Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2019 Dec 9;9:18664. doi: 10.1038/s41598-019-55244-1

GCH1 (rs841) polymorphism in the nitric oxide-forming pathway has protective effects on obstructive sleep apnea

Samaneh Sheikhi Kouhsar 1, Mohammadreza Bigdeli 1,2,✉, Yadollah Shakiba 3, Khosro Sadeghniiat 4
PMCID: PMC6901474  PMID: 31819149

Abstract

Several studies have recently investigated the contribution of genetic factors in obstructive sleep apnea (OSA). Patients with OSA suffer from a reduction in nitric oxide (NO) serum level. This study investigated rs841, A930G p22phox, and rs1799983 polymorphisms in three critical genes involved in NO formation. A total of 94 patients with OSA and 100 healthy controls were enrolled into the study. Results showed there was no association between rs841, A930G p22phox and rs1799983 polymorphism and the risk of OSA (P = 0.51, P = 0.4 and P = 0.33, respectively). Moreover, rs841 GA genotype had a reverse relationship with the severity of OSA (P = 0.005). On the other hand, rs841 GA and A930G p22phox AA genotypes had a protective effect on daytime sleepiness in OSA patients (P = 0.01and P = 0.02, respectively). Additionally, the combination of rs841 and A930G p22phox (AG/AG and AG/AA) genotypes was significantly associated with a reduction in daytime sleepiness in OSA patients (P = 0.03 and P = 0.03, respectively). According to the results of our study, GA genotype of rs841 and GA/AA genotypes of A930G p22phox polymorphisms significantly reduced the severity of the problem and daytime sleepiness in OSA patients.

Subject terms: Genetic predisposition to disease, Genetics research

Introduction

Obstructive sleep apnea (OSA) is a common sleep disorder1,2, which is characterized by repetitive pharyngeal obstruction, leading to apnea and hypopnea during sleep3. Headache, Fatigue, excessive daytime sleepiness, non-refreshing sleep, irritability, and decreased cognitive functions are the common symptoms of OSA4,5. The prevalence of undiagnosed OSA among the general population is estimated to be 5%. In addition, the prevalence of undiagnosed moderate to severe OSA among a sample of general population in Western Australia was 9%. Nonetheless, it is estimated that only 40% of people with OSA are diagnosed6,7. Untreated OSA is associated with different health complications, including metabolic disorder8, cognitive impairment9, depression10, and cardiovascular diseases11; this disorder also has an economic burden on community12. OSA is a multifactorial disorder and several genetic studies have provided evidence for the possible association between OSA and genetic factors13,14.

Nitric Oxide (NO) is synthesized from L-Arginine substrate by a family of nitric oxide synthase (NOS) enzymes. In this process, NADPH and O2 serve as co-substrates and 6-tetrahydrobiopterin (BH4) acts as a co-factor15. NO is a signaling molecule in the human body that is involved in many physiological and pathological processes16,17. NO plays an important role in neural signaling, immune response, vasodilation, and modulating insulin sensitivity18. NO deficiency is involved in the pathogenesis of multiple diseases such as hypertension19, diabetes mellitus20, stroke21, and OSA22. Nitric Oxide derivatives (serum nitrites and nitrates) and L-Arginine plasma levels decrease in patients with OSA, however, they increase after continuous positive airway pressure (CPAP) therapy23,24. Chronic sleep deprivation and repetitive hypoxia / reoxygenation in patients with OSA impairs endothelial function through reducing NO bioavailability and increasing oxidative stress and inflammation11. Therefore, changes in substrate, enzymes, and co-factors that are involved in NO formation may decrease NO levels in patients with OSA. Several functional polymorphisms have been identified in NO-forming pathway25,26. eNOS is encoded by NO3 gene, and some polymorphisms have been reported for NOS3 gene, including rs1799983, intron 4a/b, rs2070744, etc. They play a role in different diseases such as OSA27,28. According to previous studies, G894 T (rs1799983) variant is responsible for NO reduction29.

GTP cyclohydrolase 1 (GCH1) catalyzes the biosynthesis of BH4 that is an essential cofactor in the synthesis of NO. Moreover, rs841 polymorphism of GCH1 is involved in neuropathic pain, attention, and stroke30–32. So far, no study has investigated the association between this polymorphism and OSA. NADPH oxidase is another factor which is involved in NO formation and is identified as the major source of reactive oxygen species (ROS). It is a multicomponent enzyme consisting of catalytic subunits and cytosolic proteins. Among catalytic subunits, p22phox is a physical conduct for transferring electrons across the membrane and is critical for the enzymatic activity. On the other hand, p22phox subunit polymorphism is identified as a factor involved in OSA and cardiovascular diseases33,34.

This study investigated the association between OSA and rs841(G > A) in GTP cyclohydrolase I (GCH1), A930G p22phox (G > A) in NADPH Oxidase, and rs1799983 (G > T) in eNOS polymorphisms.

To the best of our knowledge, this study is the first research investigating the association between GCH1 polymorphism and OSA, as well as the relationship between rs841, A930G p22phox, and 1799983 in Iranian people.

