Society for Microbiology, Washington, D.C.
  • 30.Minsavage, G. V., M. B. Mudgett, R. E. Stall, and J. B. Jones. 2004. Importance of opgHXcv of Xanthomonas campestris pv. vesicatoria in host-parasite interactions. Mol. Plant-Microbe Interact. 17:152-161. [DOI] [PubMed] [Google Scholar]
  • 31.Mukhopadhyay, P., J. Williams, and D. Mills. 1988. Molecular analysis of a pathogenicity locus in Pseudomonas syringae. J. Bacteriol. 170:5479-5488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Müller, J., R. A. Aeschbacher, N. Sprenger, T. Boller, and A. Wiemken. 2000. Disaccharide-mediated regulation of sucrose:fructan-6-fructosyltransferase, a key enzyme of fructan synthesis in barley leaves. Plant Physiol. 123:265-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Müller, J., T. Boller, and A. Wiemken. 1995. Trehalose and trehalase in plants: recent developments. Plant Sci. 112:1-9. [Google Scholar]
  • 34.Müller, J., T. Boller, and A. Wiemken. 1998. Trehalose affects sucrose synthase and invertase activities in soybean (Glycine max [L.] Merr.) roots. J. Plant Physiol. 153:255-257. [Google Scholar]
  • 35.Page, F., S. Altabe, N. Hugouvieux-Cotte-Pattat, J.-M. Lacroix, J. Robert-Baudouy, and J.-P. Bohin. 2001. Osmoregulated periplasmic glucan synthesis is required for Erwinia chrysanthemi pathogenicity. J. Bacteriol. 183:3134-3141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Parker, J. E., C. E. Barber, M.-J. Fan, and M. J. Daniels. 1993. Interaction of Xanthomonas campestris with Arabidopsis thaliana: characterization of a gene from X. c. pv. raphani that confers avirulence to most A. thaliana accessions. Mol. Plant-Microbe Interact. 6:216-224. [DOI] [PubMed] [Google Scholar]
  • 37.Puvanesarajah, V., F. M. Schell, G. Stacey, C. J. Douglas, and E. W. Nester. 1985. Role for 2-linked-β-d-glucan in the virulence of Agrobacterium tumefaciens. J. Bacteriol. 164:102-106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ritter, C., and J. L. Dangl. 1995. The avrRpm1 gene of Pseudomonas syringae pv. maculicola is required for virulence on Arabidopsis. Mol. Plant-Microbe Interact. 8:444-453. [DOI] [PubMed] [Google Scholar]
  • 39.Rojas, M., H. Jong-Hyun, D. Wen-Ling, J. J. Doyle, and A. Collmer. 2002. HecA, a member of a class of adhesins produced by diverse pathogenic bacteria, contributes to the attachment, aggregation, epidermal cell killing, and virulence phenotypes of Erwinia chrysanthemi EC16 on Nicotiana clevelandii seedlings Clemencia. Proc. Natl. Acad. Sci. USA 99:13142-13147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Rossier, O., G. Van den Ackerveken, and U. Bonas. 2000. HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol. Microbiol. 38:828-838. [DOI] [PubMed] [Google Scholar]
  • 41.Schulte, R., and U. Bonas. 1992. Expression of Xanthomonas campestris pv. vesicatoria hrp cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol. 174:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Slater, H., A. Alvarez-Morales, C. E. Barber, M. J. Daniels, and J. M. Dow. 2000. A two-component system involving an HD-GYP domain protein links cell-cell signaling to pathogenicity gene expression in Xanthomonas campestris. Mol. Microbiol. 38:986-1003. [DOI] [PubMed] [Google Scholar]
  • 43.Smit, G., S. Swart, B. J. J. Lugtenberg, and J. W. Kijne. 1992. Molecular mechanisms of attachment of Rhizobium bacteria to plant roots. Mol. Microbiol. 6:2897-2903. [DOI] [PubMed] [Google Scholar]
  • 44.Stall, R. E., and E. L. Civerolo. 1993. Xanthomonas campestris pv. citri: cause of citrus canker, p. 48-50. In J. G. Swings and E. L. Civerolo (ed.), Xanthomonas. Chapman and Hall, London, United Kingdom.
  • 45.Swarup, S., R. De Feyter, R. H. Brlansky, and D. W. Gabriel. 1991. A pathogenicity locus from Xanthomonas citri enables strains from several pathovars to elicit canker-like lesions on citrus. Phytopathology 81:802-809. [Google Scholar]
  • 46.Swarup, S., Y. Yang, M. T. Kingsley, and D. W. Gabriel. 1992. An Xanthomonas citri pathogenicity gene, pthA, pleiotropically encodes gratuitous avirulence on nonhosts. Mol. Plant-Microbe Interact. 5:204-213. [DOI] [PubMed] [Google Scholar]
  • 47.Swords, K. M. M., D. Dahlbeck, B. Kearney, M. Roy, and B. J. Staskawicz. 1996. Spontaneous and induced mutations in a single open reading frame alter both virulence and avirulence in Xanthomonas campestris pv. vesicatoria avrBs2. J. Bacteriol. 178:4661-4669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Talaat, A. M., P. Hunter, and S. A. Johnston. 2000. Genome-directed primers for selective labeling of bacterial transcripts for DNA microarray analysis. Nat. Biotechnol. 18:679-682. [DOI] [PubMed] [Google Scholar]
  • 49.Talaga, P., B. Fournet, and J. P. Bohin. 1994. Periplasmic glucans of Pseudomonas syringae pv. syringae. J. Bacteriol. 176:6538-6544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Tao, H., C. Bausch, C. Richmond, F. R. Blattner, and T. Conway. 1999. Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. 181:6425-6440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tung, S. Y., and T. T. Kuo. 1999. Requirement of phosphoglucose isomerase of Xanthomonas campestris in pathogenesis of citrus canker. Appl. Environ. Microbiol. 65:5564-5570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98:5116-5121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Vojnov, A. A., H. Slater, M. J. Daniels, and J. M. Dow. 2001. Expression of the gum operon directing xanthan biosynthesis in Xanthomonas campestris and its regulation in planta. Mol. Plant-Microbe Interact. 14:768-774. [DOI] [PubMed] [Google Scholar]
  • 54.Wagner, W., A. Wiemken, and P. Matile. 1986. Regulation of fructan metabolism in leaves of barley (Hordeum vulgare L. cv. Gerbel). Plant Physiol. 81:444-447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Wengelnik, K., and U. Bonas. 1996. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 178:3462-3469. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES