Locoregional effects of microbiota in a preclinical model of colon carcinogenesis

Abstract

Inflammation and microbiota are critical components of intestinal tumorigenesis. To dissect how the microbiota contributes to tumor distribution, we generated germ-free (GF) Apc^Min/+ and Apc^Min/+;Il10^−/− mice and exposed them to specific-pathogen-free (SPF) or colorectal cancer-associated bacteria. We found colon tumorigenesis significantly correlated with inflammation in SPF housed Apc^Min/+;Il10^−/−, but not Apc^Min/+ mice. In contrast, small intestinal neoplasia development significantly correlated with age in both Apc^Min/+;Il10^−/− and Apc^Min/+ mice. GF Apc^Min/+;Il10^−/− mice conventionalized by an SPF microbiota had significantly more colon tumors compared to GF mice. Gnotobiotic studies revealed that while Fusobacterium nucleatum clinical isolates with FadA and Fap2 adhesins failed to induce inflammation and tumorigenesis, pks+ Escherichia coli promoted tumorigenesis in the Apc^Min/+;Il10^−/− model in a colibactin-dependent manner, suggesting colibactin is a driver of carcinogenesis. Our results suggest a distinct etiology of cancers in different locations of the gut, where colon cancer is primarily driven by inflammation and the microbiome, while age is a driving force for small intestine cancer.

Introduction

Colorectal cancer (CRC), the third most common type of malignancy and the third leading cause of cancer-related deaths in the United States (1), involves both genetic and environmental factors. Among the genomic changes associated with CRCs, loss-of-function mutations in the Apc (adenomatous polyposis coli) gene, a regulator of the WNT signaling pathway, are the most prevalent and are considered the initiating event in ~80% of CRCs (2). Of the environmental factors, the gut microbiota is increasingly appreciated as a key player in CRC pathogenesis. CRC patients often carry a distinct microbiota from the healthy population (3). Microbes can modulate CRC development directly by generating genotoxins, or indirectly and more commonly by mediating inflammatory and immune responses (4,5). Inflammation is not only a hallmark of CRC (5), but also an established risk factor for CRC as supported by epidemiological data from individuals with inflammatory bowel diseases (IBD) (6).

While human studies provide valuable correlation data on CRC, much of the mechanistic insight into the disease etiology is obtained from mouse models. Mouse CRC models can be categorized into two classes: spontaneous and chemical-induced (7). Spontaneous CRC mice carry mutations in genes frequently mutated in human CRCs. The multiple intestinal neoplasia (Min) mouse (referred to as Apc^Min/+ hereafter), a commonly used animal model of intestinal carcinogenesis, carries a point mutation in one allele of the Apc gene and is susceptible to spontaneous intestinal adenoma formation, although predominantly in the small bowel, without exhibiting chronic intestinal inflammation (8). A general pro-tumorigenic role for the microbiota was demonstrated in the Apc^Min/+ model, as the mice display reduced tumor load in the small and/or large intestine when derived under germ-free (GF) conditions (9,10). Noticeably, inflammation also enhances development of colon cancer in this model, as seen with the use of dextran sulfate sodium (DSS) (11), by specifically deleting the Apc gene in epithelial cells (12), and by genetically introducing defective IL-10 signaling (13–15). Inflammation and colonic polyposis in mice with Apc deficiency and T cell-specific deletion of Il10, Apc^Δ468;CD4^CreIl10^f/f mice, can be attenuated by antibiotic treatment (14), suggesting that microbiota-driven inflammation underlies colitis-associated CRC.

The mechanisms by which microbes have been shown to promote development of CRC are diverse and somewhat specific to each microorganism. For example, enterotoxigenic Bacteroides fragilis promotes CRC through induction of the Th17 response (16), polyketide synthase (pks)+ island carrying E. coli via production of the genotoxin colibactin (17), and Fusobacterium nucleatum adhesins that either bind E-cadherin to promote tumor growth (FadA) or promote immune invasion and localization to tumors (Fap2) (18–20). Although genetics, inflammation, and microbes play a role in promoting intestinal carcinogenesis in preclinical models; it is unclear how these factors interact and how much each contributes to promotion of CRC.

To stringently evaluate the relationship between genetic susceptibility to inflammation, microbial status, and cancer, we utilized specific-pathogen-free (SPF) and gnotobiotic Apc^Min/+ and Apc^Min/+;Il10^−/− mice. In this study, we found that inflammation and the microbiota is essential for colorectal but not small intestinal neoplasia in SPF Apc^Min/+;Il10^−/− mice. We also demonstrated that CRC-associated bacteria have differential abilities to promote CRC with colibactin-producing E. coli, but not F. nucleatum, inducing colon tumors in Apc^Min/+;Il10^−/− mice.

Materials and Methods

Animals

The University of Florida Institutional Animal Care and Use Committee approved all animal experiments (Protocol #201308038). 129/SvEv Apc^Min/+ mice were derived GF and crossed to GF 129/SVEv Il10^−/− mice to generate GF Apc^Min/+;Il10^−/− mice. GF Apc^Min/+;Il10^−/− and Apc^Min/+ mice were transferred to the SPF breeding suite and bred for 2–3 generations. SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice were either transferred to an SPF housing suite after weaning or remained in the breeding suite, mice transferred to the SPF housing suite were sacrificed at 12, 16 and 20 weeks of age. SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice older than 20 weeks were retired breeders from the SPF breeding suite.

Bacterial strains and culture conditions

F. nucleatum strains were provided by Dr. Emma Allen-Vercoe (University of Guelph), including the IBD clinical isolate EAVG_016, and CRC isolates CC53, CC7/3JVN3C1, CC7/5JVN1A4, CC2/3Fmu1, CC2/3FmuA and CC7/4Fmu3 (used for the 20-week colonization experiment in Apc^Min/+ mice). E. coli NC101 or NC101 ΔclbP were cultured from glycerol stocks in LB broth, then diluted 1:10 in fresh LB medium and cultured at 37°C before harvesting for gavage. F. nucleatum strains were cultured in Brain Heart Infusion Broth (BHI) (AS-872, Anaerobe Systems) statically at 37°C in an anaerobic chamber (type B Vinyl, Coy Laboratory). Enumeration of F. nucleatum was done by anaerobically plating serial dilutions of culture or fecal materials on fastidious anaerobic agar supplemented with 5% sheep blood.

PCR detection of F. nucleatum adhesins

All F. nucleatum strains were screened for the FadA and Fap2 adhesins by PCR using the following primers: Fn 16S_F GGATTTATTGGGCGTAAAGC, ; Fn 16S_R, GGCATTCCTACAAATATCTACGAA; fadA_F CAAATCAAGAAGAAGCAAGATTCAAT ; fadA_R, GCTTGAAGTCTTTGAGCTCT (18); fap2_F, AGCCTCTGAGGGTACAAGGT; fap2_R, TGAGCCCCTCCTTCTTCTGA. The screening revealed 4 F. nucleatum CRC isolate strains were fadA+, fap2− and 2 were fadA+, fap2+ (Supplementary Fig. S1).

E.coli NC01 clbP mutation

Inactivation of gene clbP was performed by using the lambda Red recombinase method (21) using primers clbP-P1 (TTCCGCTATGTGCGCTTTGGCGCAAGAACATGAGCCTATCGGGGCGCAAgtgtaggctggagctgcttc) and clbP-P2 (GTATACCCGGTGCGACATAGAGCATGGCGGCCACGAGCCCAGGAACCGCCcatatgaatatcctccttag). The allelic exchange was confirmed by PCR using primers IHAPJPN29 and IHAPJPN30 (22).

SPF microbiota preparation

Cecal and fecal contents were collected from wild type 129/SvEv mice that were housed under SPF conditions in the animal facility at the University of Florida. 1 gram of the contents was suspended in 10 ml sterile PBS, broken down using pipette tips, and vortexed. After settling for 2 min, the supernatant was transferred to a new tube, mixed with equal volume of sterile 20% glycerol, and frozen at −80°C.

Mouse colonization

7–12 week GF Apc^Min/+ and Apc^Min/+;Il10^−/− were transferred to SPF conditions or gnotobiotic isolators as described above. SPF stock microbiota was diluted 1:10⁶ and 200 ul of this mixture was gavaged to each mouse. E. coli NC101 or NC101 ΔclbP was gavaged at 10⁸ CFU/mouse. For AOM/Il10^−/− experiments, mice received 6 weekly intraperitoneal AOM (A5486, Sigma) injections (10 mg kg -¹) starting 1 week post mono-association with E. coli and mice were sacrificed 20 weeks post mono-association. F. nucleatum was gavaged at 10⁸ CFU/mouse when a single strain was used, or 10⁸ CFU per strain per mouse when a mixture of strains were used. BHI medium weekly gavaged mice were used as control for F. nucleatum experiments.

Mice were euthanized at indicated time points. The small intestine, cecum and colon were cut open longitudinally and macroscopic tumors were counted. About 1 × 0.5 cm snips were taken from the proximal and distal colon, flash frozen in liquid nitrogen and stored at −80°C until analysis. The rest of the colon was Swiss rolled and fixed in 10% neutral buffered formalin solution. Swiss rolls were processed, paraffin-embedded, sectioned and H&E stained by the Molecular Pathology Core at the University of Florida. Histological scoring of inflammation was performed blindly as described previously (17) and calculated as the average between the proximal and distal colon region scores.

Immunohistochemistry (IHC)

IHC was performed as described previously (17). Briefly, Swiss roll sections were deparaffinized, rehydrated, and boiled in 10mM citrate buffer for antigen retrieval. For CTNBB1, the mouse anti-CTNNB1 antibody (1:300 overnight) (6101503, BD Transduction Laboratories) and mouse on mouse (M.O.M.) peroxidase kit (PK-2200, Vector Labs) were used. For PCNA, sections were blocked with 1% BSA, incubated with anti-PCNA clone PC10 (M087901-2, Dako) mouse monoclonal antibody (1:300, 30 minutes), followed by 1:1000 goat anti-mouse biotin secondary antibody (31800 Fisher), and then incubated with streptavidin-horseradish peroxidase (18–152, Millipore). Liquid DAB+ (K3467, Dako) was used according to manufacturer instructions for development.

Fecal DNA extraction and 16S qPCR

DNA was extracted using phenol:chloroform separation followed by DNeasy Blood & Tissue Kit (69506, Qiagen). qPCR was performed on CFX384 Touch Real-Time PCR Detection System (1855485, Bio-rad) using the SsoAdvanced™ Universal SYBR Green Supermix (1725274, Bio-rad). The following primers were used: Fuso_F GGATTTATTGGGCGTAAAGC, Fuso_R GGCATTCCTACAAATATCTACGAA; and Eubacteria_F GGTGAATACGTTCCCGG, Eubacteria_R TACGGCTACCTTGTTACGACTT.

16S rRNA sequencing

The V1–V3 region hypervariable region of the 16S rRNA gene was amplified using primer pair 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 534R (5′-ATTACCGCGGCTGCTGG-3′). Both the forward and the reverse primers contained universal Illumina paired-end adapter sequences, as well as unique individual 4–6 nucleotide barcodes between PCR primer sequence and the Illumina adapter sequence to allow multiplex sequencing (Supplementary Table S1). PCR products were visualized on an agarose gel, before samples were purified using the Agencourt AMPure XP kit (A63881, Beckman Coulter) and quantified by qPCR with the KAPA Library Quantification Kit (KK4824, KAPA Biosystems). Equimolar amount of samples were then pooled and sequenced with an Illumina MiSeq. See Supplementary Data for description of 16S rRNA sequencing analysis.

qPCR examination of inflammatory cytokines

RNA was extracted from frozen tissue snips using Trizol reagent followed by phenol:chloroform separation. After DNA removal using the Turbo DNA-free Kit (AM1907, Ambion), 10–1000 ng of RNA was used for cDNA synthesis using iScript cDNA Synthesis Kit (1708891, Bio-rad). qPCR was performed on CFX384 Touch Real-Time PCR Detection System (1855485, Bio-rad) using the SsoAdvanced™ Universal SYBR Green Supermix (1725274, Bio-rad). The following primers were used: IL6_F CGGAGGCTTGGTTACACATGTT, IL6_R CTGGCTTTGTCTTTCTTGTTATC; TNFα_F ATGAGCACAGAAAGCATGATC, TNFα_R TACAGGCTTGTCACTCGAATT; IFNγ_F ACGCTTATGTTGTTGCTGATGG, IFNγ_R CTTCCTCATGGCTGTTTCTGG; IL-1β_F GCCCATCCTCTGTGACTCAT, IL-1β_R AGGCCACGGTATTTTGTCG; IL17A_F GCCCTCAGACTACCTCAACC, IL17A_R ACACCCACCAGCATCTTCTC; IL-22_F CATGCAGGAGGTGGTGCCTT, IL-22_R CAGACGCAAGCATTTCTCAG; 36B4_F TCCAGGCTTTGGGCATCA, 36B4_R CTTTATTCAGCTGCACATCACTCAGA; and GUSB_F CCGATTATCCAGAGCGAGTATG, GUSB_R CTCAGCGGTGACTGGTTCG. 36B4 and Gusb were used as references. Relative fold gene expression was calculated using the delta delta Ct method.

Statistical analysis

Data are expressed as mean +/− standard deviation. Significance thresholds of ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, or NS: not significant (p> 0.05) are shown. Statistics for all figures except for the 16S rRNA sequencing analysis were calculated with Graphpad Prism using the Mann-Whitney nonparametric unpaired two-tailed t-test. For correlational analyses, the Spearman nonparametric correlation analysis with a confidence interval of 95% and a two-tailed significance test with alpha= 0.05 was used.

Results

Inflammation promotes development of CRC in Apc^Min/+;Il10^−/− mice

To investigate the interaction between inflammation and CRC development, we interbred Il10^−/− mice to Apc^Min/+ mice (129SvEV background) to generate Apc^Min/+;Il10^−/− mice. Colon and cecal tumors increased dramatically in Apc^Min/+;Il10^−/− compared to Apc^Min/+ mice (colon tumor mean= 5.03 vs 0.73, respectively p< 0.0001; cecal tumor mean= 0.51 vs 0, respectively p< 0.0005) (Fig. 1A and C), whereas small bowel lesions remained similar between the two genotypes (mean= 0.84 vs 2.23 p= 0.2914) (Fig. 1D). Histological assessment showed presence of colonic neoplastic lesions in Apc^Min/+;Il10^−/− mice (Fig. 1E) and as expected, increased inflammation in Apc^Min/+;Il10^−/− mice compared to Apc^Min/+ mice (combined score mean = 1.32 vs 0.23, respectively p< 0.0001) (Fig. 1B). There was a significant correlation between development of CRC and extent of colon inflammation in Apc^Min/+;Il10^−/− mice (r= 0.7441 p< 0.0001) whereas no such correlation is observed in Apc^Min/+ mice (r= −0.09608 p= 0.6135) (Fig. 1F). Furthermore, development of small intestinal neoplasia did not correlate with the state of colitis in either model (Apc^Min/+;Il10^−/− r= 0.2364; Apc^Min/+ r= 0.2526; p> 0.05) (Fig. 1F). Interestingly, endpoint age (see methods for description of the chosen endpoint age range) was a significant contributor to tumorigenesis in the small bowel of both Apc^Min/+;Il10^−/− and Apc^Min/+ mice (r= 0.6458, 0.8208, respectively p< 0.0001) but only weakly contributed to neoplasia in the large bowel of Apc^Min/+;Il10^−/− mice (r= 0.2561 p= 0.0256) (Fig. 1G). Thus genetic susceptibility to inflammation promotes colon but not small intestinal tumorigenesis in SPF Apc^Min/+;Il10^−/− mice, while age appears to be the primary factor contributing to small intestinal tumorigenesis in SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice.

Figure 1.

Inflammation fosters CRC development in genetically engineered mice.

A) Macroscopic colon tumor counts from 12–51 week old SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice. B) Colon combined histological inflammation scores (the average of the proximal and distal inflammation scores) from SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice. C-D) Cecum and small intestine macroscopic tumor counts from SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice. E) Colon H&Es from 30–40 week old SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice (5×, 40× magnification). F) Relationship between colon inflammation score and macroscopic colon or small intestine tumors in SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice. G) Relationship between mouse endpoint age and macroscopic tumors in SPF Apc^Min/+;Il10^−/− and Apc^Min/+ mice. Spearman correlation r values and corresponding p values are noted in each panel. Data are expressed as mean +/− standard deviation (SD). Two-tailed Mann-Whitney statistical analysis: ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, NS: not significant.

Due to its role in promoting cellular proliferation, we evaluated the distribution of nuclear Catenin Beta 1 (CTNNB1) and proliferating cell nuclear antigen (PCNA) in actively inflamed and neoplastic regions of Apc^Min/+;Il10^−/− and Apc^Min/+ colons. Nuclear CTNNB1 and PCNA staining was mostly restricted to the crypt bases in Apc^Min/+ mice (Fig. 2B, D and Supplementary Fig. S2B, D). In contrast, the colonic mucosa from Apc^Min/+;Il10^−/− mice showed areas of CTNNB1 and PCNA staining extending the full crypt length in dysplastic regions (Fig. 2A, C and Supplementary Fig. S2A, C). In addition, expression of proliferative and inflammatory IL-6, TNFα IFNγ, IL-1β, IL-22 and IL-17a mRNA increased in Apc^Min/+;Il10^−/− compared to Apc^Min/+ proximal colon tissues (Fig. 2E). Furthermore, Apc^Min/+;Il10^−/− mice with a high number of tumors (>2) had significantly increased levels of TNFα, IFNγ and IL-1β mRNA compared to low tumor number (≤2) Apc^Min/+;Il10^−/− mice (Fig. 2F). Taken together, these data suggest that the heightened inflammatory and proliferative state observed in Apc^Min/+;Il10^−/− compared to Apc^Min/+ mice increased propensity for colorectal tumor formation and progression.

Figure 2.

Apc^Min/+;Il10^−/− mice have increased colon proliferation and inflammation.

A-B) CTNNB1 immunohistochemistry (IHC) from ~16 week old SPF Apc^Min/+;Il10^−/− (A) and Apc^Min/+ (B) colons. C-D) PCNA IHC from SPF Apc^Min/+;Il10^−/− (C) and Apc^Min/+ (D) colons. Higher magnification of both dysplastic and normal regions are shown for SPF Apc^Min/+;Il10^−/− mice. E) IL-6, TNFα, IFNγ, IL-1β, IL-22 and IL-17a mRNA expression in 16–48 week old SPF Apc^Min/+;Il10^−/− and Apc^Min/+ proximal colon tissue snips with relative fold expression compared to Apc^Min/+ mice. F) IL-6, TNFα, IFNγ, IL-1β, IL-22 and IL-17a mRNA expression in 16–48 week old SPF Apc^Min/+;Il10^−/− stratified by tumor number (high: > 2 tumors or low: ≤ 2 tumors) with relative fold expression compared to Apc^Min/+ mice. Data are expressed as mean +/− SD. Two-tailed Mann-Whitney statistical analysis: ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, NS: not significant.

Differential microbial composition within Apc^Min/+;Il10^−/− mice correlates with tumor multiplicity and inflammation status

We previously showed that inflammation altered microbial composition (17), a condition important for CRC development. Using 16S rRNA sequencing, we found that the SPF Apc^Min/+;Il10^−/− stool microbiome was associated with both colon inflammation score and tumor number (Fig. 3A), especially along the first Principal Coordinates Analysis (PCoA) axis (Fig. 3B). Using mixed linear models with either colon tumor number or colitis score as the independent variable, we identified 17 genera significantly affected by both colon tumor number and colitis score, including Allobaculum, Anaerotruncus, Butyrivibrio, Clostridium IV, Clostridium XI, Enterococcus, Oscillibacter, Pseudoflavonifractor, and Syntrophococcus (Fig. 3C, Supplementary Table S2). Only 5 genera were affected by colon tumor number but not combined inflammation score (Akkermansia, Coprobacillus, Escherichia Shigella, Marvinbryantia and Robinsoniella) while 4 genera were only affected by combined inflammation score and not colon tumor number (Alistipes, Enterorhabdus, Flavonifractor and Roseburia) (Fig. 3C). Interestingly, ~1/3 of these genera (10/26) were significantly increased in mice with colon tumors and/or inflammation while ~2/3 were decreased (16/26). Therefore, the microbial community composition is correlated with higher tumor numbers and inflammation, suggesting specific bacteria play a role in the development of colon inflammation and tumorigenesis in Apc^Min/+;Il10^−/ mice.

Figure 3.

SPF Apc^Min/+;Il10^−/− with colon tumors and colitis have an altered stool microbiota.

A) PCoA comparing the stool microbial composition of SPF Apc^Min/+;Il10^−/− mice. Each symbol represents an individual mouse (n= 70) with symbol shape and color according to colon inflammation score and tumor number, respectively. B) 3D plot showing how MDS1 from the PCoA (x axis) varies with combined inflammation score (y axis) and colon tumor number (z axis). C) Heatmap depicting the Spearman correlations (positive correlations in green, negative correlations in red) for genera that are significantly associated with colon tumor number and/or colitis in Apc^Min/+;Il10^−/− mice. Genera significant for both colon tumor number and combined inflammation score are in black font, colon tumor number only in purple font, and combined inflammation score only in blue font.

Bacteria are essential for development of colon tumorigenesis in Apc^Min/+;Il10^−/− mice

To stringently evaluate the impact of bacteria on CRC development, we derived Apc^Min/+;Il10^−/− and Apc^Min/+ mice in GF conditions and then performed microbial manipulation by either gavaging the mice with specific-pathogen-free (SPF) biota or allowing them to naturally acquire a microbiota in SPF conditions. Importantly, colon tumorigenesis was practically abolished in GF Apc^Min/+;Il10^−/− mice (mean= 0) compared to SPF conditions (Fig. 4A,D). Interestingly, SPF gavage enhanced colon tumor loads compared to passive SPF colonization of Apc^Min/+;Il10^−/− mice (mean= 3.86 vs 1 respectively p= 0.0126) (Fig. 4A,D), although colitis scores and most proliferative/inflammatory cytokine expression (IL-6, TNFα IFNγ, IL-22 and IL-17a) were not significantly different (colitis score means = 1.86 vs 2.36 respectively p=0.46) (Fig. 4B, 5D). Colon inflammation and tumors were negligible or absent in GF and SPF gavaged Apc^Min/+ mice (Supplementary Fig. S3A, B), suggesting inflammation is a key component of bacteria-mediated colon tumorigenesis. Development of small bowel neoplasia in Apc^Min/+;Il10^−/− and Apc^Min/+ mice (Fig. 5C, Supplementary Fig. S3C) was not significantly impacted by microbial colonization, suggesting a less pronounced role for the microbiota in the small intestine compared to the colon in this model. GF Apc^Min/+;Il10^−/− colons had reduced nuclear CTNNB1 and PCNA (Fig. 5A–C, Supplementary Fig. S4A–C) and decreased inflammatory cytokine expression (Fig. 5D) compared to SPF mice, indicating bacteria play a significant role in the increased inflammatory and proliferative state in SPF Apc^Min/+;Il10^−/− colons.

Figure 4.

Bacteria promote distal colon inflammation and tumorigenesis in Apc^Min/+;Il10^−/− mice.

A–C) Colon macroscopic tumor counts (A), colitis scores (B), and small intestine tumor counts (C) from GF (n=7), SPF transferred (n=5) and SPF gavaged (n=7) Apc^Min/+;Il10^−/− mice. SPF transfer (transferred to SPF and allowed to naturally acquire their microbiota) and gavage (transferred to SPF and gavaged with the cecal and fecal contents from a wild type 129SvEv mouse) mice were sacrificed 16 weeks after transfer from GF. D) Colon H&Es from GF, SPF transferred, and SPF gavaged Apc^Min/+;Il10^−/− mice. Data are expressed as mean +/− SD. Two-tailed Mann-Whitney statistical analysis: ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, NS: not significant.

Figure 5.

Microbiota promote colon inflammation and proliferation in Apc^Min/+;Il10^−/− mice.

A-C) β-catenin and PCNA IHC from GF (A), SPF transferred (B), and SPF gavaged (C) Apc^Min/+;Il10^−/− distal colons. Higher magnification of both dysplastic and normal regions are shown for SPF transfer and gavage Apc^Min/+;Il10^−/− mice. D) IL-6, TNFα, IFNγ, IL-1β, IL-22 and IL-17a mRNA expression in GF (n=5), SPF transfer (n=4), and SPF gavaged (n=4) Apc^Min/+;Il10^−/− proximal colon tissue snips with relative fold expression compared to GF. Data are expressed as mean +/− SD. Two-tailed Mann-Whitney statistical analysis: ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, NS: not significant.

Gnotobiotic experiments reveal specific microbial requirements for CRC development in Apc^Min/+;Il10^−/− mice

Fusobacterium spp. have been linked to the development of CRC (4) and recent studies showed increased carcinogenesis in F. nucleatum-colonized Apc^Min/+ mice (23–25). To investigate the interplay between microbiota and F. nucleatum in CRC, we transferred GF Apc^Min/+ to SPF conditions and gavaged them with SPF microbiota followed by weekly gavage with a fadA+, fap2− F. nucleatum CRC clinical isolate for 20 weeks. Interestingly, and in contrast to previous studies (23–25), presence of F. nucleatum failed to enhance carcinogenesis in these mice (Fig. 6A,C). We next transferred GF Apc^Min/+;Il10^−/− mice to SPF conditions, gavaged them with SPF microbiota and then introduced a mixture of 6 F. nucleatum strains (fadA+, fap2− or +) obtained from CRC patients by weekly gavage for 16 weeks. Although Apc^Min/+;Il10^−/− mice developed more inflammation and tumors than Apc^Min/+ mice, presence of F. nucleatum species did not influence intestinal carcinogenesis or colitis (Fig. 6B,C). To rule out the possibility that the SPF biota down-modulates F. nucleatum carcinogenic properties, we transferred GF Apc^Min/+ mice to a gnotobiotic isolator and associated these mice with a mixture of 6 F. nucleatum CRC clinical isolates (fadA+, fap2− or +; single gavage). Again, the presence of F. nucleatum isolates failed to enhance intestinal carcinogenesis in Apc^Min/+ mice (Fig. 6D) despite the presence of high colony-forming unit (CFU) counts (mean= 10⁷ CFU/g of stool). Although we did not see evidence of histological inflammation, to further confirm the effect of F. nucleatum on host inflammatory response, we examined inflammatory cytokine gene expression via qPCR. We found comparable levels of TNFα and IL1β in the mouse distal colon between germ-free and monoassociated Apc^Min/+ mice, whereas IL-6, IFNγ, IL-22 and IL-17a levels were undetectable (data not shown).

Figure 6.

F. nucleatum (Fn) does not exhibit pro-inflammatory and pro-tumorigenic activities.

A) GF Apc^Min/+ mice were transferred to SPF conditions and immediately gavaged with SPF microbiota (n= 6). SPF+Fn mice (n= 8) received Fn (a single strain human CRC isolate) via weekly gavage. SPF (control) mice received weekly gavage of BHI medium. Tumorigenesis was examined 20 weeks later. B) GF Apc^Min/+;Il10^−/− mice were transferred to SPF conditions and immediately gavaged with SPF microbiota (n= 4). SPF+Fn mice (n=6) received Fn (a mixture of 6 human CRC isolates) via weekly gavage. SPF (control) mice received weekly gavage of BHI medium. Tumorigenesis and inflammation were examined 16 weeks later (top panel). IL-6, TNFα, IFNγ, IL-1β, IL-22 and IL-17a mRNA expression in SPF and SPF+Fn Apc^Min/+;Il10^−/− distal colon snips (bottom panel). C) qPCR examination of fecal Fn levels in SPF+Fn Apc^Min/+ and Apc^Min/+;Il10^−/−− mice. D) GF Apc^Min/+ mice were transferred to a gnotobiotic isolator and gavaged with Fn (a mixture of 6 human CRC isolates). Tumorigenesis was examined 16 weeks later (GF n= 5 and Fn colonized n=9). In panels A-B, D, representative histology images of the colon are shown on the left. Macroscopic tumor counts are shown on the right. Data are expressed as mean +/− SD. Two-tailed Mann-Whitney statistical analysis: *p< 0.05, NS: not significant.

To further study the relationship between microbial status and carcinogenesis in gnotobiotic Apc^Min/+;Il10^−/− mice, we colonized these mice with E. coli NC101, a strain producing the colibactin genotoxin. We previously showed that removing pks from E. coli NC101 decreased development of CRC in the azoxymethane (AOM)/Il10^−/− mouse model (17). We next mono-associated Apc^Min/+;Il10^−/− mice by oral gavage (10⁸ CFU/mouse) with an E. coli NC101 mutant deficient for clbP, the pks gene necessary for colibactin activation (ΔclbP). We found that wild type NC101-colonized mice developed significantly more colon tumors than E. coli NC101 ΔclbP associated mice (mean= 1.71 vs 0.17 respectively p= 0.0023) (Fig. 7A). The finding that NC101 ΔclbP has diminished carcinogenic capacity compared to NC101 was confirmed in the AOM/Il10^−/− model (mean= 2 vs 5 tumors respectively p= 0.039, Supplementary Fig. S5). Importantly, deletion of clbP did not compromise the ability of E. coli NC101 to induce inflammation (colitis score mean= 2.675, 2.5 respectively p= 0.76) (Fig. 7B, D). Presence of a functional pks did not influence development of small intestinal tumors in Apc^Min/+;Il10^−/− mice (mean= 0.29, 0.8 respectively p= 0.22) (Fig. 7C). Overall, these findings show that Apc^Min/+;Il10^−/− mice are sensitive to microbial status and develop site specific tumors, with colibactin-producing E. coli but not F. nucleatum FadA or Fap2 enhancing colon tumor development.

Figure 7.

Colibactin promotes CRC development in Apc^Min/+;Il10^−/− mice.

A–C) Colon tumor counts (A), colitis scores (B), and small intestine tumor counts (C) from GF Apc^Min/+;Il10^−/− (n=6) and 16 week E. coli NC101 (n=7) or ΔclbP (n=6) mono-associated Apc^Min/+;Il10^−/− mice. D) IL-6, TNFα, IFNγ, IL-1β, IL-22 and IL-17a mRNA expression in NC101 (n=5) or ΔclbP (n=5) mono-associated Apc^Min/+;Il10^−/− distal colon snips with relative fold expression compared to ΔclbP mono-associated Apc^Min/+;Il10^−/− mice. Data are expressed as mean +/− SD. Two-tailed Mann-Whitney statistical analysis: ****p< 0.0001, ***p< 0.001, **p< 0.01, *p< 0.05, NS: not significant.

Discussion

Genetics and environmental factors play an important role in CRC development, with increasing attention directed toward the intestinal microbiota as a key environmental component (26). In general, the microbiota is thought to play a pro-carcinogenic role in CRC with numerous CRC mouse models demonstrating tumor reduction in antibiotic treated or GF mice (27). Here we utilized gnotobiotic Apc^Min/+ and Apc^Min/+;Il10^−/− mice to define the relationship between inflammation, microbial status and tumorigenesis. We observed that despite genetic susceptibility in both Apc^Min/+ and Apc^Min/+;Il10^−/− mice, colonic inflammation in the latter mice fosters development of colon tumors, which was associated with an altered luminal microbiota composition. Gnotobiotic experiments revealed that E. coli colibactin but not F. nucleatum FadA and Fap2 adhesins promote colon tumorigenesis, suggesting an intricate interaction between host genetics and bacteria.

We observed an inflammation dependent increase in colon tumorigenesis in 129 SvEv Apc^Min/+;Il10^−/− mice, which is in line with previous reports on Il10 deficient C57BL/6 Apc^Min/+ and Apc^Δ468 mice (13,14). However, in the small intestine compartment, tumors developed at a comparable rate regardless of Il10 status in Apc^Min/+ mice, which is in contrast to previous findings showing a delay in small intestinal polyp formation in Il10 deficient Apc ^Δ468 mice (15). Possible explanations for the differences in small intestine tumor formation may be due to genetic background differences which have been shown to strongly modulate tumor multiplicity, particularly in the small intestine of Apc^Min/+ mice (28). Nevertheless, our findings that Apc^Min/+;Il10^−/− and Apc^Min/+ small intestine tumor development significantly correlated with age but not inflammation suggests that age-related factors are a primary driver of small intestinal tumorigenesis.

We observed changes in the abundance of 26 genera that correlated with colon inflammation and/or tumor number. In contrast to previous sequencing results with Apc^Min/+ and T cell specific Apc^Min/+;Il10^−/− mice, no significant increases in the Bacteroides or Porphyromonas genera were observed (14). These differences are likely due to a combination of factors including sampling location (stool vs tissue), mouse genetic background, husbandry and 16S sequencing methods (V1–V3 region vs V3–V4). Importantly, Akkermansia, Blautia, Dorea, Enterococcus, and Escherichia/Shigella, which positively correlated with tumor number, have been previously associated as increased in mucosal tissue (17,29,30) or stools from either human CRC patients (31–33) or AOM/DSS mice (34,35). Conversely, some of the genera that negatively correlated with tumors and inflammation or just inflammation included Clostridium XIVa, Lachnospiracea and Roseburia, which have been implicated as butyrate producers and were decreased in CRC stool (31,33) or stools from AOM/DSS mice transplanted with stools from human patient samples (34). Thus, our sequencing results suggest there are changes in the microbiota that are associated with colon inflammation and tumor status.

The interaction between bacteria and the host in the context of intestinal carcinogenesis is complex. One study, using the chemical AOM/DSS regimen, reported that GF mice developed more colonic tumors than mice colonized with a complex biota, suggesting certain bacteria can have a beneficial role in CRC (36). Since microbial composition is a key determinant of colon tumor burden in AOM/DSS mice (35,37), this chemical model may better capture the protective functions of bacteria than the genetic Apc^Min/+ mouse model.

Nevertheless, the role of bacteria in Apc^Min/+ intestinal tumorigenesis is complex, with one report showing fewer tumors in the middle region of the small intestine in GF Apc^Min/+ mice (9) while another report showed reduced tumors throughout the intestine in GF Apc^Min/+ mice (10). The difference in tumor distribution is not clear. Our finding that bacteria promote colon tumors in Apc^Min/+;Il10^−/− mice is in line with a study showing reduced colon polyp numbers in Apc^Δ468;CD4^CreIl10^f/f mice following broad-spectrum antibiotic treatment (14).

Numerous studies have implicated Fusobacterium spp., in particular F. nucleatum, as carcinogenic, based on associative studies showing the presence of the bacterium in the luminal and mucosal compartment of human CRC patients using genomic analyses (3,4,24,33). In addition, daily gavage of F. nucleatum (strain EAVG_002; 7/1 or ATCC 25586) for 8–24 weeks was shown to promote intestinal tumorigenesis in C57BL/6 Apc^Min/+ mice (23–25). Surprisingly, Apc^Min/+ and Apc^Min/+;Il10^−/− mice colonized with fadA+, fap2+/− F. nucleatum isolates from CRC patients failed to promote intestinal tumorigenesis, in the presence (SPF) or absence of complex biota (gnotobiotic). The absence of tumorigenesis in mono-associated Apc^Min/+ mice was not due to poor colonization, since a high load of F. nucleatum (10⁷ CFU/g) was recovered from these mice. The discrepancy between our study and previous F. nucleatum Apc^Min/+ studies (23–25) is unclear but could be the result of strain specific properties (EAVG_002 (19,38) and ATCC 25586 (39,40) vs strains tested here), mouse genetic background differences and different microbial environments, as microbial communities are notoriously different between institutions. Nevertheless, our gnotobiotic approach clearly showed that presence of FadA and Fap2 adhesins in F. nucleatum is not sufficient to induce either inflammation or cancer, as opposed to E. coli pks+ mono-associated Apc^Min/+;Il10^−/− mice. Thus, it is possible that only a select group of F. nucleatum strains possess carcinogenic abilities, which require interactions with other specific members of the microbial community. It will be important to define these interactions and test a larger set of F. nucleatum strains to determine the role of these bacteria in CRC pathogenesis.

Several studies have found an association between pks+ E. coli and human CRC patients patients (17,29). Furthermore, pks+ E. coli isolates from mice or human CRC patients have a pro-tumorigenic effect in GF AOM/Il10^−/−, SPF Apc^Min/+, and SPF AOM/DSS mice (17,29,41). However, because the pks-associated clbA gene is implicated in the production of siderophores located in the enterobactin (ent) and yersiniabactin (HPI) loci (42), and our previous observation was based on removal of the entire pks island, it was unclear whether the decreased tumorigenesis observed in AOM/Il10^−/− mice was the consequence of dual siderophore/colibactin impairment, or solely due to abolished pks activity. Using a mutant with defective ClbP, the key enzyme implicated in pre-colibactin cleavage and generation of the active form (43), we demonstrated the colibactin-producing E. coli murine isolate NC101 is responsible for the pro-tumorigenic effect of the bacterium in Apc^Min/+;Il10^−/− mice. Whether clbA contributes to colibactin-mediated tumorigenesis is still unclear and would need to be investigated, especially since a recent in vitro study showed that iron levels and E. coli iron sensors regulate clbA transcription and colibactin production (44). Since our studies were performed using a mono-association approach, and therefore without competitive pressure from other microorganisms, the full extent of iron acquisition on E. coli pks+ induced carcinogenesis remains unclear.

Recent studies have attempted to dissect the contributions of intrinsic (organ specific stem cell division rates, aging) and extrinsic factors (hereditary mutations, lifestyle, environmental exposure, etc.), to overall cancer risk in humans (45–47). However, the interplay between all these factors makes it difficult to tease out the various contributions using epidemiological data. Nevertheless, these studies suggest that small intestine cancers with a relatively low lifetime risk are driven by intrinsic risk factors, while 82.9% of the mutation signatures in CRCs are from extrinsic factors, correlating with a much higher lifetime risk (46). We postulate that one of the extrinsic factors contributing to CRC risk is the microbiota, which not coincidentally is also affected by lifestyle and environmental factors (48,49). Interestingly, the concentration of bacteria increases along the gastrointestinal tract with 10³–10⁴ bacteria/mL in the small intestine to 10¹¹ bacteria/mL in the colon, mirroring the distribution of cancer risk along the human intestinal tract (50). Similarly, in the Apc^Min/+;Il10^−/− model, age strongly correlates with small intestine tumor numbers while inflammation and bacteria composition play a strong role in colon tumorigenesis. Elucidating the mechanisms by which specific bacteria interact with other microbiota members to promote carcinogenesis will generate important insights into the pathophysiology of CRC.