Results

Genotypes, allele frequencies, and risk of OSA

Table 1 presents the data collected on patients’ and controls’ age, gender, BMI, and the data collected via STOP-BANG and Epworth Sleep Scale questionnaires. The collected data were used to assess the association between three polymorphisms in three different genes and the risk of OSA. All genotypes observed in cases and controls were consistent with Hardy–Weinberg equilibrium (HWE) (P > 0.05). Table 2 presents the genotype distributions and allele frequencies of rs841(GCH1), A930G p22phox (NADPH Oxidase), and rs1799983 (eNOS) polymorphisms. Based on the results, genotypes and allele frequencies of rs841 (G > A), A930G p22phox (G > A) and rs1799983 (G > T) polymorphisms had no significant association with the risk of OSA (A vs. G: OR = 0.74, 95% CI = 0.3–1.81; P = 0.51, A vs. G: OR = 0.82, 95% CI = 0.53–1.28; P = 0.4 and T vs. G: OR = 2.12, 95% CI = 0.46–9.74; P = 0.33, respectively).

Table 1.

Characteristics of patient and control groups.

Characteristics Control N = 100 Patient N = 94 Pvalue
Men n (%) 79 (79%) 75 (80%) 0.89
Age 42.74 ± 7.76 44.3 ± 11.45 0.26
BMI 26.77 ± 3.9 29.14 ± 4.5 0.000
STOP-BANG 1.2 ± 0.55 3.85 ± 1.45 0.000
ESS 1.3 ± 1.56 9.42 ± 6.00 0.000

BMI: Body Mass Index, ESS: Epworth Sleep Scale. Characteristics are defined by Mean ± Standard Deviation.

Table 2.

Genotype distribution and allele frequency in OSA and controls.

SNP Genotype/Allele Control OSA Crude OR P value Adjusted OR P value
N = 100 N = 94 (95% CI) (95% CI)
Rs841 GG 63 (63%) 59 (62.8%) 1.00 (Reference)
GA 33 (33%) 32 (34%) 1.03 (0.55–1.92) 0.9 1.64 (0.3–8.79) 0.56
AA 4 (4%) 3 (3.2%) 0.8 (0.19–3.09) 0.77 1.59 (0.28–8.83) 0.59
Dominant
GG 63 (63%) 59 (62.8%) 1.00 (Reference)
GA + AA 37 (37%) 35 (37.2%) 1.01 (0.56–1.79) 0.97 0.93 (0.5–1.71) 0.82
Recessive
GG + GA 96 (96%) 91 (96.8%) 1.00 (Reference)
AA 4 (4%) 3 (3.2%) 0.79 (0.19–3.01) 0.76 0.61 (0.11–3.25) 0.56
G 159 (79.5%) 150 (79.8%) 1.00 (Reference)
A 41 (20.5%) 38 (20.2%) 0.98 (0.6–1.58) 0.94 0.74 (0.3–1.81) 0.51
A930G p22phox GG 29 (29%) 27 (28.7%) 1.00 (Reference)
GA 48 (48%) 53 (56.4%) 1.18 (0.6–2.33) 0.6 1.18 (0.6–2.32) 0.63
AA 23 (23%) 14 (14.9%) 0.65 (0.26–1.43) 0.32 0.68 (0.28–1.68) 0.41
Dominant
GG 29 (29%) 27 (28.7%) 1.00 (Reference)
GA + AA 71 (71%) 67 (81.3%) 1.01 (0.55–1.86) 0.96 1.03 (0.54–1.97) 0.92
Recessive
GG + GA 77 (77%) 80 (85.1%) 1.00 (Reference)
AA 23 (23%) 14 (14.9%) 0.58 (0.28–1.23) 0.15 0.61 (0.28–1.34) 0.22
G 106 (53%) 107 (57%) 1.00 (Reference)
A 94 (47%) 81 (43%) 0.85 (0.57–1.26) 0.43 0.82 (0.53–1.28) 0.4
Rs1799983 GG 69 (69%) 51 (54.2%) 1.00 (Reference)
GT 28 (28%) 37 (39.4%) 1.78 (0.96–3.24) 0.06 1.55 (0.82–2.93) 0.17
TT 3 (3%) 6 (6.4%) 2.7 (0.71–10.17) 0.15 3.57 (0.82–15.48) 0.08
Dominant
GG 69 (69%) 51 (54.2%) 1.00 (Reference)
GT+TT 31 (31%) 45 (45.8%) 1.96 (1.11–3.55) 0.02 3.17 (0.07–1.14) 0.93
Recessive
GG + GT 97 (97%) 88 (83.6%) 1.00 (Reference)
TT 3 (3%) 6 (6.4%) 2.2 (0.57–8.2) 0.26 0.32 (0.07–1.37) 0.12
G 166 (83%) 139 (74%) 1.00 (Reference)
T 34 (17%) 49 (26%) 1.72 (1.04–2.81) 0.02 2.12 (0.46–9.74) 0.33

SNP: Single Nucleotide Polymorphism, OSA: Obstructive Sleep Apnea, OR: Odd Ratio, CI: Confidence Interval. Adjusted odds ratio were adjusted for body mass index.

