Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2017 Sep 30;7(21):9162–9178. doi: 10.1002/ece3.3467

Genetic structure and demographic history of Lymantria dispar (Linnaeus, 1758) (Lepidoptera: Erebidae) in its area of origin and adjacent areas

Tae Hwa Kang 1, Sang Hoon Han 2, Heung Sik Lee 3,✉
PMCID: PMC5677484  PMID: 29152205

Abstract

We analyzed the population genetic structure and demographic history of 20 Lymantria dispar populations from Far East Asia using microsatellite loci and mitochondrial genes. In the microsatellite analysis, the genetic distances based on pairwise F ST values ranged from 0.0087 to 0.1171. A NeighborNet network based on pairwise F ST genetic distances showed that the 20 regional populations were divided into five groups. Bayesian clustering analysis (K = 3) demonstrated the same groupings. The populations in the Korean Peninsula and adjacent regions, in particular, showed a mixed genetic pattern. In the mitochondrial genetic analysis based on 98 haplotypes, the median‐joining network exhibited a star shape that was focused on three high‐frequency haplotypes (Haplotype 1: central Korea and adjacent regions, Group 1; Haplotype 37: southern Korea, Group 2; and Haplotype 90: Hokkaido area, Group 3) connected by low‐frequency haplotypes. The mismatch distribution dividing the three groups was unimodal. In the neutral test, Tajima's D and Fu's FS tests were negative. We can thus infer that the Far East Asian populations of L. dispar underwent a sudden population expansion. Based on the age expansion parameter, the expansion time was inferred to be approximately 53,652 years before present (ybp) for Group 1, approximately 65,043 ybp for Group 2, and approximately 76,086 ybp for Group 3. We propose that the mixed genetic pattern of the inland populations of Far East Asia is due to these expansions and that the inland populations of the region should be treated as valid subspecies that are distinguishable from other subspecies by genetic traits.

Keywords: demographic history, Far East Asia, Lymantria dispar, population genetic structure, species origin region

1. INTRODUCTION

The gypsy moth, Lymantria dispar (Linnaeus, 1758), originating from Hokkaido, Japan (Bogdanowicz, Mastro, Prasher, & Harrison, 1997; Bogdanowicz, Schaefer, & Harrison, 2000; Goldschmidt, 1934, 1940), is widely distributed in the Palearctic region (Pogue & Schaefer, 2007; Schintlmeister, 2004). There are three subspecies: L. dispar dispar, L. dispar asiatica Vnukovskij, 1926, and L. dispar japonica Motschulsky, 1860 (Pogue & Schaefer, 2007). Lymantria dispar dispar is mainly distributed in Europe, L. dispar asiatica occurs from Central Asia to East Asia, and L. dispar japonica is present only in Japan (Pogue & Schaefer, 2007). Among these subspecies, the validity of the scientific name L. dispar asiatica (Figure 1) has been debated by many authors (Lee, Kang, Jeong, Ryu, & Lee, 2015). Schintlmeister treated L. dispar asiatica as a synonym of L. dispar dispar on the basis of their type locality; however, Pogue and Schaefer treated the subspecies as valid based on the morphological characteristics of the females, which have larger wings than the females of L. dispar dispar (Lee et al., 2015; Pogue & Schaefer, 2007; Schintlmeister, 2004). The dispersal ability of the two subspecies may differ because of these differences in wing size. Based on research of male deaths after interbreeding, Higashiura et al. (2011) accepted the five subspecies of Inoue (1982). Thus, the subspecies of L. dispar are clearly in a state of confusion.

Figure 1.

Figure 1

Adult habitus of Lymantria dispar asiatica (a, male; b, female)

Lymantria dispar dispar was intentionally brought to North America for hybridization experiments; however, some individuals escaped in either 1868 or 1869 (Liebhold, Mastro, & Schaefer, 1989). Since then, the subspecies has become an invasive forest pest, causing injury to approximately 400 species of plants (Lowe, Browne, Boudjelas, & De Poorter, 2000; Pogue & Schaefer, 2007). Approximately US$11 million is spent on European gypsy moth control every year (Pimentel, Zuniga, & Morrison, 2005; Pogue & Schaefer, 2007). For these reasons, L. dispar asiatica, which has higher flight capability than L. dispar dispar, has been treated as a quarantine pest in North America (Pogue & Schaefer, 2007).

Due to the quarantine and danger this invasive species represents, studies of the differences among local populations are actively conducted. In previous decades, population genetic analyses of L. dispar were performed using various methods, such as allozyme detection, amplified fragment length polymorphism, restriction fragment length polymorphism, sequence‐based analysis, and microsatellites (Bogdanowicz et al., 1997, 2000; deWaard et al., 2010; George, 1984; Kang, Lee, & Lee, 2015; Keena, Cȏté, Grinberg, & Wallner, 2008; Koshio, Tomishima, Shimizu, Kim, & Takenaka, 2002; Qian et al., 2014; Wu et al., 2015). Area of origin studies, in particular, using microsatellite loci were mainly conducted by North American researchers. In the first attempt by Bogdanowicz et al. (1997), four markers were developed and used to assay allelic variation in four gypsy moth populations (Japan, Far East Russia, China, and North America). Subsequently, Keena et al. (2008) evaluated flight capability and related traits using four microsatellite loci (from Bogdanowicz et al., 1997) and mitochondrial DNA analyses of samples obtained from 46 geographic strains. In Far East Asia, Koshio et al. (2002) compared the allele types of regional populations using three microsatellite loci of Japanese samples from three local populations; however, they did not consider population structure because of small sample sizes. Recently, Wu et al. (2015) thoroughly analyzed the population structure of the Holarctic gypsy moth and performed an origin test for each regional population using nine microsatellite loci, including three from Bogdanowicz et al. (1997).

These studies were conducted from the perspective of quarantine inspection (or invasive species control), and the number of sampled individuals was large; however, the number of sampled areas in each region was small, leading to taxonomic confusion with respect to the subspecies of L. dispar. For example, it was reported that two Asian subspecies, L. dispar asiatica and L. dispar japonica, were difficult to distinguish using morphological characters, with individuals of L. dispar asiatica collected from the southern coastal area of Korea having characteristics similar to L. dispar japonica (Lee et al., 2015; Pogue & Schaefer, 2007). To resolve this taxonomic confusion at the subspecific level, a demographic history of the Far East Asian populations of L. dispar based on intensive sampling is required. Therefore, the goal of this study was to reveal the population genetic structure and demographic history of L. dispar in Far East Asia, including in the region of species origin: Hokkaido, Japan. For this purpose, we analyzed the genetic diversity and demographic history of L. dispar from Far East Asia using eight microsatellite loci and three mitochondrial genes (cytochrome c oxidase I [COI], ATP6, and ATP8 genes).

Genetic diversity analyses using microsatellite loci have been conducted for various eukaryotes (Balloux & Lugon‐Moulin, 2002; Sakai et al., 2001; Sunnucks, 2000). Recently, they have been used to track the influx of invasive species (Hess, Swalla, & Moran, 2008; Hunter & Hart, 2013; Keena et al., 2008; Kim et al., 2011; King, Eackles, & Chapman, 2011; Tóth, Gáspári, & Jurka, 2000). For the use of microsatellite loci, however, a primer set for each polymorphic locus is required. The general method employed is an enrichment strategy (López‐Uribe, Santiago, Bogdanowicz, & Danforth, 2012; Richardson, Stanley, & Sherman, 2012), which is expensive and time‐consuming, as it is based on traditional cloning strategies (Perry & Rowe, 2011; Santana et al., 2009; Zane, Bargelloni, & Patarnello, 2002). However, the next‐generation sequencing (NGS) technique is very useful for the construction of microsatellite loci libraries at a lower cost and far more quickly than traditional cloning‐based approaches (Hess et al., 2008; Kang, Han, & Park, 2016; Kang, Han, & Park, 2015; Perry & Rowe, 2011; Yu, Won, Jun, Lim, & Kwak, 2011). Because of the problems associated with the traditional cloning strategies, we used Illumina sequencing, one of the NGS techniques, for reading the genomic DNA of L. dispar and then developed microsatellite markers from the results.

2. MATERIALS AND METHODS

2.1. Sampling and genomic DNA extraction for NGS and pyrosequencing

For NGS, we extracted genomic DNA from an egg mass of L. dispar. The egg mass was collected from Suwon, Korea (37°14.092′N, 127°02.840′E; Figure 2b: Site A). In the egg mass, we selected 50 eggs and extracted genomic DNA using a NucleoSpin® Tissue Kit (Macherey‐Nagel GmbH, Düren, Germany) following the manufacturer's instructions. The sequencing was performed with a MiSeq Sequencer (Illumina, San Diego, CA, USA) by the DNA sequencing company DisGene (Daejeon, Korea). The resulting contigs were assembled in CLC workbench (CLC Bio, Aarhus, Denmark).

Figure 2.

Figure 2

Collection sites of Lymantria dispar in Far East Asia

2.2. Sampling and genomic DNA extraction for genetic structure analysis

For polymerase chain reaction (PCR) analysis of polymorphisms with the developed microsatellite markers and for genetic structure analysis, 552 samples were collected from 20 sites in Mongolia (1), Russia (1), China (1), Korea (12), and Japan (5) using pheromone attraction traps (Figure 2, Table 1). The thoracic muscle of each individual was removed for the extraction of genomic DNA. For morphological examination, fore and hind wings were prepared as specimens on a glue board. Abdomens were maintained at −20°C for examination of genitalia. Genomic DNA was extracted using a DNeasy® Blood & Tissue Kit (Qiagen, Leipzig, Germany) according to the manufacturer's instructions.

Table 1.

Collection sites of Lymantria dispar in Far East Asia

Sn CL GPS CIn Sn SSn COI GAn ATP6/ATP8 GAn GSn
A Korea, GG, Suwon‐si, Yeongtong‐gu, Mangpo‐dong 37°14.092′N 127°02.840′E Egg mass For NGS – – – –
1 Incheon, Gyeyang‐gu, Gyesan‐dong 37°32′57.9″N 126°43′42.7″E 30 192–221 30 KT245170–KT245199 KX945522–KX945551 20
6 GW, Inje‐gun, Buk‐myeon, Hangye‐ri 38°08′09.5″N 128°15′40.1″E 30 312–341 28 KT245288–KT245317 KX945552–KX945579 20
10 CN, Seosan‐si, Haemi‐myeon, Daegok‐ri 36°41′55.4″N 126°35′35.1″E 30 432–461 26 KT245405–KT245430 KX945580–KX945605 20
12 CB, Cheongweon‐gun, Miweon‐myeon, Daesin‐ri 36°41′46.2″N 127°36′27.3″E 30 492–521 23 KT245496–KT245480 KX945606–KX945628 20
16 GB, Yeongyang‐gun, Subi‐myeon, Suha‐ri 36°50′23.4″N 129°16′22.5″E 30 612–641 17 KT245558–KT245584 KX945629–KX945645 20
18 JB, Jinan‐gun, Jinan‐eup, Danyang‐ri 35°45′55.8″N 127°25′00.6″E 30 672–701 28 KT245609–KT245636 KX945646–KX945673 20
22 JN, Gangjin‐gun, Jakcheon‐myeon, Galdong‐ri 34°43′00.3″N 126°43′49.5″E 30 792–821 29 KT245722–KT245750 KX945674–KX945702 20
26 GB, Gyeongju‐si, Yonggang‐dong 35°51′45.4″N 129°14′14.7″E 30 912–941 30 KT245840–KT245869 KX945703–KX945732 20
27 GN, Hapcheon‐gun, Daebyeong‐myeon, Hageum‐ri 35°31′27.9″N 127°59′12.1″E 30 942–971 22 KT245870–KT245899 KX945733–KX945754 20
28 GN, Milyang‐si, Bubuk‐myeon, Jeonsapo‐ri 35°27′30.5″N 128°44′11.6″E 30 972–1,001 28 KT245900–KT245929 KX945755–KX945782 20
30 GN, Gimhae‐si, Saman‐dong 35°15′16.0″N 128°54′51.3″E 30 1,032–1,061 30 KT245960–KT245989 KX945783–KX945812 20
31 JJ, Jeju‐si, Bonggae‐dong 33°26′15.0″N 126°37′43.8″E 30 1,062–1,091 30 KT245990–KT246019 KX945813–KX945842 20
33 Russia, Vladivostok 43°23′44.6″N 132°09′56.6″E 30 1,703–1,732 28 KT246046–KT246075 KX945843–KX945870 30
34 Mongolia Selenge Province Shaganuur 50°15′N105°30′E 30 1,733–1,749 13 KX945391–KX945403 KX945871–KX945883 17
35 Japan Hokkaido Otaru Asarigawa‐onsen, 1 Chome 43°8.056′N141°2.395′E 30 1,870–1,899 23 KX945404–KX945426 KX945884–KX945906 30
36 Japan Hokkaido Sapporo Minami‐ku Jozankei Jozankei Lakeline 43°0.296′N)141°8.88′E 30 1,900–1,929 23 KX945427–KX945449 KX945907–KX945929 30
37 Japan Hokkaido Abuta Kimobetsu‐cho Fushimi 42°48.098′N 140°58.172′E 30 1,930–1,959 23 KX945450–KX945472 KX945930–KX945952 30
38 Japan Hokkaido Sapporo Minami‐ku Jozankei‐onsen higashi 4 Chome 42°57.666′N 141°9.431′E 30 1,960–1,989 26 KX945473–KX945498 KX945953–KX945978 30
39 China Jilin Helong Qingshanli 42°26′22.6″N 128°51′50.3″E 18 1,990–2,007 17 KX945499–KX945515 KX945979–KX945995 18
41 Japan Kyushu Fukuoka Miyawaka Mt. Inunaki 33°40′54.0″N 130°33′15.4″E 7 2,013–2,019 6 KX945516–KX945521 KX945996–KX946001 7
Total 20 sites – 565 – 480 – – 432

Sn, site number; CL, collecting location; CIn, number of collected individuals; Sn, sample number; SSn, number of sequenced samples; GAn, GenBank accession number; GSn, number of genotyped samples.

2.3. Microsatellite locus identification and marker development

Microsatellite loci were identified using Phobos ver. 3.3.12 (Leese, Mayer, & Held, 2008; Mayer, Leese, & Tollrian, 2010) with the following conditions: repeated sequence length, 2–4 base pairs (bp) and repeat count, greater than four. AT‐rich loci were excluded from the investigated microsatellite loci, and for loci that were repeated more than six times, primer sets were chosen using the primer design software PRIMER 3 (Koressaar & Remm, 2007; Untergrasser et al., 2012) with the following criteria: melting temperature, 55.5–56.5°C; GC content, over 30%; and primer length, 18–22 bp. A hundred and fifty primer sets were designed, and PCR tested for specificity and the presence of polymorphic amplification using one sample from each of the twelve regional populations from Korea. PCRs for the primer qualification test were conducted with AccuPower PCR PreMix (Bioneer, Daejeon, Korea) in a final volume of 20 μl containing 30 ng of template DNA and 5 pmol of each primer. Extra MgCl2 was not added. The amplification profile was 5 min at 94°C; 30 cycles of 10 s at 94°C, 10 s at 56°C, and 20 s at 72°C; and a final 5 min extension at 72°C. The specificity and presence of polymorphic amplification for each primer set were checked using a QIAxcel DNA high‐resolution cartridge (Qiagen, Leipzig, Germany). For the markers showing polymorphism in the electrophoresis, each forward (sense) primer for genotyping was labeled with 6‐carboxyfluorescein at the 5′ end (Schuelke, 2000). Of the labeled markers, eight were selected for microsatellite marker assessment by a PCR amplification test. For microsatellite marker assessment, 432 samples from the 20 regional populations were genotyped (Table 1). These PCRs were performed by the DNA sequencing company Bionics (Seoul, Korea).

2.4. Mitochondrial DNA sequencing

For the analysis of L. dispar genealogy in Far East Asia, we selected three mitochondrial genes: COI, ATP6, and ATP8. The COI gene may not be suitable for population analysis because its intraspecific variation is relatively low and its interspecific variation is relatively high (Cameron & Whiting, 2008; Wu et al., 2015); however, when combined with other genes, it may be useful (Hajibabaei, Singer, Hebert, & Hickey, 2007). The ATP6 and ATP8 genes show relatively higher intraspecific variation and are known to be suitable for population genetic analysis (Cameron & Whiting, 2008; Wu et al., 2015). The former region of the COI gene was amplified using the LCO1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) and HCO2198 (5′TAAACTTCAGGGTGACCAA AAAATCA‐3′) primer set (Folmer, Black, Hoeh, Lutz, & Vrijenhock, 1994) and a GeneMax Tc‐s‐B PCR cycler (BIOER, Hangzhou, China). PCR conditions were set as in Hebert, Cywinska, Ball, and deWaard (2003). The ATP6 and ATP8 genes were amplified using the primer set from Wu et al. (2015) and an ABI Veriti 96‐well Thermal Cycler (Applied Biosystems®; Thermo Fisher Scientific Inc., MA, USA). PCR products were checked using 1% agarose gel electrophoresis. The PCR products were purified and sequenced using the sequencing services of Macrogen (Seoul, Korea) and Bionics (Seoul, Korea). The obtained sequences were submitted to NCBI GenBank (Table 1).

2.5. Microsatellite loci data analysis

Genotyping errors (such as null alleles and scoring errors) on selected markers were checked with MICRO‐CHECKER ver. 2.2.3 (Oosterhout, Hutchinson, Wills, & Shipley, 2004). The pairwise linkage disequilibrium values for pairs of loci were then examined using Arlequin ver. 3.1 (Excoffier, Laval, & Schneider, 2005). Genetic diversity parameters such as allele frequency, genotype number, allele type, gene diversity, heterozygosity, and polymorphism information content (PIC) were calculated with PowerMarker ver. 3.5 (Liu & Muse, 2005). Hardy–Weinberg equilibrium (HWE) across loci was estimated after sequential Bonferroni correction (Rice, 1989). To test the isolation by distance (IBD) model, the correlation between genetic distance and geographic distance was calculated using Mantel's test with 30,000 randomizations in IBD ver. 3.23 (Jensen, Bohonak, & Kelley, 2005). To estimate genetic differentiation among regional populations, analysis of molecular variance (AMOVA) was used. AMOVA was calculated using the Kimura two‐parameter model in Arlequin ver. 3.1 (Excoffier et al., 2005). We ascertained the allele type frequencies based on microsatellite loci for each population and estimated the pairwise genetic distances between the populations based on allele type frequencies with PowerMarker ver. 3.5 (Liu & Muse, 2005). Based on the pairwise genetic distances, a network estimating the genealogical relations among the 20 regional populations was calculated with SplitTree4 (Huson & Bryant, 2006). We tested the genetic differentiation among the populations using a model‐based Bayesian analysis with STRUCTURE ver. 2.3.4 (Falush, Stephens, & Pritchard, 2003; Pritchard, Stephens, & Donnelly, 2000) under the following conditions: a correlated‐allele model with a 500,000 burn‐in period, 750,000 MCMC reps after burn‐in, K from 2 to 8, and 20 iterations. The value of the ad hoc statistics ∆(K) was then estimated with Harvester (Earl & von Holdt, 2012) using the average value of LnP(D) to estimate the number of genetic groups (Evanno, Regnaut, & Goudet, 2005).

2.6. Mitochondrial sequence data analysis

The obtained sequences were manipulated as a raw data set using MEGA 6 (Tamura, Stecher, Peterson, Filipski, & Kumar, 2013), and sequence divergence was estimated. The standard diversity indices (the number of haplotypes and polymorphic sites) were estimated using DnaSP ver. 5.10.01 (Librado & Rozas, 2009), and the raw data set was converted for analysis in Arlequin and NETWORK. The molecular diversity indices (haplotype diversity and nucleotide diversity) were estimated using Arlequin ver. 3.1 (Excoffier et al., 2005). To estimate the genealogical relations among the haplotypes, a median‐joining network was calculated using NETWORK ver. 4.6.1.3 (http://www.fluxus-engineering.com). F ST distances among all pairs in the population were used to assess the genetic structure of L. dispar asiatica. Population pairwise F ST values were calculated using the Kimura two‐parameter model in Arlequin ver. 3.1 (Excoffier et al., 2005) (significance test = 0.05; significance level = 1,000 permutations). To estimate genetic differentiation among regional populations, AMOVA was used following the Kimura two‐parameter model in Arlequin ver. 3.1 (Excoffier et al., 2005). To test the IBD model, the correlation between genetic distance and geographic distance was calculated using Mantel's test with 30,000 randomizations in IBD ver. 3.23 (Jensen et al., 2005).

To estimate the demographic history of the gypsy moth populations, a mismatch distribution analysis was conducted using Arlequin ver. 3.1 (Excoffier et al., 2005). Sudden expansion of the population was first estimated in a mismatch distribution graph: unimodal or not unimodal. Deviation from the demographic expansion model was estimated using the sum of the squared deviation and Harpending's raggedness index (Harpending, 1994). To estimate population equilibrium, Fu's FS test (Fu, 1997) and Tajima's D test (Tajima, 1989) were conducted. If population expansion was detected by the mismatch distribution, the expansion time of the population was calculated using the formula tau = 2ut (tau = age expansion parameter; u = the aggregate mutation rate over the region of DNA under study; and t = generation time) (Roger & Harpending, 1992), with the assumption that the mutation rate of insect mitochondrial DNA is 2.3% per million years (Brower, 1994).

3. RESULTS

3.1. NGS sequencing and microsatellite marker development

Illumina sequencing of the genomic DNA from L. dispar eggs obtained 3,974,358,483 bp from 15,988,036 reads, with an average of 248 bp per read, which assembled into 718,940 contigs, with an average of 511 bp per contig (Table  S1). The contigs contained 1,867 microsatellite loci (excluding AT repeats; the length of the repeated base, 2–4 bp; and repeated more than four times). Of these, 430 loci showing more than six repeated motifs were tested for the probability of marker design with PRIMER3 (Koressaar & Remm, 2007; Untergrasser et al., 2012). We were able to design primer sets for 207 loci, from which we randomly selected 150 loci for PCR tests to examine polymorphism. Capillary electrophoresis revealed that 29 of 150 loci showed clear polymorphism (Table 2). From PCR amplification tests on the labeled markers of selected 29 loci, we selected eight microsatellite markers (39,767, 58,587, 124,259, 134,079, 230,995, 297,455, 344,041, and 346,977) (Table 3). The sequences of the eight selected microsatellite loci were submitted to NCBI GenBank (Table 3).

Table 2.

Selected primer sets (29 of 150) showing clear polymorphism

No MSL no SPS RM
1 19,028 GCGTACAAACTACGCAAGTC (CT)14
ATAGCCATGAAGCGAGTGTA
2 20,500 CCCCTAGTCATTCCGTTAAAC (ATG)9
AGCAAACATTCGACGACTC
3 22,651 GTGGCAACCGTAGACATAAC (ATC)10
CGTCTGACCAACGAGATAAA
4 39,767 AGCGCTTCCTAATTGGTTAT (GT)15
ACGCGTGGTTATAACTTTCA
5 44,678 GGATGAAGTTGATGGGTGAG (ATC)9
CGCGATGCTGATGAAGTTAT
6 58,587 TGCAGTCGAATTTAGGCAAA (ATG)8
TTGAACAAAGCCAATCGGAT
7 109,715 GGGTTTCCTGACTTTGATACA (AC)13
CTCCATGAGATGACTGGCTA
8 119,274 GCGACCGGTCATAAAACTAT (ATG)9
ATTTCTCTCTCACGCCAGT
9 124,259 TTGACACTGCACCGTAAATT (AG)13
ATATTGCGCATATGACCCAC
10 134,079 TGAAAGACGACTAAAGCACG (ATC)9
GACTCTTGAGCAATTGGGTT
11 167,938 GAAATTTGCACCAGTTTGAA (AG)15
TGGCAATGAATTCTGCTTAT
12 178,435 CTTGCCCGTGAATATCGAAA (GT)13
AGTTTACATGAAGCGACAGTT
13 178,855 AATGTCACAGAACGAAGTGG (GT)16
GGCAACGAATTTGCTTAGTA
14 203,511 GACTTTAACGAGTGCACAGT (ACAT)7
TGACCATGAACCAATTAGCG
15 205,435 GGTGGGGTGTGTTTAGACTA (CT)13
GGTGATATGGCAGAACAGC
16 206,922 CCATGAAGCTACAAGTTCGAT (GT)13
AGGCTATATTTCCTACCGGG
17 230,995 CCATCTGACCATTGTGCTAT (ATC)10
TGAGGCACTATGTCCTTGAT
18 233,404 TTGACAGCCGTTATTGAGAT (AC)16
AACTACCGCCATCATTATCA
19 239,543 TTTGTGGCGAAACATGAGAT (ATG)8
AAACAAACGGGGTAAGCTAAA
20 243,906 ACGGAACCCTAAAAATGAAC (ATC)10
TTACCTGGAATGGTCGAATA
21 253,129 GAGTACCCGACATTGATTGA (GT)17
AGTGCACGTCTACACTACCG
22 297,455 GTGTGCGTTCTGTGGTATG (CT)23
GTGGACTCGCTGTAACACTC
23 306,436 CGTCTGCGTACTATCATATTGA (GT)13
GTTGTACTGTTACTCCTCGC
24 314,848 CTGACCAGCGTATCAATTTC (AGG)14
ATCAAATACGAACGCGATAA
25 327,335 TTTTGTTTGTAGTGCCGAAC (GT)22
CAATATGACCCAACGTCATT
26 331,393 TTCTCGCAAAACCAAGACC (ATG)9
AAGTGAATGTTAGCAGGGTG
27 335,162 ATCTGCTGATATCGCAATGG (ATC)8
GAGGCAAACAGTGGGATTTA
28 344,041 GTGGCACGTGAACAAATATAC (ATC)9
CTTTGCTTGTGGGTGTCATA
29 346,977 CTTGCTGGACTTATCTGTGG (AGTC)8
ACGTTTTTCAGTGGGTAGGT

MSL, microsatellite loci; SPS, sequence of primer set; RM, repeat motif.

Table 3.

Ten selected markers for microsatellite loci analysis of Lymantria dispar

MSL no Marker name Sequence RM Size GAn
39,767 39767‐FAM AGCGCTTCCTAATTGGTTAT (GT)15 129–179 KT633401
39767R ACGCGTGGTTATAACTTTCA
58,587 58587‐FAM TGCAGTCGAATTTAGGCAAA (ATG)8 214–299 KT633402
58587R TTGAACAAAGCCAATCGGAT
124,259 124259‐FAM TTGACACTGCACCGTAAATT (AG)13 184–218 KT633403
124259R ATATTGCGCATATGACCCAC
134,079 134079‐FAM TGAAAGACGACTAAAGCACG (ATC)9 159–270 KT633404
134079R GACTCTTGAGCAATTGGGTT
230,995 230995‐FAM CCATCTGACCATTGTGCTAT (ATC)10 148–196 KT633405
230995R TGAGGCACTATGTCCTTGAT
297,455 297455‐FAM GTGTGCGTTCTGTGGTATG (CT)23 170–254 KT633407
297455R GTGGACTCGCTGTAACACTC
344,041 344041‐FAM GTGGCACGTGAACAAATATAC (ATC)9 131–329 KT633409
344041R CTTTGCTTGTGGGTGTCATA
346,977 346977‐FAM CTTGCTGGACTTATCTGTGG (AGTC)8 165–201 KT633410
346977R ACGTTTTTCAGTGGGTAGGT

MSL, microsatellite loci; RM, repeat motif; GAn, GenBank accession number.

3.2. Microsatellite marker assessment

Microsatellite markers were initially assessed using 20 regional populations (one population from Mongolia, one from China, one from Russia, 12 from Korea, and five from Japan). Testing for genotyping errors at each locus revealed that one marker (346,977 in Site 22) showed evidence of null alleles (Table 4). However, the null allele frequency of the marker was 0.1947, which is lower than 0.20. In microsatellite analysis, the frequencies of null alleles are almost always p < .40 and usually p < .20 (Dakin & Avise, 2004). When microsatellite null alleles are uncommon to rare (p < .20), their presence causes a slight underestimate of the average exclusion probability at a locus; however, this is usually not of sufficient magnitude to warrant great concern. For p > .20, however, the mean “estimated with null” exclusion probability can be much higher than the “true” and “estimated without null” values (Dakin & Avise, 2004). Therefore, we retained the marker showing p < .20 in our population genetic analysis. We estimated that these markers were independently evolved within our samples; however, the tests for linkage disequilibrium were not significant. Therefore, genetic diversity indices (major allele frequency, genotype number, allele number, gene diversity, observed heterozygosity, and PIC) of each regional population were estimated with eight markers. We determined the allele type frequencies based on microsatellite loci for each population (Table  S2). For each marker, gene diversity, observed heterozygosity, and PIC ranged from 0.2500 to 0.8963, 0.2778 to 1.0000, and 0.2374 to 0.8877, respectively. The genetic diversity was high, ranging from 2 to 16 alleles for each marker (Table S3). The exact p‐values of HWE were calculated for each regional population after sequential Bonferroni corrections (p = .0003). Deviations from HWE were not detected in the exact p‐values; however, some markers were identified as relatively low exact p‐values in each population (Table S3). Thus, we compared the differences between gene diversity and observed heterozygosity in each population for each marker. Two populations, Sites 12 and 26, had observed heterozygosity values lower than the gene diversity values in all loci except locus 344,041. Lower observed heterozygosity values than the gene diversity values suggest significant homozygosity, and this implies the presence of null alleles or allelic dropout, linkage of alleles, or inbreeding (Damm, Armstrong, Arjo, & Piaggio, 2015). However, we tested for the presence of null alleles or allelic dropout and linkage of alleles through the previous analyses. Lastly, if the violation were a consequence of inbreeding, we would have expected to observe such a phenotype at many or all loci, not just at a single locus (Damm et al., 2015; Selkoe & Toonen, 2006). The samples from Sites 12 and 26 might indicate inbreeding or sib sampling. In this study, however, we retained the samples from the two sites in our analysis because the deviation from HWE was not detected at all analyzed loci (Table S3). Therefore, we suggest that the developed eight novel microsatellite markers may be useful for a population genetic analysis of L. dispar.

Table 4.

Results of the test of null alleles and the PCR error present in eight filtered markers

MSL Site 1 Site 6 Site 10 Site 12
NP Freq NP Freq NP Freq NP Freq
39,767 No 0.0164 No −0.0053 No −0.1204 No 0.0735
58,587 No −0.1305 No −0.5138 No −0.4287 No 0.0323
124,259 No −0.0127 No 0.0763 No −0.0307 No 0.0725
134,079 No −0.0313 No −0.1476 No −0.0360 No 0.0456
230,995 No −0.0139 No 0.0417 No −0.0508 No −0.0014
297,455 No −0.0548 No −0.0010 No −0.0810 No 0.0379
344,041 No −0.1074 No −0.0994 No −0.1225 No −0.1475
346,977 No −0.0233 No 0.0644 No −0.0468 No 0.0002
MSL Site 16 Site 18 Site 22 Site 26
NP Freq NP Freq NP Freq NP Freq
39,767 No 0.0704 No 0.0236 Yes 0.1386 No 0.0301
58,587 No −0.2454 No −0.4557 No 0.0147 No 0.0096
124,259 No 0.0164 No −0.0084 No −0.0284 No 0.1223
134,079 No −0.0530 No 0.0206 No 0.0575 Yes 0.1540
230,995 No 0.0303 No −0.0086 No −0.0073 No 0.0995
297,455 No 0.0070 No −0.0123 No 0.0362 No 0.0708
344,041 No −0.1725 No −0.1539 No −0.1185 No −0.1949
346,977 No −0.0357 No 0.0835 Yes 0.1947 No 0.1397
MSL Site 27 Site 28 Site 30 Site 31
NP Freq NP Freq NP Freq NP Freq
39,767 No 0.0022 No −0.1312 No 0.0307 No 0.1159
58,587 No 0.0443 No 0.1366 No 0.1281 No 0.0343
124,259 No −0.0552 No 0.0166 No −0.0625 No −0.1003
134,079 No −0.1057 No −0.0089 No −0.0659 No −0.0150
230,995 No −0.0280 Yes 0.1603 No 0.0402 No −0.0294
297,455 No 0.0071 No 0.0192 No 0.0271 No −0.0036
344,041 No −0.5174 No −0.2371 No −0.1892 No −0.1916
346,977 No 0.0421 No 0.0802 No 0.0023 No 0.1520
MSL Site 33 Site 34 Site 35 Site 36
NP Freq NP Freq NP Freq NP Freq
39,767 No 0.0554 No −0.1725 No −0.0752 No −0.0275
58,587 No −0.0017 No −0.0801 No 0.0340 No 0.0901
124,259 No 0.0812 No 0.0861 No 0.0094 No −0.1114
134,079 No −0.0264 No −0.1606 No 0.0087 No 0.0502
230,995 Yes 0.0980 No −0.6078 No −0.0350 No −0.0157
297,455 No 0.0196 No −0.0727 No −0.2100 No −0.0614
344,041 No −0.0685 No −0.1697 No −0.2168 No −0.3067
346,977 No −0.0182 No 0.0000 No 0.0964 No 0.0824
MSL Site 37 Site 38 Site 39 Site 41
NP Freq NP Freq NP Freq NP Freq
39,767 No 0.0402 No −0.0001 No 0.0300 No 0.0332
58,587 No −0.0135 No −0.0135 No −0.1435 No −0.0089
124,259 No 0.0296 No 0.0049 No −0.0051 No −0.1271
134,079 Yes 0.1016 No 0.0658 No −0.0389 No 0.0774
230,995 No −0.0234 No −0.0062 No −0.0010 No 0.0138
297,455 No −0.1981 No −0.1566 No −0.0962 No −0.0671
344,041 No −0.1294 No −0.2479 No −0.1748 No −0.5257
346,977 No 0.0093 No −0.1832 No −0.0479 No −0.4195

MSL, microsatellite loci; NP, null present; Freq, null allele frequency.

3.3. Population structure using microsatellite loci

3.3.1. Pairwise F ST genetic distances

The population genetic structure of L. dispar in Far East Asia was calculated with F ST values. Pairwise F ST distances among regional populations ranged from −0.0087 to 0.1171 (Table 5: Lower side). Considering the genetic distances in each geographical region, the regional populations in Hokkaido (Sites 35–38), the species origin region, showed relatively low genetic distances (from −0.0055 to −0.0010); however, compared to other regional populations, their genetic distance was relatively high (0.0472 to 0.1171). A Mongolian regional population (Site 34), which was further from Hokkaido than other regional populations, showed relatively high genetic distances of 0.0464 to 0.1171 from other regional populations. A Vladivostok population (Site 33) was similar to a Korean inland population (Site 6) in population genetic structure (F ST = −0.00006), yet showed a high genetic distance of 0.1030 when compared to a Jeju regional population (Site 31). A Chinese regional population (Site 39) was more similar to a Korean inland population (Site 28) with a relatively large geographical distance (genetic distance: 0.0050 and geographic distance: 776.35 km) than to a Russian population (Site 33) with a relatively short distance (genetic distance: 0.0199 and geographic distance: 289.10 km). A Kyushu regional population (Site 41) with a small sample size had a genetic distance of 0.0307 to 0.0964 from other populations. Lastly, the Korean inland populations (Sites 1–30) ranged from −0.0087 to 0.0358 and were similar in genetic structure. In the analysis of isolation by distance, genetic distance increased with increasing geographic distance (Figure 3a, r = 0.7909, p = .0000).

Table 5.

Pairwise F ST distances among regional populations of Lymantria dispar in Far East Asia

RP Site 1 Site 6 Site 10 Site 12 Site 16 Site 18 Site 22 Site 26 Site 27 Site 28 Site 30 Site 31 Site 33 Site 34 Site 35 Site 36 Site 37 Site 38 Site 39 Site 41
Site 1 – −0.00406 −0.01463 0.00437 −0.01334 0.30988 0.26683 0.34350 0.36249 0.37666 0.42026 0.05208 −0.01758 0.01696 0.06167 0.03623 0.05189 0.05030 −0.01908 0.09112
Site 6 0.0082 – 0.02061 0.04141 0.01087 0.31302 0.27210 0.34671 0.36975 0.37793 0.42483 0.03678 −0.01293 −0.02022 0.01923 −0.00276 0.01680 0.01657 −0.03187 0.08292
Site 10 0.0041 0.0046 – −0.00547 −0.00048 0.27709 0.23826 0.31041 0.32849 0.34123 0.38091 0.06691 0.00744 0.04545 0.07984 0.06011 0.08359 0.08000 0.01072 0.05150
Site 12 0.0095 −0.0087 0.0047 – −0.01072 0.19614 0.16332 0.23044 0.24587 0.25756 0.28768 0.06457 0.02960 0.05829 0.09211 0.08333 0.10071 0.09608 0.02959 0.04092
Site 16 0.0215 0.0085 0.0249 0.0023 – 0.24157 0.20618 0.27773 0.29740 0.30568 0.34216 0.04450 0.00193 0.02222 0.06184 0.04432 0.05908 0.05632 −0.00227 0.05484
Site 18 0.0154 0.0044 0.0074 0.0048 0.0179 – −0.02895 −0.02244 0.00001 −0.02079 −0.01230 0.16783 0.34885 0.33869 0.32523 0.34119 0.37860 0.36973 0.33390 0.26957
Site 22 0.0211 0.0223 0.0096 0.0350 0.0427 0.0082 – −0.01622 0.00406 −0.01105 −0.00127 0.14439 0.29900 0.28227 0.28579 0.29604 0.32803 0.31966 0.27852 0.22710
Site 26 0.0067 0.0132 0.0076 0.0172 0.0302 0.0055 −0.0002 – −0.01407 −0.02450 −0.02393 0.20924 0.37848 0.35742 0.35378 0.36854 0.40218 0.39334 0.35680 0.28884
Site 27 0.0195 0.0167 0.0135 0.0278 0.0358 0.0116 −0.0082 −0.0041 – −0.00950 −0.01735 0.24545 0.39655 0.36943 0.37486 0.38864 0.41977 0.41071 0.36976 0.29797
Site 28 0.0024 −0.0061 0.0083 −0.0011 0.0167 0.0079 0.0233 0.0031 0.0136 – −0.02665 0.22708 0.41510 0.40396 0.38466 0.40379 0.44125 0.43236 0.40187 0.32700
Site 30 0.0153 −0.0029 0.0146 −0.0006 −0.0006 0.0004 0.0158 0.0130 0.0180 0.0034 – 0.26873 0.46777 0.46701 0.43298 0.45685 0.49709 0.48818 0.46079 0.37824
Site 31 0.0418 0.0463 0.0502 0.0470 0.0582 0.0280 0.0347 0.0359 0.0451 0.0542 0.0364 – 0.05305 0.01264 0.05657 0.03449 0.04812 0.04617 0.02447 0.05201
Site 33 0.0050 −0.0003 0.0069 0.0043 0.0248 0.0215 0.0383 0.0225 0.0346 0.0049 0.0110 0.0629 – 0.01113 0.06291 0.02699 0.04549 0.04535 −0.03346 0.13820
Site 34 0.0561 0.0607 0.0590 0.0794 0.0960 0.0709 0.0569 0.0651 0.0664 0.0676 0.0732 0.1030 0.0464 – 0.02929 −0.02552 0.00137 0.00592 −0.01196 0.15323
Site 35 0.0585 0.0738 0.0698 0.0616 0.0619 0.0554 0.0639 0.0582 0.0626 0.0676 0.0624 0.0748 0.0865 0.1141 – −0.00877 0.01998 0.01630 0.03854 0.05446
Site 36 0.0558 0.0659 0.0642 0.0594 0.0572 0.0472 0.0588 0.0568 0.0572 0.0591 0.0533 0.0652 0.0809 0.1171 −0.0012 – −0.01555 −0.01582 −0.00622 0.08947
Site 37 0.0510 0.0636 0.0643 0.0557 0.0560 0.0526 0.0617 0.0509 0.0568 0.0575 0.0588 0.0769 0.0784 0.1127 −0.0055 −0.0051 – −0.03829 0.01818 0.11981
Site 38 0.0655 0.0741 0.0779 0.0739 0.0662 0.0618 0.0654 0.0610 0.0627 0.0697 0.0676 0.0767 0.0931 0.1144 −0.0038 −0.0010 −0.0022 – 0.01992 0.10472
Site 39 0.0137 0.0178 0.0167 0.0237 0.0380 0.0302 0.0353 0.0345 0.0282 0.0050 0.0283 0.0890 0.0199 0.0766 0.0774 0.0713 0.0735 0.0863 – 0.13201
Site 41 0.0516 0.0448 0.0453 0.0380 0.0467 0.0398 0.0307 0.0359 0.0442 0.0555 0.0418 0.0501 0.0715 0.0964 0.0494 0.0550 0.0445 0.0513 0.0921 –

RP, regional population; lower side, microsatellite loci; upper side, mitochondrial genes.

Figure 3.

Figure 3

Isolation by distance for matrix correlation between genetic distance and geographic distance (a, microsatellite loci, r = 0.7909, p = .0000; b, mitochondrial genes, r = 0.5312, p = .0006)

3.3.2. NeighborNet network

In a NeighborNet network based on pairwise F ST genetic distances, the 20 regional populations could be divided into five groups: Group 1, Hokkaido (Sites 35, 36, 37, and 38); Group 2, Kyushu (Site 41); Group 3, Jeju Island (Site 31); Group 4, Korean Peninsula and adjacent areas (Sites 1, 6, 10, 12, 16, 18, 22, 26, 27, 28, 30, 33, and 39); and Group 5, Mongolia Selenge (Site 34) (Figure 4). Among these sites, Sites 28 and 30 from inland Korea were closest to each other in geographic distance; however, their genetic distance was similar to Site 1 (geographically close to Incheon Harbor) and Site 16 (geographically close to Uljin Harbor). These two regions are geographically close to Busan Harbor, which is a frequent entry port for vessels (Choi, 2014). We therefore suspect that these two regional populations may frequently interbreed with the regional populations near Incheon Harbor and Uljin Harbor.

Figure 4.

Figure 4

NeighborNet network using pairwise F ST distances from 20 regional populations of Lymantria dispar from Far East Asia

3.3.3. Bayesian clustering

For the model‐based Bayesian analysis, K was estimated by varying it from two to eight, and the ad hoc statistics ∆(K) (Evanno et al., 2005) indicate the maximum level of structure in three genetic groups (Figure 5). Lymantria dispar has been divided into two subspecies in Asia, L. dispar asiatica (or L. dispar dispar) and L. dispar japonica, based on mitochondrial DNA and microsatellite analysis (Bogdanowicz et al., 2000; Wu et al., 2015). Our study showed similar results; however, the Far East Asian gypsy moth populations were distinguishable as three types according to sampling region (Figure 6). Comparing the individual colored bar plots among the regional populations revealed that the frequency of the green‐colored genetic content was high in Hokkaido regional populations (the species origin region) (Figures 6q, r, s, and t), the frequency of the red genetic content was high in Jeju regional populations (Figure 6o), and the frequency of the blue genetic content was high in Mongolian regional populations (Figure 6a). The regional populations from the Korean Peninsula and adjacent areas showed a mixed pattern in comparison with the Jeju regional populations and Mongolian regional populations.

Figure 5.

Figure 5

The ad hoc statistics Δ(K) on the basis of LnP(D) estimated from 20 iterations for each K. The ad hoc statistics exhibited a signal of at best K = 3

Figure 6.

Figure 6

Bar plots estimated by STRUCTURE. The best K was estimated as three based on the ad hoc statistics Δ(K) (a, Site 34; b, Site 33; c, Site 39; d, Site 01; e, Site 10; f, Site 28; g, Site 30; h, Site 16; i, Site 12; j, Site 06; k, Site 18; l, Site 22; m, Site 27; n, Site 26; o, Site 31; p, Site 41; q, Site 38; r, Site 35; s, Site 37; t, Site 36)

Comparing the individual colored bar plots of each regional population, Sites 35, 36, 37, and 38 from Hokkaido were clearly distinct in genetic makeup from the regional populations of the Korean Peninsula and adjacent areas (Figure 6). Several individuals (Figure 6r: individual 346; Figure 6s: individual 375; and Figure 6t: individuals 406, 407, and 410) showed a genetic makeup similar to that of other regional populations; however, in the majority of individuals, the main genetic makeup was the green‐colored one. A genetic content frequency similar to that of the Hokkaido regional populations could be seen in Site 41 (Kyushu population), Site 27 (Hapcheon population), Site 12 (Cheongwon population), and Site 39 (Jilin population). Among them, the Kyushu regional population, with only seven individuals analyzed, was divided into two types: three individuals showed features similar to the Hokkaido regional populations, and four individuals showed features similar to the Jeju regional populations (Figure 6p).

The individual colored bar plots of the Korean inland populations show high frequencies of the blue or red genetic content in each individual. These two genetic content types showed similar frequencies in several individuals. This result may be caused by the higher genetic diversity in these populations than in other regions, and the gene flow among the Korean inland regions may be relatively higher than with other regions (Table 6, F ST = 0.04192). In the Chinese and Russian regional populations, however, the blue genetic content was higher than other genetic content types. Several individuals (Figure 6i: individual 173; Figure 6m: individuals 248 and 262; and Figure 6c: individuals 53 and 56) had features similar to those of the Hokkaido regional populations.

Table 6.

AMOVA for microsatellites and mitochondrial genes of Lymantria dispar from Far East Asia

Source of variation Sum of squares Variance components Percentage of variation F‐statistics p‐value
MS
Among local sites 158.192 0.12761 4.19163 F ST = 0.04192 .00000
Among individuals within local sites 1180.222 −0.02834 −0.93072 F IS = −0.00971 .85239
Within individuals 1262.500 2.94520 96.73909 F IT = 0.03261 .00000
MT
Among groups 177.317 0.57813 Va 48.28000 F CT = 0.48280 .00000
Among local sites within groups 12.714 0.00565 Vb 0.47000 F SC = 0.00913 .04790
Within local sites 282.283 0.61366 Vc 51.25000 F ST = 0.48753 .00000

MS, microsatellite loci; MT, mitochondrial genes.

3.4. Population structure using mitochondrial DNA

3.4.1. Mitochondrial DNA sequence variation

DNA barcodes of the COI, ATP6, and ATP8 genes were sequenced from 480 of 552 L. dispar asiatica samples collected from the 20 study sites (n = 6–30 per site). Mitochondrial DNA sequence divergences obtained from the 480 samples ranged from null to 0.5%, with 98 haplotypes distinguished by 85 polymorphic sites (Table S4). The mean gene diversity was 0.6529 ± 0.0929 (lowest value 0.1538 ± 0.1261 from Site 34 and highest value 0.9407 ± 0.0432 from Site 12), and the mean nucleotide diversity was 0.013798 ± 0.010223 (lowest value 0.001810 ± 0.003024 from Site 34 and highest value 0.027156 ± 0.017203 from Site 12) (Table S5).

3.4.2. Mitochondrial genealogy

In the median‐joining network, three high‐frequency haplotypes (H1, 151ex; H37, 75ex; and H90, 73ex) were connected to each other by low‐frequency haplotypes (Figure 7). This pattern was revealed in the pairwise F ST distances (Table 5: Upper side). We found that the 20 studied populations of L. dispar were divided into three groups according to genetic distance: Group 1, Korean inland region and adjacent areas (Sites 01, 06, 10, 12, 16, 31, 33, 34, 39, and 41); Group 2, Korean southern region (Sites 18, 22, 26, 27, 28, and 30); and Group 3, Hokkaido region (Sites 35, 36, 37, and 38) (Table S5, F CT = 0.48280, F ST = 0.48753). The results of the analysis of IBD were similar to the microsatellite results (Figure 3b, r = 0.5312, p = .0006). In particular, haplotype H90 appeared only in Hokkaido regional populations and was connected with haplotype H1 by haplotype H95, which is another Hokkaido haplotype (Figure 7). The Kyushu regional population (Site 41) contained five haplotypes, of which three haplotypes showed in the inland (H1, 2ex; H27, 1ex; and H82, 1ex), one in Hokkaido (H93, 1ex), and one in only Kyushu (H98, 1ex). One of the high‐frequency haplotypes, H1, was distributed in all the inland collecting regions and was detected in an individual from Site 38 in Hokkaido (Figure 7). Haplotype H1 was connected with Haplotype H37, a high‐frequency haplotype in the southern area of the Korean Peninsula, by low‐frequency haplotypes. Overall, the Far East Asian gypsy moth populations showed a star‐shaped network in which three high‐frequency haplotypes (H1, 151ex; H37, 75ex; and H90, 73ex) were connected with each other through low‐frequency haplotypes (Figure 7). Therefore, the Far East Asian gypsy moth populations may have undergone sudden population expansion.

Figure 7.

Figure 7

Median‐joining network using mitochondrial genes of Lymantria dispar from Far East Asia

3.4.3. Mitochondrial DNA haplotype mismatch distribution

The median‐joining network revealed a star‐shaped mtDNA genealogy, so we analyzed the mismatch distribution, applying a sudden population expansion model. We conducted the analysis using the three groups recognized above, and we found that the mismatch graphs of the groups were unimodal and the mismatch parameters were insignificant (Figure 8). In neutral equilibrium, Tajima's D and Fu's FS tests also had negative values in all three groups (Figure 8). We therefore consider that the mismatch analysis supports a sudden population expansion.

Figure 8.

Figure 8

The mismatch distributions of each group of Lymantria dispar from Far East Asia (a, Group 1; b, Group 2; c, Group 3)

The expansion time of each group was inferred using the observed value of the age expansion parameter (tau), the equation t = tau/2u (Roger & Harpending, 1992), and an insect mtDNA mutation rate of 2.3% per MY per lineage for silent sites (Brower, 1994). The tau of each group was 1.234 in Group 1, 1.496 in Group 2, and 1.750 in Group 3, and the expansion times were estimated to be 53,652 generations ago in Group 1, 65,043 in Group 2, and 76,086 in Group 3. Considering that L. dispar produces one generation per year (Pogue & Schaefer, 2007), the population expansion time of each group in Far East Asia was inferred to be approximately 53,652 years before present (ybp) in Group 1, 65,043 ybp in Group 2, and 76,086 ybp in Group 3.

4. DISCUSSION

The taxonomic status of the two subspecies of L. dispar in Far East Asia has been debated (Arimoto & Iwaizumi, 2014; Pogue & Schaefer, 2007; Schintlmeister, 2004). In a recent study using molecular data (Wu et al., 2015), L. dispar dispar (European subspecies) was clearly distinct from the Asian two subspecies; however, the Asian subspecies were difficult to distinguish from each other. The Japanese subspecies, L. dispar japonica, was genetically similar to the populations from the southern end of the Korean Peninsula, and the Korean populations had mixed genetic content (Wu et al., 2015). We examined the previous study's collecting sites and found they were mainly located near seaports. We therefore included inland populations in the present study (Figure 2).

In mitochondrial genealogy, we found that three lineages of L. dispar were distributed in Far East Asia: two in the Korean Peninsula and adjacent inland areas, and one in Hokkaido, Japan. Inferring the demographic history of each lineage through mismatch analysis, Group 1 expanded suddenly approximately 53,652 ybp, Group 2 approximately 65,043 ybp, and Group 3 approximately 76,086 ybp, all within the Würm glacial period (110,000–12,000 ybp) (Gao, Hou, & Guo, 2016).

The Würm glacial period can be divided into three glacial stages and two subinterglacial stages (Gao et al., 2016; Han & Meng, 1996; Ma, Yu, Wang, & Yao, 2006). The mean temperature during the period was approximately 5°C lower than at present, based on the snow‐line elevation on Mt. Fuji in Japan (Kim, 2011). In Europe, three ice sheets (Scandinavian, British, and Alpine) developed to cover a large part of the continent (Trojan, 1997). The advancing glacier forced the flora and fauna of the warm and temperate zones southward, and refugia were formed in the Mediterranean region (Trojan, 1997). In a great amount of Siberia, large ice masses eliminated all plants and animals; however, eastern regions (including Ussuri Land, Korea, Manchuria, and Japan) remained ice‐free as fauna‐ and flora‐preserving areas during the glaciation period (Trojan, 1997). During these periods, the flora of the southern part of Korea showed the features of a cool, temperate climate (Chung, Lee, Lim, & Kim, 2005). For example, Polypodiaceae, Alnus spp., Carpinus spp., and deciduous Quercus spp. were distributed in the area (Chung et al., 2005; Kim, 2011). Carpinus spp. and Quercus spp. are the food plants of L. dispar asiatica in Korea (Lee et al., 2002). During the last glacial maximum (approximately 20,000–18,000 ybp), however, Picea spp., Abies spp., Pinus spp., and Larix spp. were distributed in Far East Asia as it changed to a subarctic climate (Kim, 2011; Yoon & Hwang, 2009). The coastline during this period was quite different from the present. The west sea of the Korean Peninsula was a low hilly area because the sea level was approximately 30–130 m below present levels (Kim, 2011; Park & Cho, 1998; Park, Yoo, Lee, & Lee, 2000). The Japanese islands were connected with Sakhalin and the southeast part of the Korean Peninsula by a land bridge (Park et al., 2000; Trojan, 1997).

The sudden expansion of the Japanese Hokkaido lineage (Group 3) may have taken place in the middle of the Würm glacial stage I (approximately 76,086 ybp), a period with a cold and dry climate that might have led them to move to more southern regions. The southern lineage of the Korean Peninsula (Group 2) might have expanded during the late Würm glacial stage I (approximately 65,043 ybp). During this period, the gypsy moth populations might have dispersed into the southern part of the Korean Peninsula because of the cold climate. Lastly, Group 1 might have dispersed into the Vladivostok area, the middle region of Korea, and even Mongolia because the estimated expansion period is approximately 53,652 ybp, which is known as the subinterglacial stage I (60,000–50,000 ybp), a period with a hot and wet climate. We can thus infer that the gypsy moth populations dispersed from Far East Asia into middle Asia. In the Korean Peninsula, however, they may not have dispersed southward because the Noryeong and Charyeong Mountains were formed in the Miocene (Park & Son, 2008), and therefore, genetic interaction between Group 1 and Group 2 would not have been possible. In the model‐based Bayesian analysis using microsatellite loci, K (assumed as the number of populations) was calculated to be three, the same as the number of groups examined in the mitochondrial genealogy. The genetic diversity of the regional populations was higher in the Korean Peninsula than in other regions, with the Korean Peninsula populations showing the same mixed pattern reported previously (Wu et al., 2015). We suggest that this genetic pattern might have been caused by multiple sudden population expansions, and the demographic patterns caused by the Würm glacial period may have resulted in the present genetic diversity. In genetic makeup, however, the regional populations near the Busan seaport (Sites 27 and 28) were similar to the middle area of the Korean Peninsula. This might have been caused by vessels arriving in Korea and anchoring at the ports of Incheon or Busan (Choi, 2014; Kim, Kim, Kim, & Lee, 2008). We also looked for this genetic pattern in several samples from Russian and Japanese populations (Figures 6b, p, q, r, s, and t). Thus, we suggest that several individuals might have been introduced into each region via vessels arriving at seaports.

We can suggest that L. dispar in Far East Asia are divided into two types (the inland type and the Hokkaido type), although the analyzed samples did not cover the full distributional region of the species in Far East Asia. Taxonomically, 15 nomino‐subspecies have been assigned to L. dispar: L. dispar dispar Linnaeus, 1758 (type locality [TL]: Europe); L. dispar erebus Thierry Mieg, 1886 (TL: England, Us proviennent de Darlington); L. dispar asiatica Vnukovskij, 1926 (TL: Russia, Siberia meridionales, Altaij et Sajan occidentalies, Prov. Semipalatinsk); L. dispar praeterea Kardakoff, 1928 (TL: Russia, Ussuri‐Gebiet, “Russ. Insel und in Narwa”); L. dispar hokkaidoensis Goldschmidt, 1940 (TL: Japan, Hokkaido); L. dispar koreibia Bryk, 1948 (TL: Korea, Motojondo); L. dispar kolthoffi Bryk, 1948 (TL: China, Kiangsu [=Jiangxu]); L. dispar andalusica Reinig, 1938 (TL: Spain, Sierra de Alfacar); L. dispar mediterraneae Goldschmidt, 1940 (TL: Southern Europe); L. dispar bocharae Goldschmidt, 1940 (TL: Turkestan); L. dispar chosensis Goldschmidt, 1940 (TL: Korea); L. dispar japonica Motschulsky, [1861] (TL: Japan); L. dispar umbrosa Butler, 1881 (TL: Japan, Tokei, Yokohama, Hakodate); L. dispar hadina Butler, 1881 (TL: Honshu, Yokohama); L. dispar obscura Goldschmidt, 1940 (TL: Japan, Honshu); and L. dispar nesiobia Bryk, 1942 (TL: Japan, Kuril Island). Most of these nomino‐subspecies were synonymized and merged into two subspecies, L. dispar dispar and L. dispar japonica, by Schintlmeister (2004) from morphological analysis and consideration of the type locality of each subspecies. Recently, Pogue and Schaefer (2007) reinstated L. dispar asiatica and suggested a three subspecies system (L. dispar dispar, L. dispar asiatica, and L. dispar japonica). We partly agree with Schintlmeister's (2004) view that L. dispar asiatica is a synonym of L. dispar dispar because the type locality of L. dispar asiatica is close to Europe, which is the type locality of L. dispar dispar. However, we consider that thorough genetic analyses on regional populations have to be undertaken in other regions of Eurasia to characterize the lineages of gypsy moth across its native range. A taxonomic system of the subspecies of L. dispar could therefore be re‐established if each regional lineage revealed by genetic analysis is analyzed and compared with the topotypes collected from the type locality of each subspecies.

DATA ACCESSIBILITY

DNA sequences of 10 selected microsatellite loci are available in GenBank (KT633401–KT633410); DNA sequences of COI gene are available in GenBank (KT245170–KT246075; KX945391–KX945521); DNA sequences of ATP6/ATP8 gene are available in GenBank (KX945522–KX946001).

AUTHOR CONTRIBUTIONS

Tae Hwa Kang participated in the correction of the main idea of the study, coordinated the experiment, collected samples, participated in the analysis on the genetic diversity, and drafted the manuscript; Sang Hoon Han participated in the correction of the main idea of the study, coordinated the experiment, and participated in the analysis on the genetic diversity; Heung Sik Lee participated in the design of the main idea the study, collected samples, and managed funding.

Supporting information

 

 

 

 

 

ACKNOWLEDGMENTS

We thank Dr. B. Bayartogtokh (Ecology and Environmental Science, National University of Mongolia) for help with the collection of the Mongolian samples, Dr. J. Tchistyakov (Institute of Biology and Soil Science, Russia) for providing the Russian samples, and Dr. S. W. Park (Research Institute of Forest Insects Diversity, Suwon, Korea) for collecting and providing the Japanese samples. The present study is supported by R&D project “Development of determination method of the species and the origin of Asian Gypsy Moth intercepted in the port area (project number: B‐1541785‐2013‐15‐02)”.

Kang TH, Han SH, Lee HS. Genetic structure and demographic history of Lymantria dispar (Linnaeus, 1758) (Lepidoptera: Erebidae) in its area of origin and adjacent areas. Ecol Evol. 2017;7:9162–9178. https://doi.org/10.1002/ece3.3467

Tae Hwa Kang and Sang Hoon Han contributed equally to this work.

REFERENCES

  1. Arimoto, M. , & Iwaizumi, R. (2014). Identification of Japanese Lymantria species (Lepidoptera: Lymantriidae) based on morphological characteristics of adults. Research Bulletin of the Plant Protection Service Japan, 50, 89–110. [Google Scholar]
  2. Balloux, F. , & Lugon‐Moulin, N. (2002). The estimation of population differentiation with microsatellite markers. Molecular Ecology, 11, 155–165. [DOI] [PubMed] [Google Scholar]
  3. Bogdanowicz, S. M. , Mastro, V. C. , Prasher, D. C. , & Harrison, R. G. (1997). Microsatellite DNA variation among Asian and North American gypsy moths (Lepidoptera: Lymantridae). Systematics, 90, 768–775. [Google Scholar]
  4. Bogdanowicz, S. M. , Schaefer, P. W. , & Harrison, R. G. (2000). Mitochondrial DNA variation among worldwide populations of gypsy moths, Lymantria dispar . Molecular Phylogenetics and Evolution, 15, 487–495. [DOI] [PubMed] [Google Scholar]
  5. Brower, A. V. Z. (1994). Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proceedings of the National Academy of Sciences of the United States of America, 91, 6491–6495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bryk, F. (1942). Zur Kenntnis der Großschmetterlinge der Kurilen. Deutsche Entomologische Zeitschrift Iris, 56, 3–90. [Google Scholar]
  7. Bryk, F. (1948. [1949]). Zur Kenntnis der Großschmetterlinge von Korea. Arkiv för Zoologi, 41, 1–225. [Google Scholar]
  8. Butler, A. G. (1881). Descriptions of new genera and species of heterocerous Lepidoptera from Japan. Transactions of the Entomological Society of London, 1881, 1–23. [Google Scholar]
  9. Cameron, S. L. , & Whiting, M. F. (2008). The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene, 408, 112–123. [DOI] [PubMed] [Google Scholar]
  10. Choi, Y. (2014). Formation of ports and maritime networks in East Sea rim from the standpoint of port institution and strategy. Journal of the Institute for East Asian Studies, Sogang University, 66, 47–90. [in Korean]. [Google Scholar]
  11. Chung, C. H. , Lee, H. J. , Lim, H. S. , & Kim, C. B. (2005). Palynological study of the Late Quaternary sediments at Piseo‐ri, Muan, Korea. Journal of the Korean Earth Science Society, 26, 597–602. [in Korean]. [Google Scholar]
  12. Dakin, E. E. , & Avise, J. C. (2004). Microsatellite null alleles in parentage analysis. Heredity, 93, 504–509. [DOI] [PubMed] [Google Scholar]
  13. Damm, D. L. , Armstrong, J. B. , Arjo, W. M. , & Piaggio, A. J. (2015). Assessment of population structure of coyotes in east‐central Alabama using microsatellite DNA. Southeastern Naturalist, 14, 106–122. [Google Scholar]
  14. deWaard, J. R. , Mitchell, A. , Keena, M. A. , Gopurenko, D. , Boykin, L. M. , Armstrong, K. F. , … Humble, L. M. (2010). Towards a global barcode library for Lymantria (Lepidoptera: Lymantriinae) tussock moths of biosecurity concern. PLoS One, 5, e14280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Earl, D. A. , & von Holdt, B. M. (2012). STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetic Resources, 4, 359–361. [Google Scholar]
  16. Evanno, G. , Regnaut, S. , & Goudet, J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Molecular Ecology, 14, 2611–2620. [DOI] [PubMed] [Google Scholar]
  17. Excoffier, L. , Laval, G. , & Schneider, S. (2005). Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50. [PMC free article] [PubMed] [Google Scholar]
  18. Falush, D. , Stephens, M. , & Pritchard, J. K. (2003). Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics, 164, 1567–1587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Folmer, O. , Black, M. , Hoeh, W. , Lutz, R. , & Vrijenhock, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299. [PubMed] [Google Scholar]
  20. Fu, Y. X. (1997). Statistical test of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gao, M. , Hou, G. , & Guo, F. (2016). Conceptual model of underground brine formation in the silty coast of Laizhou Bay, Bohai Sea, China. Journal of Coastal Research, 74, 157–165. [Google Scholar]
  22. George, C. (1984). Allozyme variation in natural populations of Lymantria dispar (Lepidoptera). Genetics Selection Evolution, 16, 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Goldschmidt, R. (1934). Lymantria. Bibliographia Genetica, 11, 1–185. [Google Scholar]
  24. Goldschmidt, R. (1940). The material basis of evolution. New Haven, CT: Yale University Press. [Google Scholar]
  25. Hajibabaei, M. , Singer, G. A. C. , Hebert, P. D. N. , & Hickey, D. A. (2007). DNA barcoding: How it complements taxonomy, molecular phylogenetics and population genetics. TRENDS in Genetics, 23, 167–172. https://doi.org/10.1916/j.tig.2007.02.001 [DOI] [PubMed] [Google Scholar]
  26. Han, Y. S. , & Meng, G. L. (1996). Quaternary underground brine in the coastal areas of Northern China. Beijing: Science Press. [Google Scholar]
  27. Harpending, H. (1994). Signature of ancient population growth in a low resolution mitochondrial DNA mismatch distribution. Human Biology, 66, 591–600. [PubMed] [Google Scholar]
  28. Hebert, P. D. N. , Cywinska, A. , Ball, S. L. , & deWaard, J. R. (2003). Biological identification through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270, 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hess, J. E. , Swalla, B. J. , & Moran, P. (2008). New molecular markers to genetically differentiate populations of Didemnum vexilluman (Kott, 2002)—An invasive ascidian species. Aquatic Invasions, 4, 299–310. [Google Scholar]
  30. Higashiura, Y. , Yamaguchi, H. , Ishihara, M. , Ono, N. , Tsukagoshi, H. , Yokobori, S. , … Fukatsu, T. (2011). Male death resulting from hybridization between subspecies of the gypsy moth, Lymantria dispar . Heredity, 106, 603–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Hunter, M. E. , & Hart, K. M. (2013). Rapid microsatellite marker development using next generation pyrosequencing to inform invasive Burmese Python—Python molurus bivittatus—management. International Journal of Molecular Sciences, 14, 4793–4804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Huson, D. H. , & Bryant, D. (2006). Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution, 23, 254–267. [DOI] [PubMed] [Google Scholar]
  33. Inoue, H. (1982). Lymantriidae In Inoue H., Sugi S., Kuroko H., Moriuti S. & Kawabe A. (Eds.), Moths of Japan, Vol. 1, Text (pp. 628–638). Tokyo: Kodansha. [Google Scholar]
  34. Jensen, J. L. , Bohonak, A. J. , & Kelley, S. T. (2005). Isolation by distance, web service. BMC Genetics, 6, 13 IBD ver. 3.23 http://ibdws.sdsu.edu/ [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kang, T. H. , Han, S. H. , & Park, S. J. (2015). Development of seven microsatellite markers using next generation sequencing for the conservation on the Korean population of Dorcus hopei (E. Saunders, 1854) (Coleoptera, Lucanidae). International Journal of Molecular Sciences, 16, 21330–21341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kang, T. H. , Han, S. H. , & Park, S. J. (2016). Development of 12 microsatellite markers in Dorcus titanus castanicolor (Motschulsky, 1861) (Lucanidae, Coleoptera) from Korea using next‐generation sequencing. International Journal of Molecular Sciences, 17, 1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kang, T. H. , Lee, K. S. , & Lee, H. S. (2015). DNA Barcoding of the Korean Lymantria Hübner, 1819 (Lepidoptera: Erebidae: Lymantriinae) for quarantine inspection. Journal of Economic Entomology, 108, 1596–1611. [DOI] [PubMed] [Google Scholar]
  38. Kardakoff, N. (1928). Zur Kenntnis der Lepidopteren des Ussuri‐Gebietcs. Entomologische Mitteilungen, 17, 414–425. [Google Scholar]
  39. Keena, M. A. , Cȏté, M. J. , Grinberg, P. S. , & Wallner, W. E. (2008). World distribution of female flight and genetic variation in Lymantria dispar (Lepidoptera: Lymantriidae). Environmental Entomology, 37, 636–649. [DOI] [PubMed] [Google Scholar]
  40. Kim, J. B. (2011). Natural environment of East Asia, History of East Asia I (Natural Environment–International Relationship) (pp. 11–91). Seoul: Northeast Asian History Foundation; [in Korean]. [Google Scholar]
  41. Kim, S. H. , Kim, N. C. , Kim, H. C. , & Lee, S. H. (2008). A study on development of coastal transportation system between Mokpo and Jeju based on marine logistics analysis results. Journal of the Korean Society of Marine Environment and Safety, 14, 235–240. [in Korean]. [Google Scholar]
  42. Kim, H. , Kim, M. , Kwon, D. H. , Park, S. , Lee, Y. , Jang, H. , … Jang, Y. (2011). Development and characterization of 15 microsatellite loci from Lycorma delicatula (Hemiptera: Fulgoridae). Animal Cells and Systems, 15, 295–300. [Google Scholar]
  43. King, T. L. , Eackles, M. S. , & Chapman, D. C. (2011). Tools for assessing kinship, population structure, phylogeography, and interspecific hybridization in Asian carps invasive to the Mississippi River, USA: Isolation and characterization of novel tetranucleotide microsatellite DNA loci in silver carp Hypophthalmichthys molitrix . Conservation Genetic Resources, 3, 397–401. [Google Scholar]
  44. Koressaar, T. , & Remm, M. (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics, 23, 1289–1291. [DOI] [PubMed] [Google Scholar]
  45. Koshio, C. , Tomishima, M. , Shimizu, K. , Kim, H. , & Takenaka, O. (2002). Microsatellites in the gypsy moth, Lymantria dispar L. (Lepidoptera: Lymantriidae). Applied Entomology and Zoology, 37, 309–312. [Google Scholar]
  46. Lee, K. S. , Kang, T. H. , Jeong, J. W. , Ryu, D. P. , & Lee, H. S. (2015). Taxonomic review of the genus Lymantria (Lepidoptera: Erebidae: Lymantriinae) in Korea. Entomological Research, 45, 225–234. [Google Scholar]
  47. Lee, J. H. , Lee, H. P. , Schaefer, P. W. , Fuester, R. W. , Park, J. D. , Lee, B. Y. , & Shin, C. H. (2002). Gypsy moth parasitoid complex at Mt. Halla National Park, Cheju Island, Korea. Entomological News, 113, 103–112. [Google Scholar]
  48. Leese, F. , Mayer, C. , & Held, C. (2008). Isolation of microsatellites from unknown genomes using known genomes as enrichment templates. Limnology and Oceanography: Methods, 7, 412–426. [Google Scholar]
  49. Librado, P. , & Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. [DOI] [PubMed] [Google Scholar]
  50. Liebhold, A. , Mastro, V. , & Schaefer, P. W. (1989). Learning from the legacy of Léopold Trouvelot. Bulletin of the Entomological Society of America, 35, 20–22. [Google Scholar]
  51. Linnaeus, C. (1758). Systema Naturae per Regna Tria Naturae, Secundum Classes, Ordines, Genrea, Species, cum Characteribus, Differentiis, Synonymis, Locis. Tomis I (10th edn). Homiae: Laurentii Slavii. [Google Scholar]
  52. Liu, K. , & Muse, S. V. (2005). PowerMarker: Integrated analysis environment for genetic marker data. Bioinformatics, 21, 2128–2129. [DOI] [PubMed] [Google Scholar]
  53. López‐Uribe, M. M. , Santiago, C. K. , Bogdanowicz, S. M. , & Danforth, B. N. (2012). Discovery and characterization of microsatellites for the solitary bee Colletes inaequalis using Sanger and 454 pyrosequencing. Apidologie, 44, 163–172. [Google Scholar]
  54. Lowe, S. , Browne, M. , Boudjelas, S. , & De Poorter, M. (2000). 100 of the world's worst invasive alien species: a selection from the Global Invasive Species Database. Invasive Species Specialist Group (ISSG), Species Survival Commission (SSC), World Conservation Union (IUCN), Gland, Switzerland.
  55. Ma, L. , Yu, H. J. , Wang, S. K. , & Yao, J. (2006). Late quaternary environmental evolution in the Bohai Sea and formation of quaternary subsurface brine. Coastal Engineering, 25, 1–6. [in Chinese]. [Google Scholar]
  56. Mayer, C. , Leese, F. , & Tollrian, R. (2010). Genome‐wide analysis of tandem repeats in Daphnia pulex – a comparative approach. BMC Genomics, 11, 277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Mieg, T. H. (1886). Lépidopéres Européens. Le Naturaliste, Paris, 8, 236–237. [Google Scholar]
  58. Oosterhout, C. V. , Hutchinson, W. F. , Wills, D. P. M. , & Shipley, P. (2004). MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4, 535–538. [Google Scholar]
  59. Park, Y. A. , & Cho, S. K. (1998). Marine geology In The Geological Society of Korea (Ed.), Geology of Korea (pp. 621–696). Seoul: Sigma Press; [in Korean]. [Google Scholar]
  60. Park, S. J. , & Son, I. (2008). Discussions on distribution and genesis of mountain ranges in the Korean Peninsula (III): Proposing a new mountain range map. Journal of the Geological Society of Korea, 43, 276–295. [in Korean]. [Google Scholar]
  61. Park, S. C. , Yoo, D. G. , Lee, C. W. , & Lee, E. I. (2000). Last glacial sea‐level changes and paleogeography of the Korea (Tsushima) Strait. Geo‐Marine Letters, 20, 64–71. [Google Scholar]
  62. Perry, J. C. , & Rowe, L. (2011). Rapid microsatellite development for water striders by next‐generation sequencing. Journal of Heredity, 102, 125–129. [DOI] [PubMed] [Google Scholar]
  63. Pimentel, D. , Zuniga, R. , & Morrison, D. (2005). Update of the environmental and economic costs associated with alien‐invasive species in the United States. Ecological Economics, 52, 273–288. [Google Scholar]
  64. Pogue, M. G. , & Schaefer, P. W. (2007). A review of selected species of Lymantria Hübner [1819] including three new species (Lepidoptera: Noctuidae: Lymantriinae). Washington, DC: US Department of Agriculture Forest Health Technology Enterprise Team. [Google Scholar]
  65. Pritchard, J. K. , Stephens, M. , & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155, 945–959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Qian, L. , An, Y. , Song, J. , Xu, J. , Ye, J. , Wu, C. , … Hao, D. (2014). COI gene geographic variation of gypsy moth (Lepidoptera: Lymantriidae) and a TaqMan PCR diagnostic assay. DNA Barcodes, 2, 10–16. [Google Scholar]
  67. Reinig, W. F. (1938). Elimination und selektion. Jena: Gustav Fischer. [Google Scholar]
  68. Rice, W. R. (1989). Analyzing tables of statistical tests. Evolution, 43, 223–225. [DOI] [PubMed] [Google Scholar]
  69. Richardson, M. F. , Stanley, A. M. , & Sherman, C. D. H. (2012). Development of novel microsatellite markers for the invasive Northern Pacific seastar, Asterias amurensis . Conservation Genetic Resources, 4, 327–330. [Google Scholar]
  70. Roger, A. R. , & Harpending, H. (1992). Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9, 552–569. [DOI] [PubMed] [Google Scholar]
  71. Sakai, A. K. , Allendorf, F. W. , Holt, J. S. , Lodge, D. M. , Molofsky, J. , With, K. A. , … Weller, S. G. (2001). The population biology of invasive species. Annual Review of Ecology and Systematics, 32, 305–332. [Google Scholar]
  72. Santana, Q. C. , Coetzee, M. P. A. , Steenkamp, E. T. , Mlonyeni, O. X. , Hammond, G. N. A. , Wingfield, M. J. , & Wingfield, B. D. (2009). Microsatellite discovery by deep sequencing of enriched genomic libraries. BioTechniques, 46, 217–223. [DOI] [PubMed] [Google Scholar]
  73. Schintlmeister, A. (2004). The taxonomy of the genus Lymantria Hübner, [1819] (Lepidoptera: Lymantriidae). Quadrifina, 7, 1–248. [Google Scholar]
  74. Schuelke, M. (2000). An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology, 18, 233–234. [DOI] [PubMed] [Google Scholar]
  75. Selkoe, K. A. , & Toonen, R. J. (2006). Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters, 9, 615–629. [DOI] [PubMed] [Google Scholar]
  76. Sunnucks, P. (2000). Efficient genetic markers for population biology. Trends Ecology and Evolution, 15, 199–203. [DOI] [PubMed] [Google Scholar]
  77. Tajima, F. (1989). Statistical methods for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Tamura, K. , Stecher, G. , Peterson, D. , Filipski, A. , & Kumar, S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30, 2725–2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Tóth, G. , Gáspári, Z. , & Jurka, J. (2000). Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Research, 10, 967–981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Trojan, P. (1997). The floristic and faunistic Korean refugium during the last glacial period and its significance in postglacial biota formation. Fragmenta Faunistica, 40, 215–221. [Google Scholar]
  81. Untergrasser, A. , Cutcutache, I. , Koressaar, T. , Ye, J. , Faircloth, B. C. , Remm, M. , & Rozen, S. G. (2012). Primer3−new capabilities and interfaces. Nucleic Acids Research, 40, e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Vnukovskij, V. (1926). Nouvelles forms de Lymantria dispar L. de la Sibérie et de semiretshje. Revue Russe d'Entomologie, 20, 78–81. [Google Scholar]
  83. Wu, Y. , Molongoski, J. J. , Winograd, D. F. , Bogdanowicz, S. M. , Louyakis, A. S. , Lance, D. R. , … Harrison, R. G. (2015). Genetic structure, admixture and invasion success in a Holarctic defoliator, the gypsy moth (Lymantria dispar, Lepidoptera: Erebidae). Molecular Ecology, 24, 1275–1291. [DOI] [PubMed] [Google Scholar]
  84. Yoon, S. O. , & Hwang, S. (2009). The reconstruction of natural environment for the last glacial maximum around Korea and adjacent areas. Journal of the Korean Geomorphological Association, 16, 101–112. [in Korean]. [Google Scholar]
  85. Yu, J. N. , Won, C. , Jun, J. , Lim, Y. W. , & Kwak, M. (2011). Fast and cost‐effective mining of microsatellite markers using NGS Technology: An example of a Korean water deer Hydropotes inermis argyropus . PLoS One, 6, e26933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Zane, L. , Bargelloni, L. , & Patarnello, T. (2002). Strategies for microsatellite isolation: A review. Molecular Ecology, 11, 1–16. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

 

 

 

 

Data Availability Statement

DNA sequences of 10 selected microsatellite loci are available in GenBank (KT633401–KT633410); DNA sequences of COI gene are available in GenBank (KT245170–KT246075; KX945391–KX945521); DNA sequences of ATP6/ATP8 gene are available in GenBank (KX945522–KX946001).


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES