Skip to main content
BMJ Open Access logoLink to BMJ Open Access
. 2017 Sep 18;67(10):1793–1804. doi: 10.1136/gutjnl-2017-313863

Pan-genomic analyses identify key Helicobacter pylori pathogenic loci modified by carcinogenic host microenvironments

Jennifer M Noto 1, Abha Chopra 2, John T Loh 3, Judith Romero-Gallo 1, M Blanca Piazuelo 1, Mark Watson 2, Shay Leary 2, Amber C Beckett 3, Keith T Wilson 1,3,4,5, Timothy L Cover 3,4,6, Simon Mallal 2,6, Dawn A Israel 1, Richard M Peek 1,3,5
PMCID: PMC5857411  NIHMSID: NIHMS907832  PMID: 28924022

Abstract

Objective

Helicobacter pylori is the strongest risk factor for gastric cancer; however, the majority of infected individuals do not develop disease. Pathological outcomes are mediated by complex interactions among bacterial, host and environmental constituents, and two dietary factors linked with gastric cancer risk are iron deficiency and high salt. We hypothesised that prolonged adaptation of H. pylori to in vivo carcinogenic microenvironments results in genetic modification important for disease.

Design

Whole genome sequencing of genetically related H. pylori strains that differ in virulence and targeted H. pylori sequencing following prolonged exposure of bacteria to in vitro carcinogenic conditions were performed.

Results

A total of 180 unique single nucleotide polymorphisms (SNPs) were identified among the collective genomes when compared with a reference H. pylori genome. Importantly, common SNPs were identified in isolates harvested from iron-depleted and high salt carcinogenic microenvironments, including an SNP within fur (FurR88H). To investigate the direct role of low iron and/or high salt, H. pylori was continuously cultured in vitro under low iron or high salt conditions to assess fur genetic variation. Exposure to low iron or high salt selected for the FurR88H variant after only 5 days. To extend these results, fur was sequenced in 339 clinical H. pylori strains. Among the isolates examined, 17% (40/232) of strains isolated from patients with premalignant lesions harboured the FurR88H variant, compared with only 6% (6/107) of strains from patients with non-atrophic gastritis alone (p=0.0034).

Conclusion

These results indicate that specific genetic variation arises within H. pylori strains during in vivo adaptation to conditions conducive for gastric carcinogenesis.

Keywords: Helicobacter pylori, gastric cancer, iron deficiency, high salt


Significance of this study.

What is already known on this subject?

  • Helicobacterpylori strains exhibit remarkable genetic diversity as a species and have a panmictic population structure, reflecting a high level of genetic exchange among strains.

  • H. pylori is the strongest known risk factor for the development of gastric adenocarcinoma; however, the majority of H. pylori-infected individuals do not develop disease.

  • Two environmental factors associated with increased gastric cancer risk are high dietary salt intake and iron deficiency. Both high salt and low iron significantly augment the severity of H. pylori-induced gastric inflammation and the development of premalignant and malignant lesions in rodent models of gastric cancer.

What are the new findings?

  • Whole genome sequencing of H. pylori strains B128 and 7.13 and in vivo-adapted 7.13 output isolates harvested from animals maintained on iron-replete, iron-depleted, regular salt or high salt diets identified a small number of common polymorphisms that occurred within the context of iron deficiency and high salt intake.

  • Specific cancer-related genetic loci were identified when in vivo-adapted carcinogenic H. pylori strain 7.13 was compared with its progenitor human H. pylori isolate B128, which does not cause cancer.

  • Environmental-specific genetic loci were identified among H. pylori strains isolated from carcinogenic, iron-deficient or high salt, microenvironments.

  • A single nucleotide polymorphism in fur was selected for by exposure to low iron or high salt conditions and was more frequently identified in clinical H. pylori strains from patients with premalignant lesions.

How might it impact clinical practice in the foreseeable future?

  • Key H. pylori genetic loci that are susceptible to genetic alteration under in vivo environmental stress may serve as genetic biomarkers for H. pylori virulence potential and gastric cancer risk.

Introduction

Helicobacter pylori persistently colonises the gastric mucosa of more than 50% of the world’s population. H. pylori strains harbour remarkable genetic diversity as a species, as evidenced by variation of gene order and genetic content, the mosaic structure of genes and sequence diversity within conserved genes.1–3 H. pylori exhibits a panmictic population structure, reflecting a high level of genetic exchange among strains,4 5 and recombination between strains can occur in vivo during naturally occurring mixed infections.3 Analyses of complete genomic sequences from a number of isolates indicate that H. pylori has incorporated genetic material from other organisms,4 5 and that variation occurs among single colony isolates of distinct H. pylori from an individual host.6 7

In addition to being one of the most common bacterial infections worldwide, H. pylori is the strongest known risk factor for the development of gastric adenocarcinoma, and pathological outcomes are mediated by complex interactions among bacterial virulence determinants, host constituents and environmental factors. One H. pylori virulence determinant that increases gastric cancer risk is the cag pathogenicity island. H. pylori strains that harbour the cag island induce more severe gastric injury and further augment the risk for gastric cancer compared with cag-negative strains. The cag island encodes a bacterial type IV secretion system, which translocates the oncoprotein CagA into host cells to induce cellular morphological changes, proliferation and migration.2 8

Two environmental factors associated with increased gastric carcinogenesis are high dietary salt intake and iron deficiency.9 Epidemiological studies have demonstrated a link between salt intake and increased gastric cancer risk,10 11 and high salt diets accelerate the development of gastric cancer in animal models of infection.12–14 Similarly, epidemiological studies have supported the concept that iron deficiency contributes to the risk of gastric cancer,15 16 and a recent study from our group demonstrated that iron depletion significantly increased the development of gastric adenocarcinoma in H. pylori-infected gerbils.17 Therefore, both high salt and low iron augment the severity of H. pylori-induced gastric inflammation and the development of premalignant and malignant lesions in rodent models of gastric cancer.

Several studies have investigated specific mechanisms through which iron deficiency or high salt may modify H. pylori and enhance the risk for gastric cancer. Iron deficiency and high salt-dependent alterations of H. pylori per se include alterations in bacterial cell morphology, gene regulation and protein expression.17–26 Specifically, CagA expression and translocation into gastric epithelial cells are increased in response to both high salt and low iron conditions, and, under iron restriction, function of the cag type IV secretion system is enhanced.17 22 24 All of these modifications likely contribute to the increased risk of H. pylori-induced gastric cancer associated with these dietary alterations.14 17 22 24 26

In this study, we tested the hypothesis that prolonged adaptation of H. pylori to an in vivo carcinogenic gastric microenvironment induced by iron deficiency or high salt would select for genetic variants important for pathogenesis. We previously identified a strain of H. pylori, 7.13, that reproducibly induces gastric cancer in rodent models of gastritis. This strain was derived via in vivo adaptation of a human clinical H. pylori strain, B128, which induces inflammation, but not cancer, in rodent gastric mucosa. Thus, H. pylori strains B128 and 7.13 are closely related genetically, but differ in oncogenic potential.27 Whole genome sequence analyses were performed on H. pylori strains B128 and 7.13, and in vivo-adapted 7.13 output isolates exposed to iron-replete or iron-depleted conditions and indicate that targeted genetic variation in H. pylori arises during in vivo adaptation to conditions conducive for the development of gastric cancer.

Results

H. pylori genetic alterations during in vivo adaptation

We initially conducted whole genome sequence analyses of human progenitor H. pylori strain B128 and its in vivo gerbil-adapted carcinogenic derivative strain 7.13. Sequences were assembled using the genome sequence of H. pylori strain B8, a closely related strain for which its complete genome sequence is available, as the reference strain.28 In addition to these strains, we also performed whole genome sequence analysis using in vivo gerbil-adapted H. pylori isolates exposed to iron-replete or iron-depleted conditions. Three single colony isolates from H. pylori strains B128 and 7.13 and three single colonies from 7.13-infected gerbils maintained on either iron-replete (n=3) or iron-depleted (n=3) diets were used for whole genome sequence analysis (figure 1). In vivo-adapted strains from iron-replete and iron-depleted conditions were also compared with in vivo-adapted strains isolated from regular salt or high salt conditions14 (figure 1).

Figure 1.

Figure 1

Experimental design. Helicobacter pylori strain B128 was originally isolated from a human patient.54 Strain B128 (green) was used for orogastric challenge of Mongolian gerbils and was passaged three times through gerbils in a previous study.28 The in vivo-adapted output strain, designated H. pylori strain B8 (orange), was isolated from those gerbils, sequenced and used as the reference strain in this study.19 In an independent experiment, strain B128 (green) was also used for orogastric challenge of a single Mongolian gerbil, and the in vivo-adapted output strain isolated from this gerbil was designated H. pylori strain 7.13 (orange).27 Carcinogenic H. pylori strain 7.13 was then used to infect another cohort of Mongolian gerbils maintained on either iron-replete or iron-depleted diets.17 Single colonies (n=3) from three independent gerbils maintained on iron-replete diet (n=9) and three independent gerbils maintained on iron-depleted diet (n=9) were subjected to whole genome sequence analysis. In vivo-adapted strain from iron-replete (red) and iron-depleted (blue) conditions was also compared with previously described H. pylori single colonies (n=4) harvested from one gerbil maintained on a regular salt (pink) or high salt (light blue) diet.21

Whole genome sequence analysis

The total length of the H. pylori reference strain B8 genome (1673 997 bp) was completely covered, and the guanine-cytosine content was 38.8% for all sequenced strains. Overall sequence read count, average sequence read length, coverage and unmapped reads for H. pylori sequences are shown in online supplementary table S1. On average, the total read count was 645 132 bp, the mean read length was 263 bp, the fold coverage was 102 and the percentage of unmapped reads was 6.6% for all H. pylori strains analysed in this study.

Supplementary file 1

gutjnl-2017-313863supp001.pdf (1.2MB, pdf)

Phylogenetic analysis confirmed that human H. pylori B128 isolates are more closely related to each other than to H. pylori strains adapted to gerbil stomachs (figure 2A). Consistent with in vivo adaptation within the same host, the reference H. pylori strain B8, which is also gerbil adapted, is more closely related to the gerbil-adapted strain 7.13 than to its parental human-adapted strain B128 (figure 2A). Furthermore, H. pylori strains isolated from gerbils under iron-replete conditions are more closely related to each other than to strains isolated from gerbils maintained on iron-depleted diets (figure 2A). These findings demonstrate that in vivo adaptations to different hosts (human vs gerbil) and to different environmental conditions (iron-replete vs iron-depleted) induce H. pylori genetic changes.

Figure 2.

Figure 2

(A) Phylogenetic analyses of whole genome sequences from Helicobacter pylori strains B128 (green) and 7.13 (orange), and in vivo-adapted iron-replete (red) and iron-depleted (blue) strains. R1-3 and D1-3 designate independent gerbils maintained on either iron-replete (n=3) or iron-depleted (n=3), respectively, while a–c designate different single colonies isolated from each gerbil. H. pylori strains isolated from humans or gerbils are grouped within the grey boxes, respectively. The scale bar represents amino acid changes per site. (B) Venn diagram20 showing the number of common and unique single nucleotide polymorphisms (SNPs) among human-adapted H. pylori strains B128 (green) and 7.13 (orange), and in vivo-adapted H. pylori strains isolated from gerbils maintained on iron-replete (red) and iron-depleted (blue) diets, all relative to the reference H. pylori strain B8. The number in the parentheses indicates the total number of unique SNPs identified in each strain and present exclusively in that strain, but not any other strain.

The number of unique single nucleotide polymorphisms (SNPs) among all sequenced H. pylori strains, relative to H. pylori reference strain B8, is shown in figure 2B.29 The human-adapted strain B128 had 26 unique SNPs (ie, SNPs present exclusively in strain B128, but not in any other strain) (figure 2B, online supplementary table S2). The gerbil-adapted strain 7.13 only had two unique SNPs (figure 2B, online supplementary table S2), highlighting the similarity among strains adapted to the gerbil host. However, subsequent H. pylori adaptation to iron-replete (29 SNPs) or iron-depleted (49 SNPs) conditions resulted in the greatest number of unique SNPs (figure 2B, online supplementary table S2), reinforcing the importance of genetic adaptation to different environmental conditions.

When all of the sequences were analysed, a total of 180 genetic loci with single and multinucleotide polymorphisms were identified, including 33 within intergenic regions and 147 within coding regions (online supplementary table S3). When each single colony was analysed individually for total polymorphisms, there was variation among the single colonies (online supplementary tables S4 and S5). The H. pylori human isolate B128 had, on average, 98 polymorphisms, 12 insertions and 10 deletions. Of the polymorphisms within coding regions of strain B128, 67% resulted in a non-synonymous change (online supplementary table S4). Among the three single colonies, gerbil-adapted H. pylori strain 7.13 contained, on average, 47 polymorphisms, nine insertions and three deletions. Of the SNPs within coding regions of strain 7.13, 65% resulted in a non-synonymous change (online supplementary table S4). Similarly, among the nine single colonies harvested from three gerbils maintained on iron-depleted diets, there were, on average, 52 polymorphisms, 12 insertions and five deletions, while in vivo-adapted strains isolated from gerbils maintained on iron-replete diets had, on average, 43 polymorphisms, 11 insertions and three deletions. Of the SNPs within coding regions of the iron-depleted and iron-replete strains, 54% and 52% resulted in a non-synonymous change, respectively (online supplementary table S5). Based on the number of variants identified, most of the genetic variation arose through in vivo adaptation to a new gerbil host. However, all H. pylori isolates were found to be unique, including isolates from a single host.

Many of the genetic alterations resulting in deletions or insertions occurred within genetic loci important for H. pylori pathogenesis, including polymorphisms within loci regulating chemotaxis (cheA), adhesion (hopZ, oipA, sabA), survival (katA), iron acquisition or active transport (tonB) and cag type IV secretion system function (cagY) (table 1).

Table 1.

Deletions and insertions in Helicobacter pylori strains B128 and 7.13, and in vivo-adapted strains isolated from gerbils maintained on iron-depleted or iron-replete diets

Deletions B128 single colonies 7.13 single colonies 7.13 iron-depleted single colonies 7.13 iron-replete single colonies
Location Gene HPB8 locus a b c a b c D1 a D1 b D1
C
D2 a D2 b D2 c D3 a D3 b D3 c R1 a R1 b R1 c R2 a R2 b R2 c R3 a R3 b R3 c
 88333 Intergenic 43 26 26 29 31 29 26 31 33 39
 132884 tonB1 138 27* 44.3–
46.2
 132889 tonB1 138 27.1–
27.5
 132892 tonB1 138 26
 132907 tonB1 138 27*
 132926 tonB1 138 85 90 79.7–
81.4
80.6–
81.6
77 92 75 76
 365607 Intergenic 94
 378215 galE 409 96*
 410076 cheA 442 61.0–
74.5*
 410076 cheA 442 63.8–
71.3
 410080 cheA 442 63*
 693451 cagY 716 100 100
 693465 cagY 716 30* 36* 56*
 819621 oipA 838 93*
 919030 sabA 930 92* 91* 87* 81* 88*
 1065100 Intergenic 25 44
 1098589 hsdR5 1120 96*
 1171489 1200 99* 97*
 1197192 Intergenic 26
 1316726 radA 1343 32* 31* 38* 29* 29* 32* 26* 36* 28* 32* 26* 28* 38*
 1445365 hrgA 1474 78
 1492146 Intergenic 28 43
 1533081 1561 38* 36* 42*
 1533085 1561 38 36 42
 1533088 1561 38* 36* 42*
 1539253 Intergenic 98
 1584758 hopZ 1616 91* 91* 90* 81* 90* 89* 90* 86* 89* 90* 87* 86* 88* 89*
 1584759 hopZ 1616 94* 100* 93* 89* 97* 90* 91* 88* 93*
 1585383 hopZ 1616 92 89 90
 1621918 1665 88.2-
94.4
89.9–
97.5
94.1–
99.0
 1621918 1665 98* 96* 97* 98* 98* 97* 99* 94* 96* 98* 99* 98* 97* 99* 99* 98*
 1621919 1665 97* 100* 99* 99*
Insertions B128 single colonies 7.13 single colonies 7.13 iron-depleted single colonies 7.13 iron-replete single colonies
Location Gene HPB8 locus a b c a b c D1 a D1 b D1
C
D2 a D2 b D2 c D3 a D3 b D3 c R1 a R1 b R1 c R2 a R2 b R2 c R3 a R3 b R3 c
 88333 Intergenic 46 40 38 37 33 40 42 45 38 42 38 55 45 40 31 34 31 33 40
 88334 Intergenic 49 46 54 52
 102469 Intergenic 75
 132300 Intergenic 70 65 63 58 55 52 62 66 50
 149625 Intergenic 52
 210808 Intergenic 50
 236057 268 96*
 293971 Intergenic 98 94 95 91 95 91 94 94 96 93 96 93 92 96 96 95 93 95 97 95 92 95
 397298 fucT1 427 25* 35* 26*
 471641 Intergenic 100 95 97 81 97 93 95 92 92 93 98 93 95 94 95 90 94 95 94 93 94 86 93 91
 607701 Intergenic 63
 628559 Intergenic 28 28
 631022 Intergenic 85 69 82 77 84 85 96 91 93 89 94 81 79 100 84 76 78
 631033 Intergenic 90 80 77 83 95 62 73 96 86 78 89 87 87 75 87 78 82 78 96 91 79 84
 666812 nudT14 691 94* 93* 99*
 759720 Intergenic 68 66 65 74 72 74 63 63 70
 819619 oipA 838 67* 70*
 833169 fucT7 854 63* 66* 65*
 883216 hyuA1 895 93* 99* 98*
 8 83 595 hyuA1 895 100* 96* 97*
 1064308 katA 1087 100*
 1082193 1103 92* 97*
 1197192 Intergenic 42 49 54
 1197193 Intergenic 50 59 57 59 56 48 57 51 52 54 52 55 55 57 51 57 62 55 62
 1217501 Intergenic 58 53 46 44 53
 1332440 Intergenic 45 50 44 48 47 50 46 48 53 57 44
 1332612 1358 79* 69* 83.7-
84.8*
75* 80* 77* 71.6–
72.5*
74* 63* 77* 79* 74.4–
75.6*
81* 87* 80* 84* 73* 85* 66* 73* 75*
 1414196 1447 87*
 1458196 1484 56 60 60
 1566403 Intergenic 43 38 36 43 38 37 37 44
 1566404 Intergenic 58 54 60 45 48 44 59 46 45 53 55 55 47 44 57 51 49 47 58 57 39 59 53
 1621919 1665 83*
 1657270 Intergenic 66 74 65 80 62 73 61 72
 1657271 Intergenic 79 76 76 63 60 70 70 67 60 68 70 63 62 60 69

D1-3 and R1-3 designate independent gerbils maintained on either iron-depleted (n=3) or iron-replete (n=3) diets, respectively, while a-c designate different single colonies isolated from each gerbil. Colour-coded regions within each single colony represent deletions or insertions that were present in each isolate, and the number in each box represents the percentage of reads that contained each single nucleotide polymorphism. When a percentage range is shown, this represents multinucleotide polymorphisms present.

*Deletion or insertion results in a frameshift mutation.

Among the 180 polymorphisms identified, 72 were located within genes with predicted function and resulted in non-synonymous amino acid changes (table 2). Similar to the insertions and deletions, many of these variants were within genes encoding proteins that function in pathogenesis, including motility (fliI, fliF), adhesion (babA, babB), iron acquisition or active transport (tonB) and cag IV secretion system function (cagY). When we compared unique SNPs within coding regions between in vivo-adapted strains isolated from gerbils maintained on iron-depleted versus iron-replete diets, we identified 35 polymorphisms, distributed among 15 genes, including babB, cagY, pepP, oppD, hcpD, hcpE, prfB, and various outer membrane and hypothetical proteins. Additional SNPs were present in both groups, but were more prevalent in iron-depleted versus iron-replete strains; these included SNPs within babA, babB and fur.

Table 2.

Unique genetic loci with polymorphisms resulting in non-synonymous amino acid changes in Helicobacter pylori strains B128 and 7.13, and in vivo-adapted strains isolated from gerbils maintained on iron-depleted or iron-replete diets

Variant B128 single colonies 7.13 single colonies 7.13 iron-depleted single colonies 7.13 iron-replete single colonies
Location Gene HPB8 locus a b c a b c D1 a D1 b D1 c D2 a D2 b D2 c D3 a D3 b D3 c R1 a R1 b R1 c R2 a R2 b R2 c R3 a R3 b R3 c
118890 fliI 124 K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R K>R
132888 tonB1 138 K>E
211182 babB 237 S>L
211347 babB 237 T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I
211415 babB 237 G>R G>R G>R G>R G>R G>R G>R G>R G>R G>R
211583 babB 237 D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N
211592 babB 237 K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E
211690 babB 237 N>K N>K N>K N>K N>K N>K N>K N>K N>K N>K N>K N>K
211694 babB 237 E>K E>K E>K E>K E>K E>K
211838 babB 237 K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q
211844 babB 237 G>S G>S G>S G>S G>S G>S G>S
212150 babB 237 G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S
212315 babB 237 G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S
263909 rpsL 294 E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K
263985 rpsL 294 R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K R>K
264366 rpsG 295 T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M T>M
264374 rpsG 295 D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N
273162 Hypothetical 303 E>K
273165 Hypothetical 303 L>V
342359 pal 375 T>A T>A T>A
559618 Hypothetical 587 E>K E>K E>K
563546 Hypothetical 593 Y>C Y>C Y>C
591318 Putative OMP 626 T>S T>S
591626 Putative OMP 626 A>N A>N
591635 Putative OMP 626 K>N K>N
591638 Putative OMP 626 p>Q p>Q
616637 DNA methyltransferase 642 D>N D>N D>N
629024 babA 657 S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L S>L
629189 babA 657 T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I T>I
629257 babA 657 G>R G>R G>R G>R G>R G>R G>R G>R G>R G>R G>R G>R G>R
629425 babA 657 D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N D>N
629434 babA 657 K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E K>E
629532 babA 657 N>K N>K N>K N>K N>K N>K N>K N>K N>K N>K N>K
629536 babA 657 E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K E>K
629680 babA 657 K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q K>Q
629686 babA 657 G>S G>S G>S G>S G>S G>S G>S
629992 babA 657 G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S
630157 babA 657 G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S G>S
692170 cagY 716 n>T
692262 cagY 716 L>K
692887 cagY 716 K>R K>R K>R
693460 cagY 716 V>A V>A
693465 cagY 716 K>E K>E
693471 cagY 716 V>I V>I V>I
693483 cagY 716 L>K L>K L>K
693497 cagY 716 S>Q S>Q S>Q
693505 cagY 716 K>R K>R K>R
693508 cagY 716 T>N T>N T>N
693513 cagY 716 A>K A>K A>K
727820 Hypothetical 750 L>W L>W L>W
798239 Glycosyltransferase 817 A>T A>T A>T
799896 Glycosyltransferase 818 D>E D>E D>E
846179 rnc 865 A>D
913806 mesE 927 P>S P>S P>S
1084103 Putative OMP 1104 K>Q K>Q K>Q
1084106 Putative OMP 1104 A>S A>S A>S
1084553 Putative OMP 1104 Q>E Q>E Q>E
1084556 Putative OMP 1104 L>F L>F L>F
1084587 Putative OMP 1104 M>I M>I M>I
1122559 fur 1145 R>H R>H R>H R>H R>H R>H R>H R>H R>H R>H R>H R>H R>H
1130504 pepP 1155 R>H
1195655 fliF 1220 P>L P>L P>L
1221163 Polysaccharide deacetylase 1252 A>T A>T A>T
1283634 Conserved hypothetical OMP 1309 A>E
1289275 oppD 1313 D>N D>N
1302387 hcpE 1328 A>V A>V A>V
1369139 prfB 1395 A>T
1377477 hcpD 1405 T>A
1405574 Hypothetical 1436 A>D A>D A>D
1533082 Predicted coding region 1561 S>P
1533085 Predicted coding region 1561 S>F
1533088 Predicted coding region 1561 D>N

D1-3 and R1-3 designate independent gerbils maintained on either iron-depleted (n=3) or iron-replete (n=3) diets, respectively, while a–c designate different single colonies isolated from each gerbil. Colour-coded regions represent non-synonymous amino acid changes that result from specific genetic polymorphisms. Specific amino acid changes are designated within each box.

The SNP (FurR88H) located within fur, a gene encoding the ferric uptake regulator, was identified previously in in vivo-adapted H. pylori strains isolated from a gerbil maintained on a high salt diet.30 Therefore, we compared the number of SNPs from in vivo-adapted strains isolated from gerbils maintained on iron-depleted diets with those previously isolated from a gerbil maintained on a high salt diet. Specifically, we sought to identify SNPs present in these isolates that were either not present or present at a lower frequency in strains isolated from control gerbils maintained on iron-replete or regular salt diets. We identified five SNPs distributed among four genes, including HPB8_593, HPB8_716 (cagY), HPB8_1139 and HPB8_1145 (fur) (online supplementary table S6) in iron-depleted and high salt H. pylori in vivo-adapted output strains, suggesting that certain loci are subject to variation following in vivo adaptation to different host microenvironments.

Analysis of sequence variation in fur

To investigate mechanisms underpinning these changes in greater depth, phylogenetic analysis of Fur in H. pylori strains B128 and 7.13, and in vivo-adapted strains isolated from gerbils maintained on iron-replete, iron-depleted, high salt or regular salt diets was performed (figure 3). In vivo-adapted strains isolated from gerbils maintained on iron-depleted or high salt diets exhibited a high degree of identity within Fur, and segregated based on the FurR88H variant, suggesting that this region may be a susceptible genetic locus subject to variation under these conditions. The presence of the fur SNP in some regular salt21 and iron-replete strains in addition to one 7.13 single colony suggests that this variant is present at a low frequency within H. pylori populations and is favoured under certain conditions such as high salt and low iron.

Figure 3.

Figure 3

Phylogenetic analysis of Fur amino acid sequence. Phylogenetic analysis was performed for full-length Fur from all available Helicobacter pylori sequence data within the National Center for Biotechnology Information NCBI database. H. pylori single colonies from strains B128 (green) and 7.13 (orange), and in vivo-adapted strains isolated from gerbils maintained on iron-replete (red) and iron-depleted (blue) diets as well as in vivo-adapted strains isolated from gerbils maintained on regular salt (pink) and high salt (light blue) diets were included in these analyses. R1-3 and D1-3 designate independent gerbils maintained on either iron-replete (n=3) or iron-depleted (n=3), respectively, while a–c designate different single colonies isolated from each gerbil. HSO and RSO designate independent high salt output and regular salt output H. pylori strains, respectively. REFSEQ (#) represents the number of unique H. pylori sequences from different H. pylori strains that cluster under the same phylogeny. Although all Fur sequences from the NCBI database were used, this phylogenetic analysis shows only the branch to which the newly sequenced strains cluster. The scale bar represents amino acid changes per site.

To extend these findings, we next investigated the direct effects of high salt or low iron per se on genetic variation within fur. H. pylori strain 7.13 was continuously cultured in vitro for 6 days under high salt (1.1% NaCl), in the presence of an iron chelator (100 µM dipyridyl) to simulate iron depletion, or supplementation with iron (100 µM FeCl3). As expected, H. pylori growth under high salt or low iron was significantly attenuated (figure 4A). Sequence analysis revealed that adaptation to high salt and/or iron depletion in vitro resulted in selection of the fur SNP (FurR88H) after only 4 to 5 days, respectively, and this variant was maintained throughout the duration of growth in vitro (figure 4B). Exposure of H. pylori to normal growth conditions or normal growth conditions supplemented with iron did not induce sequence variation within fur. These data indicate that in vitro adaptation to high salt or low iron induces genetic variation in fur in vitro, suggesting that adaptation within the context of environmental stress may be regulated by these dietary changes in vivo.

Figure 4.

Figure 4

Analysis of genetic variation within fur following continuous culture in vitro under high salt or low iron conditions. (A) Helicobacter pylori strain 7.13 was grown in normal Brucella broth, modified Brucella broth with iron supplementation (100 µM FeCl3), iron chelation (100 µM dipyridyl) or high salt (1.1% NaCl) for 20 hours and continuously over a 6-day time course. The growth rate or ratio of the final OD600 to the initial starting OD600 is represented as mean values with SE from experiments performed on at least six independent occasions. A one-way analysis of variance with multiple comparisons was used to determine statistical significance. ****p<0.0001. (B) H. pylori strain 7.13 was continuously cultured in vitro under these conditions for 6 days to assess the presence (CAC) or absence (CGC) of the SNP in fur (FurR88H). SNP, single nucleotide polymorphism.

To expand on these in vitro studies and specifically address the relationship between presence of the FurR88H variant and iron deficiency in vivo, we performed sequence analysis on 224 in vivo-adapted H. pylori strains isolated from gerbils maintained on iron-replete or iron-depleted diets. The FurR88H variant was present at a significantly higher frequency among gerbils maintained on iron-depleted diets (93/118, 79%) compared with those maintained on iron-replete diets (54/106, 51%; p<0.0001, figure 5A). These data indicate that in vivo adaptation to environmental iron deficiency leads to genetic adaptation within fur.

Figure 5.

Figure 5

Analysis of genetic variation within fur in vivo. The frequency of the FurR88H variant was examined among (A) 224 in vivo-adapted Helicobacter pylori strains isolated from gerbils maintained on iron-replete or iron-depleted diets and (B) 339 clinical H. pylori strains isolated from three independent and well-defined patient cohorts within Colombia and the USA.31–33Fischer’s exact test was used to determine statistical significance. **p<0.005 and ****p<0.0001. DYS, dysplasia; IM, intestinal metaplasia; MAG, multifocal atrophic gastritis; NAG, non-atrophic gastritis alone.

Finally, we examined genetic variation in fur among 339 clinical H. pylori strains isolated from three independent and well-defined patient cohorts within Colombia and the USA (online supplementary table S7).31–33 Sequence analysis of fur revealed that 14% (46/339) of these clinical H. pylori strains harboured the same FurR88H variant identified in in vivo gerbil-adapted strains isolated from conditions of high salt or iron deficiency (online supplementary table S7). Among the clinical H. pylori isolates examined, 17% (40/232) of strains from patients with premalignant lesions (multifocal atrophic gastritis, intestinal metaplasia, dysplasia) harboured the FurR88H variant, compared with 6% (6/107) of strains from patients with non-atrophic gastritis alone (p=0.0034, figure 5B). These results demonstrate that this specific fur SNP is likely important for in vivo adaptation to a new host and within subpopulations of humans at increased risk for gastric cancer.

Discussion

Bacterial population structures differ based on the taxa under investigation. Some species, such as Mycobacterium tuberculosis 34 and Yersinia pestis,35 are of such recent origin that little sequence diversity has accumulated. In such largely clonal species, only a few coding sequences are variably present among different isolates.36–38 However, bacteria with high sequence diversity and frequent homologous recombination, such as H. pylori, harbour different population dynamics.39

H. pylori has co-evolved with humans since their origin, and such lifelong evolution is associated with selection of host-specific variants within particular genes necessary for survival and adaptation to the human host.8 Survival and persistence within the human host depends on the ability of H. pylori to rapidly respond to changing environmental conditions and circumvent host defense mechanisms initiated during colonisation.8 Rearrangement of genomic DNA allows a variety of pathogens to alter expression of surface antigens and evade host immunity, and H. pylori has one of the highest rates of genetic recombination of any known bacterial species,40 suggesting that this process confers a selective advantage in colonisation and survival. Indeed, H. pylori mutants defective in homologous recombination are spontaneously cleared,41 reinforcing the tenet that genetic recombination and variation are critical for H. pylori survival within the human host.

In addition to high rates of recombination, H. pylori displays exceptional genetic variability and intraspecies diversity.4 40 H. pylori has a highly plastic genome, reflecting elevated rates of recombination and development of point mutations, which promotes bacterial divergence and intraspecies diversity within a population.42 43 H. pylori exists within its gastric niche as a bacterial population in a continuous state of genetic variation, which allows rapid adaptation to changing environmental conditions in its current host as well as an ability to successfully colonise a new host.2 44 45 In this study, we hypothesised that prolonged adaptation of H. pylori to an in vivo carcinogenic gastric environment induced by iron deficiency would facilitate genetic changes involved in survival, persistence and increased virulence. Indeed, we demonstrated that H. pylori strains isolated from gerbils maintained on iron-replete diets are more closely related to each other than to strains isolated from gerbils maintained on iron-depleted diets, suggesting that specific variants are advantageous for survival and persistence in altered microenvironments. In addition, the current analysis confirmed that H. pylori B128 isolates recovered from a human stomach are more closely related to each other than to H. pylori strains adapted to gerbil stomachs, and that there are specific genetic variations that arise following adaptation to a new host. The diversity among 7.13 single colony isolates suggests that passage of B128 through a new gerbil host resulted in a more diverse population of isolates poised for further adaptation in vivo. As a result of frequent recombination and genetic variation, almost all H. pylori isolates from unrelated hosts and differing environments possess unique sequences.4 39

Further and consistent with other reports,6 7 we have demonstrated that variability exists among single colony isolates from each individual H. pylori strain. As a result of this diversity, H. pylori has been previously termed a quasispecies, a population of genetic variants comprising a single strain that allows for rapid selection and adaptation to the changing gastric microenvironments of the host.45–47 Recent changes in DNA sequencing technology have afforded the opportunity to assess the genetic diversity of H. pylori populations in much greater depth. We have now demonstrated that polymorphisms exist within single colonies, suggesting that even greater levels of within-host population diversity exist than previously demonstrated. Furthermore, we identified numerous genetic variants that arise under the selective pressure of iron deficiency, and some of these variants were also identified in H. pylori isolates exposed to high salt.

Among the various SNPs that resulted in non-synonymous variants, the majority arose within genetic loci prone to variation during adaptation to a new host or environmental condition. Many of these included outer membrane proteins that are particularly susceptible to selective pressure for survival and persistence. Adhesins that underwent genetic modification included babA and babB, which have been shown to undergo specific recombination in other models of H. pylori infection.48–50 Another genetic locus, cagY, which encodes an essential component of the cag type IV secretion system, has been shown to be particularly susceptible to variation in vivo.51 52 Another targeted locus was fur, which encodes a transcriptional regulator that controls expression of a large repertoire of genes and is an essential factor for survival and persistence of H. pylori in the stomach. Fur controls bacterial iron homeostasis, and also plays a central role in bacterial metabolism, energy production and immune regulation.53 The specific SNP in fur (FurR88H) identified following adaptation to low iron conditions was also identified in another study of in vivo adaptation to high salt.30 In this study, the fur SNP was directly linked to increased expression of genes controlling iron acquisition and homeostasis as well as increased resistance to high salt conditions and oxidative stress.30 Due to the role of Fur in regulating iron homeostasis, it is likely that this SNP also promotes increased survival and persistence of H. pylori under low iron conditions. Collectively, our data suggest that the accumulation of polymorphisms allows H. pylori to rapidly adapt to changing microenvironments to promote survival and persistence within the host.

Methods

Mongolian gerbils

Male Mongolian gerbils (Charles River Laboratories) were housed in the Vanderbilt University Animal Care Facilities and maintained on iron-depleted (TestDiet 5TWD), iron-replete (TestDiet 5STQ),17 regular salt or high salt (Purina 5001).14 Gerbils were orogastrically challenged with carcinogenic H. pylori strain 7.13. H. pylori strain 7.13 was originally isolated as a single colony following in vivo adaptation of the human H. pylori strain B128 to the Mongolian gerbil model and was then subcultured following minimal passage for single colony purification (figure 1).27 Single colony purified strain 7.13 was isolated from a frozen stock, expanded on trypticase soy agar plates with 5% sheep blood (BD Biosciences) and then grown in Brucella broth (BD Biosciences) supplemented with 10% FBS (Atlanta Biologicals) for 16 hours at 37°C with 5% CO2 prior to gerbil challenge.17 Gerbils were then euthanised 12–16 weeks postchallenge. The Vanderbilt University Institutional Animal Care and Use Committee (IACUC) approved all experiments and procedures.

H. pylori culture

H. pylori strain B128 was originally isolated from a single gastric biopsy of a human patient with gastric ulceration.54 B128 was subsequently used for orogastric challenge of a gerbil, and the in vivo-adapted output strain isolated from this gerbil was designated H. pylori strain 7.13.27 H. pylori strain 7.13 reproducibly induces gastric cancer in rodent models,14 17 27 while B128 only induces gastritis, but not cancer in these models.27 Three single colonies of B128 and 7.13 were isolated and expanded. In a more recent study, carcinogenic strain 7.13 was then used to infect another cohort of gerbils maintained on either iron-replete or iron-depleted diets.17 In vivo-adapted single colonies were recovered from gerbils maintained on iron-replete (n=3) and iron-depleted (n=3) diets, and single colonies were isolated and expanded.

In this study, we analysed in vivo-adapted output strains that were cultured from these gerbils. Specifically, we analysed three single colonies cultured from three gerbils maintained on an iron-replete (n=9) or iron-depleted (n=9) diets, and these were compared with single colonies cultured from one gerbil maintained on regular salt (n=4) or high salt (n=4). All H. pylori isolates were minimally passaged on trypticase soy agar plates with 5% sheep blood (BD Biosciences) and in Brucella broth (BD Biosciences) supplemented with 10% FBS (Atlanta Biologicals) for 16 hours at 37°C with 5% CO2.

H. pylori in vitro adaptation to high salt or low iron conditions

H. pylori strain 7.13 was grown in modified Brucella broth containing 1% Bacto tryptone (BD Biosciences), 1% Bacto Proteose Peptone No. 3 (BD Biosciences), 0.2% yeast extract (Difco), 0.1% dextrose (Fisher Scientific) with high sodium chloride (1.1% NaCl, Sigma), dipyridyl (100 µM 2,2-bipyridyl, Sigma) or addition of iron (100 µM FeCl3, Sigma) approximately 20 hours at 37°C with 5% CO2 and continuously over a 6-day time course. Approximately 5×108 colony forming units (CFUs) were harvested at each time point during mid-log phase for DNA extraction and used to inoculate a fresh broth culture for continuous culture in vitro.

H. pylori whole genome sequence analysis

H. pylori cultures were harvested, and bacterial DNA was extracted using the Wizard Genomic Purification Kit (Promega). H. pylori DNA was sheared using Covaris, yielding an average fragment length of 550 bp. Libraries were prepared using Truseq Nano LT Kit (Illumina) with unique indexes. Postquantitation was performed using the Kapa Library Quantitation Kit (Kapa Biosystems). Libraries were sequenced on the MiSeq Sequencer using the 600V3 Kit (Illumina). For analysis, raw sequence reads were quality trimmed using CLCbio Genomics Workbench V. 8.0 (Qiagen). Alignment files were exported from the CLCbio Workbench in BAM file formats and were then imported into Visual Genomics Analysis Studio, software developed at the Institute for Immunology and Infectious Diseases at Murdoch University, and Geneious V. 6.1.8 (Biomatters) for further analysis. Analyses were performed using a 25% cut-off, which required at least 25% of the reads from at least one single colony to contain the polymorphism, to allow detection of intrapopulation variance. All sequence reads were aligned with the genome sequence of H. pylori strain B8 (GenBank accession number NC_014256.1), a closely related strain whose complete genome sequence is available.28 B8 was chosen as the reference strain because H. pylori strains 7.13 and B8 each originated from the same parental H. pylori strain B128 and each was generated by experimentally infecting gerbils with strain B128. Although B128 (GenBank accession number ABSY0000000) and 7.13 (GenBank accession number NZ_LAQK00000000) have been previously sequenced, these strains were also sequenced in this study to directly compare these sequences within the newly derived strains using the same sequencing technology. All sequences have been deposited to GenBank (BioProject PRJNA362878). Sequence data for H. pylori strains isolated from gerbils on a high salt diet or a regular diet21 were analysed using the same criteria. Specifically, we sought to identify SNPs present in isolates from gerbils on iron-depleted or high salt diets, but not present or present at a lower abundance in isolates from gerbils maintained on iron-replete or regular salt diets.

DNA extraction, PCR and sequence analysis

Approximately 5×108 CFUs were pelleted by centrifugation and stored at −20°C. DNA was extracted from H. pylori using the PureLink Pro 96 Genomic DNA Purification Kit (Invitrogen). DNA was then used as template to amplify a 500 bp product using fur-specific primers: 5′TCCGCCAAAAAGACAAAAAC3′ and 5′GGGCAAGACTTTCACTTGGA3′. PCR products were prepared for sequence analysis using ExoSAP-IT Express PCR Product Cleanup Kit (Affymetrix), quantified using spectrophotometric nucleic acid quantification (BioTek) and sequenced (GeneWiz). Geneious V. 6.1.8 (Biomatters) was used for subsequent analysis.

H. pylori clinical isolates

Clinical H. pylori strains were isolated from three independent and well-defined patient cohorts within Colombia and the USA.31–33Online supplementary table S7 includes information on the clinical H. pylori strains, including strain identification number, patient country of origin, age, sex and histological diagnosis.

Statistical analysis

Mean values with SE are shown from experiments performed on at least six independent occasions. One-way analysis of variance with multiple comparisons and Fisher’s exact tests were used to determine statistical significance. p<0.05 was considered statistically significant.

Study approval

All animal and human studies were conducted in accordance with the Declaration of Helsinki principles and have been approved by Vanderbilt University IACUC and Institutional Review Board, respectively.

Acknowledgments

We would like to acknowledge the following funding sources: R01CA190612 (KTW), R01DK053620 (KTW), P01CA028842 (KTW), R01AI039657 (TLC), R01AI118932 (TLC), Department of Veterans Affairs 2I01B×0 00 627 (TLC), R01CA077955 (RMP), R01DK058587 (RMP), P30DK058404 (RMP), P01CA116087 (RMP, TLC, KTW).

Footnotes

Contributors: JMN contributed to the study design, performed experiments, gathered and analysed data, and drafted the manuscript. AC generated and analysed whole genome sequences. JTL generated and provided sequence data from Helicobacter pylori strains harvested from gerbils maintained on regular or high salt diets. JRG assisted with all animal experiments and isolation of in vivo-adapted H. pylori strains. MBP provided all patient information from the two Colombian patient cohorts and clinical H. pylori isolates from these subjects. MW and SL generated and analysed whole genome sequences. ACB and KTW provided feedback on the manuscript. TLC contributed to the study design and provided sequence data from H. pylori strains harvested from gerbils maintained on regular or high salt diets. SM contributed to the study design and the whole genome sequence analysis. DAI contributed to the study design, analysed sequence data, and helped with drafting and editing the manuscript. RMP contributed to the study design and helped with drafting and editing the manuscript.

Competing interests: None declared.

Patient consent: Obtained

Ethics approval: Institutional Review Board, Vanderbilt University Medical Center.

Provenance and peer review: Not commissioned; externally peer reviewed.

References

  • 1. Salama N, Guillemin K, McDaniel TK, et al. . A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains. Proc Natl Acad Sci U S A 2000;97:14668–73. 10.1073/pnas.97.26.14668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Blaser MJ, Berg DE. Helicobacter pylori genetic diversity and risk of human disease. J Clin Invest 2001;107:767–73. 10.1172/JCI12672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Suerbaum S, Josenhans C. Helicobacter pylori evolution and phenotypic diversification in a changing host. Nat Rev Microbiol 2007;5:441–52. 10.1038/nrmicro1658 [DOI] [PubMed] [Google Scholar]
  • 4. Falush D, Kraft C, Taylor NS, et al. . Recombination and mutation during long-term gastric colonization by Helicobacter pylori: estimates of clock rates, recombination size, and minimal age. Proc Natl Acad Sci U S A 2001;98:15056–61. 10.1073/pnas.251396098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Linz B, Windsor HM, McGraw JJ, et al. . A mutation burst during the acute phase of Helicobacter pylori infection in humans and rhesus macaques. Nat Commun 2014;5:4165 10.1038/ncomms5165 [DOI] [PubMed] [Google Scholar]
  • 6. Israel DA, Salama N, Krishna U, et al. . Helicobacter pylori genetic diversity within the gastric niche of a single human host. Proc Natl Acad Sci U S A 2001;98:14625–30. 10.1073/pnas.251551698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Björkholm B, Lundin A, Sillén A, et al. . Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori . Infect Immun 2001;69:7832–8. 10.1128/IAI.69.12.7832-7838.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Atherton JC, Blaser MJ. Coadaptation of Helicobacter pylori and humans: ancient history, modern implications. J Clin Invest 2009;119:2475–87. 10.1172/JCI38605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Cover TL, Peek RM. Diet, microbial virulence, and Helicobacter pylori-induced gastric cancer. Gut Microbes 2013;4:482–93. 10.4161/gmic.26262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lee SA, Kang D, Shim KN, et al. . Effect of diet and Helicobacter pylori infection to the risk of early gastric Cancer. J Epidemiol 2003;13:162–8. 10.2188/jea.13.162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Tsugane S. Salt, salted food intake, and risk of gastric cancer: epidemiologic evidence. Cancer Sci 2005;96:1–6. 10.1111/j.1349-7006.2005.00006.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Fox JG, Dangler CA, Taylor NS, et al. . High-salt diet induces gastric epithelial hyperplasia and parietal cell loss, and enhances Helicobacter pylori colonization in C57BL/6 mice. Cancer Res 1999;59:4823–8. [PubMed] [Google Scholar]
  • 13. Bergin IL, Sheppard BJ, Fox JG. Helicobacter pylori infection and high dietary salt independently induce atrophic gastritis and intestinal metaplasia in commercially available outbred Mongolian gerbils. Dig Dis Sci 2003;48:475–85. 10.1023/A:1022524313355 [DOI] [PubMed] [Google Scholar]
  • 14. Gaddy JA, Radin JN, Loh JT, et al. . High dietary salt intake exacerbates Helicobacter pylori-induced gastric carcinogenesis. Infect Immun 2013;81:2258–67. 10.1128/IAI.01271-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Akiba S, Neriishi K, Blot WJ, et al. . Serum ferritin and stomach cancer risk among a Japanese population. Cancer 1991;67:1707–12. [DOI] [PubMed] [Google Scholar]
  • 16. Nomura A, Chyou PH, Stemmermann GN. Association of serum ferritin levels with the risk of stomach cancer. Cancer Epidemiol Biomarkers Prev 1992;1:547–50. [PubMed] [Google Scholar]
  • 17. Noto JM, Gaddy JA, Lee JY, et al. . Iron deficiency accelerates Helicobacter pylori-induced carcinogenesis in rodents and humans. J Clin Invest 2013;123:479–92. 10.1172/JCI64373 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Szczebara F, Dhaenens L, Armand S, et al. . Regulation of the transcription of genes encoding different virulence factors in Helicobacter pylori by free iron. FEMS Microbiol Lett 1999;175:165–70. 10.1111/j.1574-6968.1999.tb13615.x [DOI] [PubMed] [Google Scholar]
  • 19. Delany I, Spohn G, Rappuoli R, et al. . The Fur repressor controls transcription of iron-activated and -repressed genes in Helicobacter pylori . Mol Microbiol 2001;42:1297–309. 10.1046/j.1365-2958.2001.02696.x [DOI] [PubMed] [Google Scholar]
  • 20. Merrell DS, Thompson LJ, Kim CC, et al. . Growth phase-dependent response of Helicobacter pylori to iron starvation. Infect Immun 2003;71:6510–25. 10.1128/IAI.71.11.6510-6525.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Lee HW, Choe YH, Kim DK, et al. . Proteomic analysis of a ferric uptake regulator mutant of Helicobacter pylori: regulation of Helicobacter pylori gene expression by ferric uptake regulator and iron. Proteomics 2004;4:2014–27. 10.1002/pmic.200300740 [DOI] [PubMed] [Google Scholar]
  • 22. Loh JT, Torres VJ, Cover TL. Regulation of Helicobacter pylori cagA expression in response to salt. Cancer Res 2007;67:4709–15. 10.1158/0008-5472.CAN-06-4746 [DOI] [PubMed] [Google Scholar]
  • 23. Gancz H, Jones KR, Merrell DS. Sodium chloride affects Helicobacter pylori growth and gene expression. J Bacteriol 2008;190:4100–5. 10.1128/JB.01728-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Loh JT, Friedman DB, Piazuelo MB, et al. . Analysis of Helicobacter pylori cagA promoter elements required for salt-induced upregulation of CagA expression. Infect Immun 2012;80:3094–106. 10.1128/IAI.00232-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Voss BJ, Loh JT, Hill S, et al. . Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration. Proteomics Clin Appl 2015;9:1021–34. 10.1002/prca.201400176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Noto JM, Lee JY, Gaddy JA, et al. . Regulation of Helicobacter pylori virulence within the context of iron deficiency. J Infect Dis 2015;211:1790–4. 10.1093/infdis/jiu805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Franco AT, Israel DA, Washington MK, et al. . Activation of beta-catenin by carcinogenic Helicobacter pylori . Proc Natl Acad Sci U S A 2005;102:10646–51. 10.1073/pnas.0504927102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Farnbacher M, Jahns T, Willrodt D, et al. . Sequencing, annotation, and comparative genome analysis of the gerbil-adapted Helicobacter pylori strain B8. BMC Genomics 2010;11:335 10.1186/1471-2164-11-335 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Heberle H, Meirelles GV, da Silva FR, et al. . InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams. BMC Bioinformatics 2015;16:169 10.1186/s12859-015-0611-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Loh JT, Gaddy JA, Algood HM, et al. . Helicobacter pylori adaptation in vivo in response to a high-salt diet. Infect Immun 2015;83:4871–83. 10.1128/IAI.00918-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Peek RM, Blaser MJ, Mays DJ, et al. . Helicobacter pylori strain-specific genotypes and modulation of the gastric epithelial cell cycle. Cancer Res 1999;59:6124–31. [PubMed] [Google Scholar]
  • 32. Mera R, Fontham ET, Bravo LE, et al. . Long term follow up of patients treated for Helicobacter pylori infection. Gut 2005;54:1536–40. 10.1136/gut.2005.072009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Schneider BG, Mera R, Piazuelo MB, et al. . DNA methylation predicts progression of human gastric lesions. Cancer Epidemiol Biomarkers Prev 2015;24:1607–13. 10.1158/1055-9965.EPI-15-0388 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Sreevatsan S, Pan X, Stockbauer KE, et al. . Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci U S A 1997;94:9869–74. 10.1073/pnas.94.18.9869 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Achtman M, Morelli G, Zhu P, et al. . Microevolution and history of the plague bacillus, Yersinia pestis . Proc Natl Acad Sci U S A 2004;101:17837–42. 10.1073/pnas.0408026101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Hinchliffe SJ, Isherwood KE, Stabler RA, et al. . Application of DNA microarrays to study the evolutionary genomics of Yersinia pestis and Yersinia pseudotuberculosis . Genome Res 2003;13:2018–29. 10.1101/gr.1507303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Tsolaki AG, Hirsh AE, DeRiemer K, et al. . Functional and evolutionary genomics of Mycobacterium tuberculosis: insights from genomic deletions in 100 strains. Proc Natl Acad Sci U S A 2004;101:4865–70. 10.1073/pnas.0305634101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Hirsh AE, Tsolaki AG, DeRiemer K, et al. . Stable association between strains of Mycobacterium tuberculosis and their human host populations. Proc Natl Acad Sci U S A 2004;101:4871–6. 10.1073/pnas.0305627101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Gressmann H, Linz B, Ghai R, et al. . Gain and loss of multiple genes during the evolution of Helicobacter pylori . PLoS Genet 2005;1:e43 10.1371/journal.pgen.0010043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Suerbaum S, Smith JM, Bapumia K, et al. . Free recombination within Helicobacter pylori . Proc Natl Acad Sci U S A 1998;95:12619–24. 10.1073/pnas.95.21.12619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Loughlin MF, Barnard FM, Jenkins D, et al. . Helicobacter pylori mutants defective in RuvC Holliday junction resolvase display reduced macrophage survival and spontaneous clearance from the murine gastric mucosa. Infect Immun 2003;71:2022–31. 10.1128/IAI.71.4.2022-2031.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Kang J, Blaser MJ. Bacterial populations as perfect gases: genomic integrity and diversification tensions in Helicobacter pylori . Nat Rev Microbiol 2006;4:826–36. 10.1038/nrmicro1528 [DOI] [PubMed] [Google Scholar]
  • 43. Levine SM, Lin EA, Emara W, et al. . Plastic cells and populations:DNA substrate characteristics in Helicobacter pylori transformation define a flexible but conservative system for genomic variation. Faseb J 2007;21:3458–67. 10.1096/fj.07-8501com [DOI] [PubMed] [Google Scholar]
  • 44. Blaser MJ. Ecology of Helicobacter pylori in the human stomach. J Clin Invest 1997;100:759–62. 10.1172/JCI119588 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Covacci A, Rappuoli R. Helicobacter pylori: molecular evolution of a bacterial quasi-species. Curr Opin Microbiol 1998;1:96–102. 10.1016/S1369-5274(98)80148-3 [DOI] [PubMed] [Google Scholar]
  • 46. Kuipers EJ, Israel DA, Kusters JG, et al. . Quasispecies development of Helicobacter pylori observed in paired isolates obtained years apart from the same host. J Infect Dis 2000;181:273–82. 10.1086/315173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Webb GF, Blaser MJ. Dynamics of bacterial phenotype selection in a colonized host. Proc Natl Acad Sci U S A 2002;99:3135–40. 10.1073/pnas.042685799 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Pride DT, Meinersmann RJ, Blaser MJ, et al. . Allelic variation within Helicobacter pylori babA and babB . Infect Immun 2001;69:1160–71. 10.1128/IAI.69.2.1160-1171.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Solnick JV, Hansen LM, Salama NR, et al. . Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques. Proc Natl Acad Sci U S A 2004;101:2106–11. 10.1073/pnas.0308573100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Colbeck JC, Hansen LM, Fong JM, et al. . Genotypic profile of the outer membrane proteins BabA and BabB in clinical isolates of Helicobacter pylori . Infect Immun 2006;74:4375–8. 10.1128/IAI.00485-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Aras RA, Fischer W, Perez-Perez GI, et al. . Plasticity of repetitive DNA sequences within a bacterial (Type IV) secretion system component. J Exp Med 2003;198:1349–60. 10.1084/jem.20030381 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Barrozo RM, Cooke CL, Hansen LM, et al. . Functional plasticity in the type IV secretion system of Helicobacter pylori . PLoS Pathog 2013;9:e1003189 10.1371/journal.ppat.1003189 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Pich OQ, Merrell DS. The ferric uptake regulator of Helicobacter pylori: a critical player in the battle for iron and colonization of the stomach. Future Microbiol 2013;8:725–38. 10.2217/fmb.13.43 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Israel DA, Salama N, Arnold CN, et al. . Helicobacter pylori strain-specific differences in genetic content, identified by microarray, influence host inflammatory responses. J Clin Invest 2001;107:611–20. 10.1172/JCI11450 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file 1

gutjnl-2017-313863supp001.pdf (1.2MB, pdf)


Articles from Gut are provided here courtesy of BMJ Publishing Group

RESOURCES