Genotypes and severity of OSA

In order to conduct further assessment, we divided OSA patients into two groups. There were 43 patients in severe group and 51 patients in mild-to-moderate group. Table 1 in appendix presents the polysomnographic parameters in patients. Statistical analysis did not show a significant difference between the severe and non-severe OSA patients in terms of the genotypes distribution of A930G p22phox (NADPH Oxidase) and rs1799983 (eNOS) polymorphism (P > 0.05, Table 3). Interestingly, as shown in Table 3, for the first time we found a significant difference between the severe and mild-to-moderate OSA patients in terms of the genotype of rs841 (GCH1), where GA genotype was more frequently observed in the mild-to-moderate OSA patients (Crude OR = 0.3, 95% CI = 0.12–0.78; P = 0.01, after adjusting for age, gender, BMI, OR = 0.21, 95% CI = 0.07–0.62; P = 0.005). The results showed that GA genotype of rs841 (GCH1) reduced the severity of OSA in patients; moreover, this genotype of rs841 had a protective effect in patients with OSA.

Table 3.

Association between rs841, A930G p22phox, rs1799983 genotypes and the severity of OSA.

SNP Genotype Non-severe Severe Crude OR P value Adjusted OR P value
N = 51 N = 43 (95% CI)
Rs841 GG 26 33 1.00 (Reference)
GA 23 9 0.3 (0.12–0.78) 0.01 0.21 (0.07–0.62) 0.005
AA 2 1 0.3 (0.02–3.58) 0.44 0.05 (0.002–1.32) 0.07
A930G p22phox GG 14 13 1.00 (Reference)
GA 31 22 0.76 (0.3–1.92) 0.57 0.61 (0.22–1.7) 0.35
AA 6 8 1.43 (0.38–4.7) 0.58 1.14 (0.27–4.84) 0.85
Rs1799983 GG 28 23 1.00 (Reference)
GT 18 19 1.28 (0.55–3.03) 0.56 0.92 (0.36–2.31) 0.86
TT 5 1 0.24 (0.01–2.11) 0.18 0.33 (0.33–3.36) 0.35

SNP: Single Nucleotide Polymorphism, OSA: Obstructive Sleep Apnea, OR: Odd Ratio, CI: Confidence Interval. Adjusted odds ratio were adjusted for age, gender and body mass index.

Genotypes and daytime sleepiness in OSA

We investigated the association between the three genetic polymorphisms involved in NO formation and daytime sleepiness in OSA patients. We divided patients into two groups, patients with daytime sleepiness (n = 72) and patients without daytime sleepiness (n = 22) (Table 4). Assessing rs841 (GCH1), the frequency of GA genotype was significantly higher in patients without daytime sleepiness, as compared with patients with daytime sleepiness (Crude OR = 0.27, 95% CI = 0.1–0. 8; P = 0.01, after adjustment for age, gender, BMI OR = 0.23, 95% CI = 0.07–0.7; P = 0.01). Furthermore, assessing A930G p22phox, there was a significant difference between the patients without daytime sleepiness and the patients with daytime sleepiness in terms of genotype distribution; according to the results, AA genotype decreased daytime sleepiness in patients and had a protective effect (Crude OR = 0.23, 95% CI = 0.06–0.95; P = 0.04, after adjustment for age, gender, BMI OR = 0.14, 95% CI = 0.02–0.8; P = 0.02). There was no association between rs179983 (eNOS) genotypes and daytime sleepiness in the two groups of patients (P > 0.05).

Table 4.

Association between rs841, A930G p22phox, rs1799983 genotype and daytime sleepiness in OSA.

SNP Genotype Non-sleepy Sleepy Crude OR P value Adjusted OR P value
N = 22 N = 72 (95% CI) (95% CI)
Rs841 GG 9 (40.9%) 51 (70.8%) 1.00 (Reference)
GA 12 (54.5%) 19 (26.4%) 0.27 (0.1–0.8) 0.01 0.23 (0.07–0.7) 0.01
AA 1 (4.5%) 2 (2.8%) 0.35 (0.03–5.64) 0.39 0.3 (0.01–5.08) 0.4
A930G p22phox GG 4 (18.2%) 23 (31.9%) 1.00 (Reference)
GA 12 (54.5%) 41 (56.9%) 0.59 (0.19–1.99) 0.4 0.56 (0.15–2.07) 0.38
AA 6 (27.3%) 8 (11.2%) 0.23 (0.06–0.95) 0.04 0.14 (0.02–0.8) 0.02
Rs1799983 GG 14 (63.63%) 37 (51.4%) 1.00 (Reference)
GT 6 (27.27%) 31 (43%) 1.95 (0.66–5.81) 0.21 1.79 (0.58–5.52) 0.3
TT 2 (9%) 4 (5.6%) 0.75 (0.16–4.34) 0.76 1.61 (0.23–11.03) 0.62

SNP: Single Nucleotide Polymorphism, OSA: Obstructive Sleep Apnea, OR: Odd Ratio, CI: Confidence Interval. Adjusted odds ratio were adjusted for age, gender and body mass index.

Association between genotype combinations and daytime sleepiness in OSA patients

Interactions between polymorphisms within genes involved in the reduction of daytime sleepiness in OSA patients were investigated using the logistic regression analysis and the results showed a significant relationship between rs841 and A930G p22phox in two genotypes combination (Crude OR = 0.16, 95% CI = 0.02–0.98; P = 0.04 and Crude OR = 0.09, 95% CI = 0.009–0.97; P = 0.04, after adjustment for age, gender, BMI OR = 0.11, 95% CI = 0.01–0. 8; P = 0.03 and OR = 0.05, 95% CI = 0.003–0.83; P = 0.03, respectively). The combinations of rs841 GA genotype and A930G p22phox GA/AA genotype were significantly associated with a reduction in daytime sleepiness in patients with OSA, as compared with the reference combination of rs841 GG and A930G p22phox GG genotype (Table 5). The combinations of other genotypes did not result in a significant difference (P > 0.05).

Table 5.

Distribution of combined genotypes in sleep and non-sleep OSA.

Genotype Non-sleepy Sleepy Crude OR (95% CI) P value Adjusted OR (95% CI) P value
rs841 A930G
GA GA 7 8 0.16 (0.02–0.98) 0.04 0.11 (0.01–0.8) 0.03
GA AA 3 2 0.09 (0.009–0.97) 0.04 0.05 (0.003–0.83) 0.03

OR: Odd Ratio, CI: Confidence Interval. Adjusted odds ratio were adjusted for age, gender and body mass index.

Discussion

Over the past two decades, public awareness about the importance of sleep and its related disorders has increased significantly35. In this work, we investigated the association between the susceptibility to OSA and GCH1 (rs841), NADPH oxidase (A930G p22phox (CYBA)) and endothelial NOS (rs1799983) polymorphisms. These genes play a role in nitric oxide formation36. To our knowledge, this was the first study that assessed the association between rs841 (GCH1) polymorphism and the risk of OSA. Some studies have shown that rs841 polymorphism is associated with the risk of ischemic stroke, endothelial dysfunction, and oxidative stress in patients with type 2 diabetes mellitus32,37. Interestingly, our results indicated no association between rs841 and the susceptibility to OSA; on the contrary, GA genotype of this polymorphism reduced the severity of the disease and daytime sleepiness in patients with OSA. Moreover, we did not find any relationship between A930G p22phox polymorphism and the risk of OSA; however, according to the results of a study by Pierola et al., this polymorphism plays an important role in genetic susceptibility to OSA33. In contrast, AA genotype of A930G p22phox polymorphism prevented daytime sleepiness in patients with OSA. The analysis of data collected in our study showed that T allele of rs1799983 polymorphism was not associated with increased risk of OSA. Bayazit et. al.’s study showed that eNOS4 polymorphism was not associated with OSA, while eNOS296 polymorphism was associated with OSA susceptibility. In this study, there was no relationship between eNOS4, eNOS296 polymorphisms and polysomnography parameters, diabetes mellitus, coronary artery disease, arrhythmia, hypertension, hypercholesterolemia, and smoking28. NO reduces in OSA patients, treatment with CPAP ameliorate endothelial nitric oxide release and vasodilation38.

Several studies have indicated a reduction in nitric oxide bioavailability in OSA patients3,39,40. BH4 is an essential co-factor required for the activation of all the three nitric oxide synthases; changes in this co-factor can affect NO formation41. GTP Cyclohydrolas 1 (GCH1) is a rate-limiting enzyme in the BH4 synthesis42. Therefore, changes in GCH1 gene could decrease or increase BH4 availability for NOS. Some studies have demonstrated that GCH1 rs841 polymorphism has a similar effect on BH4 levels in plasma and vascular tissues, and acts as a pain-protective haplotype of GCH143. This polymorphism reduces BH4 levels in people with cardiovascular diseases, results in a reduction in NO, and increase superoxide production42. Given the protective effect of this polymorphism and other haplotypes of GCH1, it could be concluded that rs841 moderately reduces GCH1 expression and BH4 production44. Cycles of intermittent hypoxia, as a sign of OSA, promote oxidative stress and enhance the production of reactive oxygen species39. NADPH oxidase is a membrane-bound complex enzyme with cytosolic subunits (Rac, p47phox, p67phox) that are linked to catalytic membrane subunits (Nox, p22phox) to facilitate the superoxide production45. P22phox subunit plays an important role in the normal function of enzymes46. Recent studies have demonstrated that several polymorphisms of p22phox gene (CYBA) are associated with increased oxidative stress and cardiovascular diseases32,47,48. According to Pierola et al., patients with GA and GG genotypes of A930G p22phox polymorphism are more at risk of OSA. A930G p22phox polymorphism changes the expression of p22phox, in addition G allele increases p22phox expression and oxidative stress. A-930G polymorphism is associated with sleep apnea independently of sympathetic activation, obesity, hypertension, hyperlipidemia and diabetes mellitus33. A meta-analysis study indicated that A930G polymorphism might be a protective factor for hypertension49. Based on another study, NO production is lower in hypertensive patients with GG genotype of A930G polymorphism46, that could indicate that patients with GA/AA genotype produce more NO than patients with GG genotype; this phenomenon may justify the protective effect of GA/AA genotype in OSA patients. eNOS is one of the three isoforms of NOS enzyme that produces nitric oxide in the presence of BH4 and NADPH15. eNOS and NO play an important role in the regulation of endothelial vasodilation, and their functional impairment plays an important role in the development of various diseases50, such as cardiovascular diseases51, cerebral ischemia52, and OSA53. Therefore, the expression of eNOS and subsequent endothelial NO release may be affected by gene polymorphism54. A study investigated 50 single nucleotide polymorphisms of eNOS in children with OSA and the results suggested that these polymorphisms could contribute to the risk of OSA-induced cardiovascular morbidity55. G894T (rs1799983) polymorphism of eNOS is a functional polymorphism which could lead to the sequence change in Glu 298 Asp56. Moreover, rs1799983 polymorphism of eNOS gene is associated with reduced activity of NOS and bioavailability of NO. Concurrent presence of CETP B1, NOS3 T, and ANGPTL8 T alleles increases the risk of cardiovascular diseases and type 2 diabetes mellitus57.

This study had some limitations. Firstly, the genes selected for investigation had overlap with other diseases such as cardiovascular diseases, diabetes, stroke, and brain ischemia; thus, we only selected patients with no comorbidity. Therefore, it had an advantage and a disadvantage for our study. As an advantage, the genetic assessments were just performed for people who only had OSA; however, as a disadvantage, it was difficult to find patients with no comorbidity, and it resulted in a small sample size. Hence, it is suggested to conduct further studies with larger sample sizes. On the other hand, in order to perform a comparative analysis, it is better to select another group of OSA patients with a concurrent comorbidity. Secondly, we assessed just one polymorphism in each gene, hence the association between other polymorphisms and OSA could be investigated further.

Overall, our study showed that gene polymorphisms in nitric oxide-forming pathway had a reverse association with OSA. rs841 and A930G p22phox polymorphisms had a protective effect in patients with OSA.

Materials and Methods

Subjects

This study, as a case-control study, was performed in Baharloo Hospital and Imam Khomeini Hospital, Tehran, Iran. The study protocol was approved by Ethics Committee of Tehran University of Medical Sciences (ethical code: IR.TUMS.VCR.REC.1395.1107). A written informed consent was obtained from all the participants. The experiments were performed in accordance with the American Academy of Sleep Medicine Guidelines58.

A total of 94 patients (F19: M75) with OSA and 100 healthy controls (F21: M79) were matched in terms of age and gender. The data on personal characteristics, medical history, and sleep information were obtained through using a questionnaire. All the patients underwent a polysomnography test. Polysomnography was performed overnight, and it monitored many body functions, including skeletal muscle activation (EMG), eye movement (EOG), brain activity (EEG), blood pressure, heart beating, and oxygen saturation. After test analysis, people with 5 ≤ AHI < 15, 15 ≤ AHI < 30 and AHI ≥ 30 were classified into the three groups of patients with mild, moderate, and severe OSA, respectively.

In order to control the costs and consider practical issues, polysomnography was not performed for the controls, and the controls were considered healthy on the basis of data on history that were obtained via answering STOP-BANG and Epworth Sleepiness Scale questionnaires. The cutoff point for STOP-BANG questionnaire was 259, and the cutoff point for Epworth Sleepiness Scale questionnaire was 1060.

Exclusion criteria for both case and control groups were the presence of trauma, inflammatory diseases, cardiovascular diseases, brain ischemia, diabetes, chronic pulmonary disorders, asthma, chronic kidney disease, thyroid diseases, smoking history, and drug addiction. Blood samples were collected from the members in the two groups and stored in −20 °C to be used for further examinations.

DNA extraction and genotyping

DNA was extracted from the whole peripheral blood samples using Geneall DNA extraction kit (Geneall, Seoul, South Korea), in accordance with the manufacturer’s protocol. NADPH Oxidase A930G p22phox was genotyped via Restricted Fragment Length Polymorphism (RFLP) method. The polymerase chain reaction (PCR) forward primer was 5′ GGAAACCACCAAGTGCCTCGGATGG 3′ and Revers primer was 5′ TCTGCACCCTGATGCTACCAAGGAC 3′. PCR was carried out using a volume of 30 ml, under the following condition: an initial denaturation step at 94 °C for 1 min, followed by 31 cycles of 1 min at 94 °C, 1 min at 67 °C, and 1 min at 72 °C; finally, the last elongation step was performed at 72 °C for 2 min. Amplified products were digested using h 3 U of BbvI restriction enzyme for 1 h at 37 °C (New England Biolabs, Beverly, MA, USA). The results of digestion were separated on 3% agarose (Sigma-Aldrich, USA). TaqMan SNP genotyping assays were used for GCH1 rs841 and eNOS rs1799983 genotyping. Following the manufacturer’s protocol, the probes were designed by Applied Biosystems and genotyping were performed on Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, California, United States).

Statistical analysis

Statistical analyses were performed in SPSS 25.0 software package for Windows (SPSS Inc, Chicago, IL, USA) and GraphPad Prism 8 (GraphPad Software, San Diego, CA). Chi-square test was preformed to assess deviation from Hardy-Weinberg equilibrium to assess genotypes distribution. The effect of each single-nucleotide polymorphism (SNP) on OSA was investigated using multiple logistic regression analysis adjusted for body mass index in the patients and controls, however, in order to analyze the data obtained from the patient group, multiple logistic regression was preformed after adjusting for age, gender, and body mass index. The strength of the association between the three polymorphisms and OSA was measured via computing ORs at a confidence interval of 95%. Statistical significance was defined as a two-tailed P < 0.05.

Acknowledgements

This study was supported by Tehran University of Medical Sciences. The authors would like to express their thanks to Dr Solmaz Arshi at Occupational Sleep Research Center of Baharloo Hospital and Dr Samaneh Akbarpour at Clinical Research Development Unit (CRDU) of Baharloo Hospital, and they would also like to thank Occupational Sleep Research Center and Sleep Clinic of Imam Khomeini Hospitals, Tehran University of Medical Sciences, Tehran, Iran for their support, cooperation, and helps throughout the study. The authors express special thanks to Yekta Lab personnel for their kind assistance in the process of research. We appreciate Dr. Abdolkarim Hosseini for his kind help, as a research assistant.

Author contributions

M.B. and Y.S. designed the experiments, S.S.K. carried out the experiments, Y.S. contributed in molecular experiments, K.S. performed patient’s polysomnography analysis, S.S.K. and Y.S. conducted the data analysis, and all the authors wrote and edit the final manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Peppard PE, et al. Increased prevalence of sleep-disordered breathing in adults. Am J Epidemiol. 2013;177:1006–1014. doi: 10.1093/aje/kws342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Qaseem A, et al. Management of obstructive sleep apnea in adults: A clinical practice guideline from the American College of Physicians. Ann Intern Med. 2013;159:471–483. doi: 10.7326/0003-4819-159-7-201310010-00704. [DOI] [PubMed] [Google Scholar]
  • 3.Lavie L. Obstructive sleep apnoea syndrome–an oxidative stress disorder. Sleep Med Rev. 2003;7:35–51. doi: 10.1053/smrv.2002.0261. [DOI] [PubMed] [Google Scholar]
  • 4.Osman AM, Carter SG, Carberry JC, Eckert DJ. Obstructive sleep apnea: current perspectives. Nat Sci Sleep. 2018;10:21–34. doi: 10.2147/NSS.S124657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Romero E, Krakow B, Haynes P, Ulibarri V. Nocturia and snoring: predictive symptoms for obstructive sleep apnea. Sleep Breath. 2010;14:337–343. doi: 10.1007/s11325-009-0310-2. [DOI] [PubMed] [Google Scholar]
  • 6.Simpson L, et al. High prevalence of undiagnosed obstructive sleep apnoea in the general population and methods for screening for representative controls. Sleep Breath. 2013;17:967–973. doi: 10.1007/s11325-012-0785-0. [DOI] [PubMed] [Google Scholar]
  • 7.Knauert M, Naik S, Gillespie MB, Kryger M. Clinical consequences and economic costs of untreated obstructive sleep apnea syndrome. World J Otorhinolaryngol Head Neck Surg. 2015;1:17–27. doi: 10.1016/j.wjorl.2015.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bonsignore MR, Borel AL, Machan E, Grunstein R. Sleep apnoea and metabolic dysfunction. Eur Respir Rev. 2013;22:353–364. doi: 10.1183/09059180.00003413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lim DC, Pack AI. Obstructive sleep apnea and cognitive impairment: addressing the blood-brain barrier. Sleep Med Rev. 2014;18:35–48. doi: 10.1016/j.smrv.2012.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jehan, S. et al. Depression, Obstructive Sleep Apnea and Psychosocial Health. Sleep Med Disord1 (2017). [PMC free article] [PubMed]
  • 11.Eisele HJ, Markart P, Schulz R. Obstructive Sleep Apnea, Oxidative Stress, and Cardiovascular Disease: Evidence from Human Studies. Oxid Med Cell Longev. 2015;2015:608438. doi: 10.1155/2015/608438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kapur VK. Obstructive sleep apnea: diagnosis, epidemiology, and economics. Respir Care. 2010;55:1155–1167. [PubMed] [Google Scholar]
  • 13.Casale M, et al. Obstructive sleep apnea syndrome: from phenotype to genetic basis. Curr Genomics. 2009;10:119–126. doi: 10.2174/138920209787846998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mukherjee S, Saxena R, Palmer LJ. The genetics of obstructive sleep apnoea. Respirology. 2018;23:18–27. doi: 10.1111/resp.13212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Stuehr Dennis J. Enzymes of the L-Arginine to Nitric Oxide Pathway. The Journal of Nutrition. 2004;134(10):2748S–2751S. doi: 10.1093/jn/134.10.2748S. [DOI] [PubMed] [Google Scholar]
  • 16.Hou YC, Janczuk A, Wang PG. Current trends in the development of nitric oxide donors. Curr Pharm Des. 1999;5:417–441. [PubMed] [Google Scholar]
  • 17.Tuteja N, Chandra M, Tuteja R, Misra MK. Nitric Oxide as a Unique Bioactive Signaling Messenger in Physiology and Pathophysiology. J Biomed Biotechnol. 2004;2004:227–237. doi: 10.1155/S1110724304402034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Levine AB, Punihaole D, Levine TB. Characterization of the role of nitric oxide and its clinical applications. Cardiology. 2012;122:55–68. doi: 10.1159/000338150. [DOI] [PubMed] [Google Scholar]
  • 19.Hermann M, Flammer A, Luscher TF. Nitric oxide in hypertension. J Clin Hypertens (Greenwich) 2006;8:17–29. doi: 10.1111/j.1524-6175.2006.06032.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tessari P, et al. Nitric oxide synthesis is reduced in subjects with type 2 diabetes and nephropathy. Diabetes. 2010;59:2152–2159. doi: 10.2337/db09-1772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen ZQ, Mou RT, Feng DX, Wang Z, Chen G. The role of nitric oxide in stroke. Med Gas Res. 2017;7:194–203. doi: 10.4103/2045-9912.215750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Haight JS, Djupesland PG. Nitric oxide (NO) and obstructive sleep apnea (OSA) Sleep Breath. 2003;7:53–62. doi: 10.1007/s11325-003-0053-4. [DOI] [PubMed] [Google Scholar]
  • 23.Lavie L, Hefetz A, Luboshitzky R, Lavie P. Plasma levels of nitric oxide and L-arginine in sleep apnea patients: effects of nCPAP treatment. J Mol Neurosci. 2003;21:57–63. doi: 10.1385/JMN:21:1:57. [DOI] [PubMed] [Google Scholar]
  • 24.Ip MS, et al. Circulating nitric oxide is suppressed in obstructive sleep apnea and is reversed by nasal continuous positive airway pressure. Am J Respir Crit Care Med. 2000;162:2166–2171. doi: 10.1164/ajrccm.162.6.2002126. [DOI] [PubMed] [Google Scholar]
  • 25.Devendran A, et al. Allele, Genotype and Haplotype Structures of Functional Polymorphic Variants in Endothelial Nitric Oxide Synthase (eNOS), Angiotensinogen (ACE) and Aldosterone Synthase (CYP11B2) Genes in Healthy Pregnant Women of Indian Ethnicity. J Reprod Infertil. 2015;16:180–192. [PMC free article] [PubMed] [Google Scholar]
  • 26.Niu W, Qi Y. An updated meta-analysis of endothelial nitric oxide synthase gene: three well-characterized polymorphisms with hypertension. PLoS One. 2011;6:e24266. doi: 10.1371/journal.pone.0024266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhu Y, et al. The genetic association between iNOS and eNOS polymorphisms and gastric cancer risk: a meta-analysis. Onco Targets Ther. 2018;11:2497–2507. doi: 10.2147/OTT.S161925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bayazit YA, et al. Role of nitric oxide synthase gene intron 4 and exon 7 polymorphisms in obstructive sleep apnea syndrome. Eur Arch Otorhinolaryngol. 2009;266:449–454. doi: 10.1007/s00405-008-0763-0. [DOI] [PubMed] [Google Scholar]
  • 29.Nassereddine S, et al. The polymorphism G894 T of endothelial nitric oxide synthase (eNOS) gene is associated with susceptibility to essential hypertension (EH) in Morocco. BMC Med Genet. 2018;19:127. doi: 10.1186/s12881-018-0638-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yasuda Y, et al. A functional polymorphism of the GTP cyclohydrolase 1 gene predicts attention performance. Neurosci Lett. 2014;566:46–49. doi: 10.1016/j.neulet.2014.02.019. [DOI] [PubMed] [Google Scholar]
  • 31.Heddini U, et al. GCH1-polymorphism and pain sensitivity among women with provoked vestibulodynia. Mol Pain. 2012;8:68. doi: 10.1186/1744-8069-8-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yan JT, et al. Polymorphisms of genes in nitric oxide-forming pathway associated with ischemic stroke in Chinese Han population. Acta Pharmacol Sin. 2011;32:1357–1363. doi: 10.1038/aps.2011.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Pierola J, et al. NADPH oxidase p22phox polymorphisms and oxidative stress in patients with obstructive sleep apnoea. Respir Med. 2011;105:1748–1754. doi: 10.1016/j.rmed.2011.08.006. [DOI] [PubMed] [Google Scholar]
  • 34.San Jose G, Fortuno A, Beloqui O, Diez J, Zalba G. NADPH oxidase CYBA polymorphisms, oxidative stress and cardiovascular diseases. Clin Sci (Lond) 2008;114:173–182. doi: 10.1042/CS20070130. [DOI] [PubMed] [Google Scholar]
  • 35.Sia CH, et al. Awareness and knowledge of obstructive sleep apnea among the general population. Sleep Med. 2017;36:10–17. doi: 10.1016/j.sleep.2017.03.030. [DOI] [PubMed] [Google Scholar]
  • 36.Xia N, et al. Resveratrol reverses endothelial nitric-oxide synthase uncoupling in apolipoprotein E knockout mice. J Pharmacol Exp Ther. 2010;335:149–154. doi: 10.1124/jpet.110.168724. [DOI] [PubMed] [Google Scholar]
  • 37.Wolkow PP, et al. GTP cyclohydrolase I gene polymorphisms are associated with endothelial dysfunction and oxidative stress in patients with type 2 diabetes mellitus. PLoS One. 2014;9:e108587. doi: 10.1371/journal.pone.0108587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lattimore JL, Wilcox I, Skilton M, Langenfeld M, Celermajer DS. Treatment of obstructive sleep apnoea leads to improved microvascular endothelial function in the systemic circulation. Thorax. 2006;61:491–495. doi: 10.1136/thx.2004.039164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Badran M, Golbidi S, Ayas N, Laher I. Nitric Oxide Bioavailability in Obstructive Sleep Apnea: Interplay of Asymmetric Dimethylarginine and Free Radicals. Sleep Disord. 2015;2015:387801. doi: 10.1155/2015/387801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yuksel M, Okur HK, Pelin Z, Ogunc AV, Ozturk L. Arginase activity and nitric oxide levels in patients with obstructive sleep apnea syndrome. Clinics (Sao Paulo) 2014;69:247–252. doi: 10.6061/clinics/2014(04)05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bendall JK, Douglas G, McNeill E, Channon KM, Crabtree MJ. Tetrahydrobiopterin in cardiovascular health and disease. Antioxid Redox Signal. 2014;20:3040–3077. doi: 10.1089/ars.2013.5566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Latremoliere A, Costigan M. GCH1, BH4 and pain. Curr Pharm Biotechnol. 2011;12:1728–1741. doi: 10.2174/138920111798357393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tegeder I, et al. GTP cyclohydrolase and tetrahydrobiopterin regulate pain sensitivity and persistence. Nat Med. 2006;12:1269–1277. doi: 10.1038/nm1490. [DOI] [PubMed] [Google Scholar]
  • 44.Doehring A, Antoniades C, Channon KM, Tegeder I, Lotsch J. Clinical genetics of functionally mild non-coding GTP cyclohydrolase 1 (GCH1) polymorphisms modulating pain and cardiovascular risk. Mutat Res. 2008;659:195–201. doi: 10.1016/j.mrrev.2008.04.007. [DOI] [PubMed] [Google Scholar]
  • 45.Lassegue B, Griendling KK. NADPH oxidases: functions and pathologies in the vasculature. Arterioscler Thromb Vasc Biol. 2010;30:653–661. doi: 10.1161/ATVBAHA.108.181610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wyche KE, et al. C242T CYBA polymorphism of the NADPH oxidase is associated with reduced respiratory burst in human neutrophils. Hypertension. 2004;43:1246–1251. doi: 10.1161/01.HYP.0000126579.50711.62. [DOI] [PubMed] [Google Scholar]
  • 47.Cascales A, et al. Association of anthracycline-related cardiac histological lesions with NADPH oxidase functional polymorphisms. Oncologist. 2013;18:446–453. doi: 10.1634/theoncologist.2012-0239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zhou Y, Zhao YC. Association between the nicotinamide adenine dinucleotide phosphate oxidase p22phox gene -A930G polymorphism and intracerebral hemorrhage. Mol Med Rep. 2015;11:3511–3516. doi: 10.3892/mmr.2015.3154. [DOI] [PubMed] [Google Scholar]
  • 49.Qin YW, et al. The A930G polymorphism ofP22phox (CYBA) gene but not C242T variation is associated with hypertension: a meta-analysis. PLoS One. 2013;8:e82465. doi: 10.1371/journal.pone.0082465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Heiss C, Rodriguez-Mateos A, Kelm M. Central role of eNOS in the maintenance of endothelial homeostasis. Antioxid Redox Signal. 2015;22:1230–1242. doi: 10.1089/ars.2014.6158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Huang PL. eNOS, metabolic syndrome and cardiovascular disease. Trends Endocrinol Metab. 2009;20:295–302. doi: 10.1016/j.tem.2009.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Moro MA, Cardenas A, Hurtado O, Leza JC, Lizasoain I. Role of nitric oxide after brain ischaemia. Cell Calcium. 2004;36:265–275. doi: 10.1016/j.ceca.2004.02.011. [DOI] [PubMed] [Google Scholar]
  • 53.Atkeson A, Jelic S. Mechanisms of endothelial dysfunction in obstructive sleep apnea. Vasc Health Risk Manag. 2008;4:1327–1335. doi: 10.2147/vhrm.s4078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Gad MZ, et al. Endothelial nitric oxide synthase (G894T) gene polymorphism in a random sample of the Egyptian population: comparison with myocardial infarction patients. Genet Test Mol Biomarkers. 2012;16:695–700. doi: 10.1089/gtmb.2011.0342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Chatsuriyawong S, et al. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea. BMC Med Genomics. 2013;6:29. doi: 10.1186/1755-8794-6-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Seckin Y, et al. Association of eNOS Gene Polymorphisms G894T and T-786C with Risk of Hepatorenal Syndrome. Gastroenterol Res Pract. 2016;2016:2579626. doi: 10.1155/2016/2579626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.El-Lebedy D. Interaction between endothelial nitric oxide synthase rs1799983, cholesteryl ester-transfer protein rs708272 and angiopoietin-like protein 8 rs2278426 gene variants highly elevates the risk of type 2 diabetes mellitus and cardiovascular disease. Cardiovasc Diabetol. 2018;17:97. doi: 10.1186/s12933-018-0742-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Sleep-related breathing disorders in adults: recommendations for syndrome definition and measurement techniques in clinical research. The Report of an American Academy of Sleep Medicine Task Force. Sleep22, 667–689 (1999). [PubMed]
  • 59.Chung F, Abdullah HR, Liao P. STOP-Bang Questionnaire: A Practical Approach to Screen for Obstructive Sleep Apnea. Chest. 2016;149:631–638. doi: 10.1378/chest.15-0903. [DOI] [PubMed] [Google Scholar]
  • 60.Johns MW. A new method for measuring daytime sleepiness: the Epworth sleepiness scale. Sleep. 1991;14:540–545. doi: 10.1093/sleep/14.6.540. [DOI] [PubMed] [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES