Glutaminyl‐tRNA Synthetase from Pseudomonas aeruginosa: Characterization, structure, and development as a screening platform

Abstract

Pseudomonas aeruginosa has a high potential for developing resistance to multiple antibiotics. The gene (glnS) encoding glutaminyl‐tRNA synthetase (GlnRS) from P. aeruginosa was cloned and the resulting protein characterized. GlnRS was kinetically evaluated and the K _M and k _cat ^obs, governing interactions with tRNA, were 1.0 μM and 0.15 s⁻¹, respectively. The crystal structure of the α₂ form of P. aeruginosa GlnRS was solved to 1.9 Å resolution. The amino acid sequence and structure of P. aeruginosa GlnRS were analyzed and compared to that of GlnRS from Escherichia coli. Amino acids that interact with ATP, glutamine, and tRNA are well conserved and structure overlays indicate that both GlnRS proteins conform to a similar three‐dimensional structure. GlnRS was developed into a screening platform using scintillation proximity assay technology and used to screen ~2,000 chemical compounds. Three inhibitory compounds were identified and analyzed for enzymatic inhibition as well as minimum inhibitory concentrations against clinically relevant bacterial strains. Two of the compounds, BM02E04 and BM04H03, were selected for further studies. These compounds displayed broad‐spectrum antibacterial activity and exhibited moderate inhibitory activity against mutant efflux deficient strains of P. aeruginosa and E. coli. Growth of wild‐type strains was unaffected, indicating that efflux was likely responsible for the lack of sensitivity. The global mode of action was determined using time‐kill kinetics. BM04H03 did not inhibit the growth of human cell cultures at any concentration and BM02E04 only inhibit cultures at the highest concentration tested (400 μg/ml). In conclusion, GlnRS from P. aeruginosa is shown to have a structure similar to that of E. coli GlnRS and two natural product compounds were identified as inhibitors of P. aeruginosa GlnRS with the potential for utility as lead candidates in antibacterial drug development in a time of increased antibiotic resistance.

1. INTRODUCTION

In recent years, infectious diseases have become increasingly difficult to treat as a result of resistance to therapeutic remedies by many bacteria. This antibiotic resistance is a major global problem and it has attracted a considerable amount of media attention. In a recent report from the Centers for Disease Control and Prevention, it was estimated that at least 23,000 individuals die each year in the United States from infections caused by pathogens exhibiting resistance to antibiotics.1 This public health threat can be attributed to several factors, including misuse as well as overuse of antibacterials in clinical as well as community settings, the tendency of bacteria to acquire resistance due to acquisition of efflux systems, and the low permeability of the bacterial membrane.2 Certain bacteria have become resistant to many antibiotics, and these multidrug‐resistant bacteria form a new group of “superbugs” in which there are no known drugs to treat them.3 One pathogen in this group that is of specific concern is Pseudomonas aeruginosa, an aerobic, Gram‐negative bacteria that is a common cause of healthcare‐associated infections including pneumonia, urinary tract infections, and bloodstream infections.4 The ability of this bacteria to form resilient biofilms on implanted medical devices such as catheters, as well as on general hospital surfaces and water sources, poses a threat to immunocompromised individuals resulting in higher mortality rates.5 Patients with cystic fibrosis are especially at risk, as P. aeruginosa colonizes the lungs of these patients forming biofilms, which leads to chronic infections and is a leading cause of death.6

The glutaminyl tRNA‐synthetase (GlnRS), encoded by the glnS gene, is an aminoacyl tRNA synthetase (aaRS), which functions by attaching amino acids to cognate tRNAs during protein biosynthesis. GlnRS is a class I tRNA synthetase, which is characterized by the presence of two amino acid consensus sequences, HIGH and KMSKS, located in the active site of the catalytic domain formed by the conserved Rossmann fold. GlnRS, along with glutamyl‐, and arginyl‐tRNA synthetases (GluRS and ArgRS) are the only three aaRS requiring the presence of cognate tRNA to form the aminoacyl‐adenylate intermediate.7 These three tRNA synthetases are further classified as Subclass Ib enzymes due to similar subunit structures.8

Aminoacylation of a tRNA with the cognate amino acid occurs via a two‐step esterification reaction. First, an aminoacyl‐adenylate intermediate is formed by the condensation of the amino acid and ATP. Next, the amino acid is transferred to the 2′‐ or 3′‐ hydroxyl group of the terminal adenosine of the cognate tRNA.9 The attachment of the correct amino acid to its cognate tRNA is vital for the fidelity of protein synthesis. This process is known as tRNA identity but different aaRSs have various different fidelity mechanisms to ensure accuracy.10 Unlike many other tRNA synthetases, GlnRS has no independent internal editing function to aid in discrimination of near‐cognate amino acids such as asparagine or glutamic acid.11 Instead, an induced‐fit binding mechanism for the binding specificity of glutamine (Gln) by GlnRS is promoted by conformational changes that occur in the active site as a result of binding the anticodon loop of tRNA^Gln.12 In addition, specific nucleotides that are considered to be identity elements in tRNA^Gln promote correct tRNA recognition by the cognate synthetase. The recognition is facilitated by positive elements that allow GlnRS to directly recognize cognate tRNA^Gln, and negative elements that block recognition of tRNA^Gln by non‐cognate synthetases.7 In addition to identity elements for binding the correct tRNA, competition by various aaRS proteins for binding cognate tRNAs plays a key role in specificity.13 The individual fit mechanism for binding specificity and the specific tRNA^Gln identify elements work together to ensure fidelity.

GlnRS is one of only two out of 20 aaRS enzymes, which is not found in all organisms, and some prokaryotes lack a tRNA synthetase to attach Gln to its cognate tRNA^Gln. When this is the case, tRNA^Gln is mischarged by a non‐discriminating (ND) GluRS resulting in Glu‐tRNA^Gln. The mischarged tRNA^Gln is then converted to Gln‐tRNA^Gln in an amidation reaction by a heterotrimeric amidotransferase.14 In P. aeruginosa, GluRS is the discriminating type and therefore does not attach a glutamic acid amino acid to tRNA^Gln, thus necessitating a functional form of GlnRS.15

The gene encoding GlnRS from P. aeruginosa was cloned and the resulting over‐expressed protein was purified and the kinetic parameters (K _M, V _max, and k _cat) governing the interaction with tRNA^Gln were determined. The crystal structure of the α₂ form of GlnRS was solved to 1.9 Å resolution. A high‐throughput screening platform was then developed and optimized to screen for potential anti‐infectives using scintillation proximity assay (SPA) technology. Out of 2,000 synthetic and natural chemical compounds, three compounds were identified that inhibited the activity of P. aeruginosa GlnRS. From these three compounds, after scaffold analysis and MIC determination, two were selected for additional characterization.

2. RESULTS

2.1. Protein expression and characterization

The glutaminyl‐tRNA synthetase gene (glnS) from P. aeruginosa was cloned, expressed and the resulting protein was purified to greater than 98% homogeneity (Figure S1). The aminoacylation assay described under Section 4 was used to analyze the activity of P. aeruginosa GlnRS and to determine the concentrations to be used in downstream assays (Figure 1a). The aminoacylation reaction occurs via two distinct enzymatic steps. First, binding of ATP and the cognate amino acid allows the formation of an aminoacyl‐adenylate. This results from the condensation of the amino acid substrate, in this case, Gln, and ATP, in which ATP is hydrolyzed releasing the β and γ phosphates as PP_i. With all but three of the aaRS enzymes (GluRS, GlnRS, and ArgRS), this reaction can occur in the absence of the tRNA and can be monitored using the ATP:PP_i exchange assay to determine the kinetic interaction of the enzyme with either ATP or the amino acid. The results of this assay are indicative of the ability of the enzyme to form an aminoacyl‐adenylate in the absence of tRNA followed by reversal of the reaction and subsequent radioactive labeling of ATP in the presence of saturating amounts of [³²P]PP_i. In this initial step, formation of an aminoacyl adenylate by GlnRS is “nonproductive” in the absence of tRNA^Gln, for reasons discussed in the next section. To confirm the requirement for tRNA^Gln in the formation of an aminoacyl‐adenylate by P. aeruginosa GlnRS, the ATP:PP_i exchange assay was monitored in the presence and absence of tRNA (Figure 1b). In the absence of tRNA^Gln (Figure 1b, Lane 1) there was no [³²P]ATP formed by the reversal of the condensation reaction. This indicated that no aminoacyl‐adenylate had formed. However, in the presence of increasing concentrations of tRNA^Gln, increased levels of [³²P]ATP were detected (Figure 1b, lanes 2–4). This indicated that in the presence of tRNA an aminoacyl‐adenylate was formed. However, the low level of radioactive ATP formed suggests that the reversal of the reaction is not a dynamic process, likely because the reaction goes to fulfillment and the tRNA is aminoacylated.

Figure 1.

Characterization of P. aeruginosa GlnRS. (a) Pseudomonas aeruginosa GlnRS was titrated into the aminoacylation assay as described in Section 4 at concentrations between 0.005 and 0.5 μM. Background activity was minimal and was subtracted from values at all concentrations of GlnRS. (b) ATP:PP_i exchange reaction to determine the requirement for the cognate tRNA in the formation of an aminoacyl adenylate by P. aeruginosa GlnRS. The reactions contained 0, 0.3, 0.6, and 1.2 μM tRNA^Gln in lanes 1, 2, 3, and 4, respectively. (c) Determination of the kinetic parameters with respect to tRNA^Gln for P. aeruginosa GlnRS in the aminoacylation reaction. Initial velocities were determined and the data were fit to a Michaelis–Menten steady‐state model using XLfit (IDBS) to determine K _m and V _max

Next, the kinetic interactions of P. aeruginosa GlnRS with its cognate tRNA substrate were determined using the aminoacylation assay. The initial rate for aminoacylation was determined at several concentrations of tRNA^Gln (0.5–2 μM) while holding the concentrations of ATP and Gln constant at 2.5 mM and 100 μM, respectively (Figure 1c). The initial velocities were modeled by fitting them to the Michaelis–Menten steady‐state model using XLfit (IDBS). The K _M and the observed enzyme turn‐over values (k _cat ^obs) were determined to be 1.0 μM and 0.15 s⁻¹ for P. aeruginosa GlnRS, which gave a k _cat ^obs/K _M value of 0.15 s⁻¹ μM⁻¹. The same values determined for Escherichia coli GlnRS were 0.15 μM, 0.2 s⁻¹, and 0.95 s⁻¹ μM⁻¹, respectively.16 The minor variation in the K _M values could be a result of the codon usage or tRNA^Gln isotype concentration variation found in P. aeruginosa relative to that in E. coli.

2.2. Structure and sequence analysis

Pseudomonas aeruginosa GlnRS incubated with MgCl₂ and adenylyl‐imidodiphosphate (AMPPNP) crystallized into space group P2 and crystals diffracted to 1.9 Å resolution with a single homodimer in the asymmetric unit (Figure 2a) (PDB ID: http://firstglance.jmol.org/fg.htm?mol=5BNZ). Despite the presence of MgCl₂ and AMPPNP in the crystallization conditions and AMPPNP and l‐glutamine in the soaking conditions, no evidence of any ligand was observed in the electron density. Data collection and refinement statistics are given in Table 1. Pseudomonas aeruginosa GlnRS formed a typical GlnRS structure containing five distinct domains: dinucleotide fold domain (DNF), acceptor stem binding domain (ABD), helical sub‐domain, proximal beta‐barrel, and distal beta‐barrel (Figure 2b).

Figure 2.

The crystal structure of P. aeruginosa GlnRS. (a) The three‐dimensional structure of P. aeruginosa GlnRS was solved to 1.9 Å resolution (PDB ID: http://firstglance.jmol.org/fg.htm?mol=5BNZ) as a single α₂ homodimer in the asymmetric unit. (b) Each monomer contained five distinct domains: dinucleotide fold domain (DNF) (blue), acceptor stem binding domain (ABD) (green), helical sub‐domain (magenta), proximal beta‐barrel (salmon), and distal beta‐barrel (yellow)

Table 1.

Data collection and refinement statistics for the crystal structure of P. aeruginosa GlnRS

Data collection
PDB code	http://firstglance.jmol.org/fg.htm?mol=5BNZ
Resolution (Å)	50–1.90 (1.95–1.90)
Space group	P2
Unit cell dimensions
a, b, c (Å)	109.01, 56.02, 127.14
α, β, γ, (°)	90.00, 99.41, 90.00
No. of unique reflections	119,747
R merge	9.5 (46.1)
Redundancy	5.0 (5.0)
Completeness (%)	99.8 (99.6)
l/σ	11.71 (3.31)
CC1/2	99.7 (83.9)
Refinement
Resolution (Å)	1.90 (1.95–1.90)
No. of protein atoms	8,743
No. of sulfate atoms	20
No. of Cl atoms	2
No. of water molecules	1,522
R working (R free)	18.8 (22.8)
R.M.S. deviations
Bond lengths (Å)	0.007
Bond angles (°)	1.006
Ave. B factors (Å2)
Protein	20.92
Sulfate	52.93
Cl	46.82
Water	32.23
Ramachandran plot
Favored region (%)	98.57
Allowed regions (%)	1.17
Outlier regions (%)	0.27

The structure of E. coli GlnRS with ATP and tRNA^Gln (PDB ID: 1GSG), with a glutaminyl‐adenylate analog and tRNA^Gln (PDB ID: 1QTQ) or without any ligands (PDB ID: 1NYL) has been well studied, primarily from the three‐dimensional structures of GlnRS from E. coli.17, 18, 19 More recently, the structure of GlnRS from Deinococcus radiodurans has been solved.20 This protein, albeit similar to the E. coli GlnRS, contains a unique C‐terminal Yqey domain and will not be discussed here. A comparison of the amino acid primary structure of E. coli and P. aeruginosa GlnRS reveals a high degree of sequence conservation and the residues that come in direct contact with ATP, Gln, and tRNA^Gln are highly conserved (Figure 3). This is consistent with alignment studies where a high level of sequence conservation was observed (average 68/56% similar/identical residues) when GlnRS was compared with 33 GlnRS proteins across the eubacterial phylum (Table S1). Interestingly, the greatest variation occurred when the amino acid sequence of P. aeruginosa GlnRS was compared with that of GlnRS from the epsilonproteobacteria phyla, in which there were only 47.3/38.6 similar/identical residues. The high level of sequence conservation indicates that recognition of the substrates and insurance of specificity in substrate selection likely occurs in a similar fashion in these enzymes.

Figure 3.

Amino acid sequence alignment of P. aeruginosa and E. coli GlnRS. The protein sequences were downloaded from the National Center for Biotechnology Information (NCBI). Accession numbers for GlnRS protein sequences of E. coli and P. aeruginosa are P00962 and Q9I2U8, respectively. Sequence alignments were performed using Vector NTI Advance (TM) 11.5.3 (Invitrogen). Identical amino acid residues are white letters on a black background and similar residues are black letters on a grey background. The positions of the HIGH and KMSKS motifs are boxed. Amino acid residues that interact with Gln (♦), ATP (●), and tRNA (■/□, acceptor stem/anticodon) are indicated

The DNF domain contains the catalytic active site of GlnRS and it is composed of two sections separated by the ABD domain. The first half contains the signature HIGH motif, while the KMSKS motif is contained within the second half of the DNF domain (Figure 3). This active site region contains binding sites for ATP and Gln as well as the acceptor stem of tRNA^Gln. The amino acids observed to form contacts with these substrates in the DNF of E. coli GlnRS are almost strictly conserved in the P. aeruginosa GlnRS (Figure 4). During the process of substrate binding, certain amino acid residues in the ABD make contact with the acceptor stem, guiding it through conformational rearrangements to the active site in the DNF domain.12 There is a high degree of sequence conservation seen in the alignment in Figure 3, and the residues contacting the acceptor stem of the tRNA in E. coli GlnRS are conserved or similar in the P. aeruginosa enzyme.

Figure 4.

Comparison of the active site structures of P. aeruginosa and E. coli GlnRS. In the overlay, P. aeruginosa GlnRS is shown in blue and E. coli GlnRS is shown in magenta. The aminoacyl adenylate mimic (Gln‐AMS) backbone is shown in green and the acceptor stem of tRNA^Gln is shown in gold. Amino acid residues interacting with the two substrates are labeled (P. aeruginosa/E. coli numbering)

The mechanism of identification of the cognate amino acid and discrimination of non‐cognate amino acids allows the aaRSs to be divided into two groups. The aaRS enzymes in the first group have a proofreading function in the form of an editing domain that ensures cognate acylation of tRNA. The editing occurs either at the pre‐transfer state, in which the mis‐activated amino acid‐adenylate is hydrolyzed before attachment to the 3′‐end of the cognate tRNA, or at the post‐transfer state, in which the non‐cognate amino acid of the mischarged tRNA is hydrolyzed.21 The other group of aaRS enzymes ensures cognate acylation of tRNA by a process other than editing. In the case of E. coli, GlnRS binds ATP and Gln as a result of structural rearrangements in the active site induced by cognate tRNA binding.17 This precludes the binding of other potential amino acid substrates besides Gln and glutamic acid. To distinguish between Gln and glutamic acid, two residues in the active site are essential (Figure 4): Arg30 (E. coli numbering) recognizes the carbonyl carbon of Gln through electrostatic interactions, and Tyr211 acts as a “negative determinant” against binding of glutamic acid by potentially forming hydrogen bonds with the two amide hydrogen of Gln, thereby stabilizing binding.11, 18 These residues are strictly conserved between E. coli and P. aeruginosa GlnRS.

The anticodon of the tRNA is a major determinate for the selection of the cognate tRNA, and the two carboxyl‐terminal domains of GlnRS make contacts with this region of the tRNA, acting to discriminate in favor of binding tRNA^Gln out of the pool of tRNAs.19 The three nucleotides composing the anticodon interact with specific amino acid residues. First, there are two isoacceptors for tRNA^Gln (CUG and UUG). The pocket for binding either U34 or C34 accommodates either of the pyrimidines but discriminates against a purine.22 Within the pocket U34/C34 appears to form hydrogen bonds with Arg410/Arg412 (P. aeruginosa/E. coli), allowing a certain amount of wobble room. Next, U35 has a tight binding pocket and movement is limited by interactions with a number of amino acid residues. Arg412, Lys401, and Arg520 (E. coli numbering) stabilize U35 through ionic interactions with the two adjacent phosphates. Arg520 also packs against one side of U35 and forms a hydrogen bond with the 2‐keto of the uracil base. Pro369 packs against the other side of U35, holding it rigidly in place. Arg341, Gln517, and Glu519 recognize U35 by forming hydrogen bonds with the 4‐keto group, N3, and the 2‐keto group, respectively, of the uracil ring. Finally, G36 fits into a pocket specific for the guanosine, which is recognized by hydrogen bonding of the guanidinium group of Arg402 to N7 and the 6‐keto group of guanine.22 All of these amino acid residues making contact with the anticodon are strictly conserved in GlnRS from both E. coli and P. aeruginosa (Figure 5) indicating a similar mechanism of action.

Figure 5.

Comparison of the anticodon binding regions of GlnRS from P. aeruginosa and E. coli. In the overlay, P. aeruginosa GlnRS is shown in blue and E. coli GlnRS is shown in magenta. The three nucleotides forming the anticodon of the tRNA are labeled (C34, U35, and G36). The anticodon of tRNA^Gln is shown in gold. Amino acid residues interacting with the nucleotides forming the anticodon are labeled (P. aeruginosa/E. coli numbering)

2.3. Screening for inhibitors of P. aeruginosa GlnRS activity

Using SPA technology, the activity of GlnRS in the aminoacylation assay was screened against three chemical compound libraries to identify inhibitory compounds. First, a collection of 320 natural products, mostly derived from plants, was from the Prestwick Phytochemical Library. The second was the NatProd Collection from Microsource Discovery Systems, composed of 800 natural products, including simple and complex oxygen heterocycles, alkaloids, sesquiterpenes, diterpenes, pentacyclic triterpenes, and sterols. Finally, the Anti‐infective Library from TimTec, LLC contained 890 low‐molecular‐weight synthetic compounds with scaffolds based on known antibacterial, antifungal, and antimicrobial agents. The assay detects the ability of GlnRS to aminoacylate tRNA^Gln and to measure the effect of a chemical compound on the aminoacylation activity. Chemical compounds were dissolved in 100% dimethyl sulfoxide (DMSO) resulting in final DMSO concentrations of 4% in the screening assays. To determine the effect on the enzymatic activity, DMSO was added to the aminoacylation assay at increasing amounts. There was no decrease in activity observed in the aminoacylation assays containing up to 7% DMSO and only a moderate decrease in activity to 10% DMSO (Figure 6a). Next, tRNA was titrated into the assay to determine the concentration of tRNA^Gln to be used in the screening assay with the goal of ensuring that the amount of tRNA^Gln used would be within the linear region of the reaction‐detection time (Figure 6b). From the titration reactions, ~1 μM tRNA^Gln was selected for use in the screening assays. The other components of the assay were also optimized for maximum activity (Figure S2). The chemical compound concentration in the initial screening assays was 132 μM and screening was carried out as single point assays. Compounds observed to inhibit at least 50% of enzymatic activity were re‐assayed in triplicate. These assays resulted in three confirmed hit compounds, BM02E04, BM04B05, and BM04H03, all from the natural product library (Figure 7). Initially, the potency of the compounds for inhibiting the enzymatic activity of GlnRS was determined (Figure 8). To do this, the compounds were titrated into aminoacylation assays, resulting in concentrations of compound ranging from 200 to 0.4 μM. The IC₅₀ values for BM02E04, BM04B05, and BM04H03 were determined to be 1.9, 2.5, and 40 μM, respectively.

Figure 6.

Screening assay development. (a) Effect of DMSO in the P. aeruginosa GlnRS aminoacylation assay. DMSO (0–10%) was added into the aminoacylation assay described in Section 4.7. (b) To determine the tRNA concentration to be used in screening assays and to determine that the amount of tRNA^Gln used would be within the linear region of the reaction‐detection time, tRNA was added into the aminoacylation assay described in Section 4.7 The activity was monitored using SPA technology

Figure 7.

The chemical structure of the hit compounds. The structure of (a) BM02E04, (b) BM04H03, and (c) BM04B05

Figure 8.

Determination of the IC₅₀ values of the hit compounds. IC₅₀ values for the inhibitory potency of (a) BM02E04, (b) BM04B05, and (c) BM04H03 against the aminoacylation activity of P. aeruginosa GlnRS were 1.9, 2.5, and 40 μM, respectively. The compounds were serially diluted from 200 to 0.4 μM into aminoacylation assays containing P. aeruginosa GlnRS at 0.12 μM. The “% Positive” indicates the percent of activity observed relative to activity in assays where only DMSO was added to the assay in the absence of compound. The curve fits and IC₅₀ values were determined using the Sigmoidal Dose–Response Model in XLfit 5.3 (IDBS)

2.4. Microbiological assays

The three hit compounds were tested in broth microdilution assays to determine minimum inhibitory concentrations (MICs) against a panel of 10 pathogenic bacteria, including efflux pump mutants of E. coli and P. aeruginosa and a hypersensitive strain of P. aeruginosa (Table S2). Quality control of test antibiotics was monitored by testing against the same panel of bacteria (Table S3). BM02E04 inhibited the growth of all Gram‐positive organisms: Staphylococcus aureus and Streptococcus pneumoniae at 64 μg/ml and Enterococcus faecalis at 4 μg/ml. BM04H03 inhibited growth of E. faecalis, S. aureus, and S. pneumoniae with MIC values of 64, 8, and 64 μg/ml. These two compounds, BM02E04 and BM04H03, had good MICs against the Gram‐negative Moraxella catarrhalis (32 and 0.125 μg/ml, respectively). Interestingly, cultures of the respiratory pathogen, Haemophilus influenzae, were only slightly affected by the compounds. BM02E04 exhibited a modest MIC against the mutant form of E. coli (E. coli tolC), while BM04H03 showed a significant decrease in the MIC value against the efflux deficient stain. When compared with the lack of inhibition of the wild‐type strain, this indicated that efflux was a likely mechanism for the lack of sensitivity. Both compounds were also observed to have a low level of activity against P. aeruginosa PA200, the efflux pump mutant, and the hypersensitive strain, again indicating that the lack of sensitivity of the wild‐type P. aeruginosa may be due to efflux. There was no activity observed against the wild‐type strains of either E. coli or P. aeruginosa at concentrations below 128 μg/ml. Based on compound scaffold analysis and broad‐spectrum activity against both Gram‐positive and Gram‐negative pathogens, two of the compounds, BM02E04 and BM04H03, were selected for further analysis.

Next, time‐kill kinetic studies were performed to determine the global mode of inhibition of bacterial growth in cultures. Based on MIC results, both compounds were tested against cultures of the Gram‐positive bacteria, S. aureus, and the Gram‐negative M. catarrhalis. All cultures contained compounds at four times the MIC and samples were analyzed between 0 and 24 hr (Figure 9a,b). Both BM02E04 and BM04H03 were observed to inhibit S. aureus with a bacteriostatic global mode of inhibition. They displayed constant growth but a decrease in colony‐forming units (CFU) of 2–6 log₁₀ compared to the control during the initial 6 hr. BM04H03 was also observed to inhibit the growth of the Gram‐negative M. catarrhalis, with a bacteriostatic mode of inhibition. However, BM02E04 was bactericidal when tested against M. catarrhalis and inhibited bacterial growth by killing the bacteria.

Figure 9.

Activity of BM02E04 and BM04H03 in microbiological assays. The activity of the hit compounds against the growth of cultures containing (a) S. aureus, and (b) M. catarrhalis bacteria were determined using broth microdilution susceptibility testing. Compounds were added to bacterial cultures at 4× MIC. Samples were analyzed by plating and determination of colony‐forming units (CFU) at 0, 2, 4, 6, and 24 hr. Diamonds (♦) represent cultures containing BM04H03 and squares (■) represent cultures containing BM02E04. Circles (●) represent the growth of control cultures containing only DMSO in the absence of compound. Toxicity of (c) BM02E04 and (d) BM04H03 was measured using human embryonic kidney 293 (HEK‐293) cell cultures. The compound concentrations ranged from 25 to 400 μg/ml. The data points represent an average value for assays carried out in triplicate. The “% Positive” indicates the percent of cell growth observed relative to growth in assays where only DMSO was added to the cells in the absence of compound

(3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide) (MTT) assays were performed to examine whether the hit compounds, BM02E04 and BM04H03, were cytotoxic to human cells, and if they were toxic, to determine the concentration at which growth was inhibited by 50% (CC₅₀). Human embryonic kidney 293 (HEK293) cells were treated with concentrations of each compound separately at 25–400 μg/ml for 24 hr under standard tissue culture conditions in triplicate. There was only a slight decrease in cell viability in the presence of BM02E04 at the highest concentration tested (400 μg/ml) and BM04H03 was not observed to be toxic to cells at any concentration tested (Figure 9c,d). The low level of toxicity observed in these early tests is advantageous in the development of potential antimicrobial agents and indicates that both compounds may be amenable to further development as therapeutics.

3. DISCUSSION

The aminoacyl‐tRNA synthetases are essential components of protein synthesis and are vital for cell growth in all organisms. In the quest for discovery of new and different agents with which to fight bacterial infections, it is important that the molecular targets upon which these agents act be sufficiently distinct when compared with the eukaryotic homolog. The group of aaRS enzymes from bacterial origins as a whole is divergent in amino acid primary structure compared with that of eukaryotic counterparts. This difference makes them good targets for the development of new antibacterial agents. When P. aeruginosa GlnRS was compared with the human cytosolic form of GlnRS (hGlnRS), there were only 40.6/31.8% similar/identical amino acids observed. However, this is bit misleading since the hGlnRS contains an N‐terminal 200 amino acid domain that functions in the formation of a multi‐synthetase complex that is not part of the bacterial GlnRS.23 When this domain was removed from the amino acid sequence of hGlnRS and the truncated polypeptide was compared with the full amino acid sequence of P. aeruginosa GlnRS, the percentage of similar/identical residues increased to 57.5/45.0, respectively. This degree of amino acid sequence similarity observed between human and P. aeruginosa GlnRS is higher than the similarity between eukaryotic and prokaryotic aaRS enzymes in general. However, when BM02E04 and BM04H03 were tested in human cell cultures, there was almost a complete absence of toxicity, indicating these compounds did not target the human enzyme and do have good potential for development as therapeutic agents. The amino acid sequence of P. aeruginosa GlnRS, when compared to homologs from other members of the eubacteria phyla contained ~68/56% similar/identical sequence conservation. This increased level of sequence conservation may argue for broad‐spectrum activity against various bacteria, which is also supported by the finding in MIC testing that these compounds were observed to be active against both Gram‐negative and Gram‐positive pathogens.

We show here the three‐dimensional crystal structure for P. aeruginosa GlnRS solved to 1.9 Å, which allows identification and comparison of regions critical for enzymatic function relative to the well‐studied E. coli enzyme. The structure of E. coli GlnRS was previously solved bound to each of the three substrates (ATP, Gln, and tRNA^Gln), which allows us to directly compare essential amino acid residues making contact with the substrates. In this comparison, we found that the critical amino acid residues were structurally conserved, indicating likely conservation of function as well as structure.

SPA technology was used to develop a screen for inhibitors of the activity of P. aeruginosa GlnRS. The screening assays were robust and resulted in Z′ and Z factors of approximately 0.55 and 0.33, respectively, across all plates. The signal to background ratio of the unaffected enzyme activity to the ethylenediaminetetraacetic acid (EDTA) controls was approximately 6:1. From over 2,000 compounds, five compounds from the TimTec LLC compound library and 15 from the MicroSource Discovery Systems were identified that inhibited the activity of P. aeruginosa GlnRS. After removing compounds that had activity against multiple aaRS enzymes from P. aeruginosa, three compounds, BM02E04, BM04B05, and BM04H03, were chosen for additional analysis. All three compounds exhibited inhibition of enzymatic activity. However, structure analysis and the lack of activity against bacteria in culture resulted in the removal of BM04B05 from further consideration. BM02E04 and BM04H03 exhibited moderate MICs against Gram‐positive bacteria as well as against efflux mutant forms of E. coli and P. aeruginosa. Time‐kill studies indicated that these two compounds were bacteriostatic against the cultures of S. aureus. This would be the expected mode of action for compounds that inhibit the activity of an aaRS, since inhibition of the aminoacylation activity mimics starvation for amino acids by lowering the ratio of charged to uncharged tRNA, and induces the stringent response resulting in static bacterial growth. BM04H03 was also bacteriostatic against cultures of the Gram‐negative M. catarrhalis. However, BM02E04 displayed a bactericidal mode of inhibition in these bacterial cultures. The bactericidal form of inhibition observed with BM02E04 may be due to inhibition of secondary roles and functions as well as inhibition of the aminoacylation function. Many secondary roles have been observed for members of the aaRS group of enzymes.24

A search of PubChem identified BM02E04 as purpurogallin‐4‐carboxylic acid (CID: 269315). There is little data on the bioactivity of this compound, but it has been shown to be active as an antioxidant and in PubChem bioassays (AID:1259374) to decrease the activity of human microphthalmia‐associated transcription factor. The core scaffold (purpurogallin) is a natural phenol and it has shown activity in numerous PubChem bioassays.

BM04H03 was identified in PubChem as cryptotanshinone (CID: 160254). Cryptotanshinone, a diterpene quinone, is isolated from the roots of the plant Salvia miltiorrhiza Bunge and has been widely used in traditional Chinese medicine for treatment of a variety of diseases. Recently, cryptotanshinone has been shown to have anticancer activity.25 The finding that these natural product compounds are bio‐active in a number of assays, may reduce the potential for development as an antibacterial, since this may increase the likelihood of toxicity. However, cryptotanshinone has been shown to be well tolerated in numerous clinical settings.

As noted above, both BM02E04 and BM04H03 were observed to have moderate MIC values against the three Gram‐positive bacteria, E. faecalis, S. aureus, and S. pneumoniae. This is an interesting observation since these three organisms do not contain a GlnRS enzyme; instead, they contain a ND GluRS, which charges both tRNA^Glu and tRNA^Gln with glutamic acid. The ND‐GluRS from these three Gram‐positive bacteria as well as GlnRS from numerous other eubacteria (see Table S1) must all recognize tRNA^Gln as a cognate tRNA. When we carried out BLAST searches against the E. faecalis, S. aureus, and S. pneumoniae databases using the P. aeruginosa GlnRS amino acid sequence as the query sequence, the ND‐GluRS proteins were the primary hits. The “sequences producing significant alignments” portion of the various ND‐GluRS proteins in the BLAST results ranged from 303 amino acid residues to the full‐length proteins, and in the alignments with the corresponding amino acid sequence of GlnRS from P. aeruginosa revealed a high degree of conservation. In particular, we aligned the overall amino acid sequence of GlnRS from P. aeruginosa with that of the ND‐GluRS from S. pneumoniae (accession VTQ31436), the results indicated a similar conservation of amino acids (71/60%, similar/identical) as observed when the sequence of P. aeruginosa GlnRS was compared with the amino acid sequence of GlnRS from other eubacteria (Table S1). It is an intriguing possibility that inhibition by these compounds of the growth of these bacteria in culture may be the result of inhibition of the ND‐GluRS proteins. Further work will be necessary to determine whether BM02E04 and BM04H03 also target the ND‐GluRS proteins of these bacteria.

4. METHODS AND MATERIALS

4.1. Materials

All chemicals were obtained from Fisher Scientific (Pittsburg, PA). DNA oligonucleotides were from Integrated DNA Technologies (Coralville, IA). DNA sequencing was performed by Functional Bioscience (Madison, WI). Radioactive isotopes, SPA beads, and 96‐well screening plates were from PerkinElmer (Waltham, MA). The natural compound libraries were from MicroSource Discovery Systems (Gaylordsville, CT) and Prestwick Chemical, Inc. (Strasbourg‐Illkirch, France), and the synthetic compound library was from TimTec LLC (Newark, DE). Compounds stocks were dissolved in DMSO to a concentration of 10 mM, stored at −20°C and thawed immediately before analysis. The compounds had an average purity of 95%, and the minimum purity is at least 90%.

4.2. Cloning and purification

Polymerase chain reaction was used to amplify the gene encoding P. aeruginosa GlnRS (MJ Mini Thermo Cycler, Bio‐Rad, Hercules, CA) using P. aeruginosa PAO1 (ATCC 47085) genomic DNA as a template. An NheI restriction site was added at the 5′ end of the gene using a forward primer (5′‐CCAAGCTAGCAAGCCAGAGACCACC‐3′) and a HindIII restriction site was added at the 3′ end using a reverse primer (5′‐ CAACAAGCTTTCAGCCCTGTCCCCAG‐3′). The amplified gene was inserted into the pET‐28b(+) plasmid (Novagen) digested with NheI and HindIII restriction enzymes. This recombinant plasmid was transformed into E. coli Rosetta 2 (DE3) Singles Competent Cells (EMD Millipore, Danvers, MA).

Bacterial cultures were grown in Terrific Broth containing 25 μg/ml of kanamycin and 50 μg/ml of chloramphenicol at 37°C. At an optical density (A₆₀₀) of 0.6, the overexpression of P. aeruginosa GlnRS was induced by the addition of isopropyl β‐d‐1‐thiogalactopyranoside to a concentration of 0.5 mM. The culture was grown for 4 hr post‐induction and bacteria were harvested by centrifugation (10,000g, 4°C, 45 min). Fraction I lysates were prepared26 and purification of P. aeruginosa GlnRS was initiated by the addition of ammonium sulfate to 60% saturation resulting in precipitation of the target enzyme. Pseudomonas aeruginosa GlnRS was further purified using nickel‐nitrilotriacetic acid affinity chromatography (Perfect Pro, 5 Prime)27 and then dialyzed twice against a buffer (2 L) containing: 20 mM Hepes‐KOH (pH 7.0), 40 mM KCl, 1 mM MgCl₂, 0.1 mM EDTA, and 10% glycerol. Purified protein was aliquoted and flash‐frozen in liquid nitrogen.

4.3. Gel electrophoresis and protein assays

For sodium dodecyl sulfate‐polyacrylamide gel electrophoresis, 4–12% polyacrylamide precast gradient gels (Novex NuPAGE; Invitrogen) were used with 3‐(N‐morpholino)propanesulfonic acid as the running buffer (Invitrogen). The gels were stained with Simply Blue Safe Stain (Invitrogen) to visualize the proteins. The protein standard was the EZ‐Run Rec Ladder (Fisher Scientific). Coomassie Protein Assay Reagent (Thermo Scientific, Waltham, MA) was used to determine protein concentrations with bovine serum albumin as a standard.

4.4. ATP:PP_i exchange reactions

ATP:PP_i exchange reactions (100 μl) were carried out at 37°C for 20 min in 50 mM Tris–HCl (pH 7.5), 10 mM KF, 8 mM MgOAc, 1 mM dithiothreitol (DTT), 2 mM [³²P]PP_i (50 cpm/pmol), 2 mM ATP, 2 mM Gln and 0.2 μM of P. aeruginosa GlnRS as described.15 The reactions were carried out in the absence and in the presence of tRNA^Gln (0.3, 0.6, 1.2 μM).

4.5. Timed tRNA aminoacylation assay

Aminoacylation reactions were used to determine initial velocities at various concentrations of tRNA^Gln. These reactions were carried out at 37°C and stopped at time intervals ranging from 1 to 5 min. Reactions (50 μl) contained a component mixture to yield final concentrations of 50 mM Tris–HCl (pH 7.5), 5 mM MgCl₂, 2.5 mM ATP, 1 mM DTT, 75 μM [³H]Gln (50 cpm/pmol), and 0.025 μM P. aeruginosa GlnRS. Reactions were initiated by the addition of tRNA^Gln at varying concentrations (0.5–2.0 μM). Reactions were stopped by the addition of 2 ml of 5% (v/v) ice‐cold trichloroacetic acid (TCA), placed on ice for 10 min, and then filtered through glass fiber filters (Millipore, type HA 0.45 mm). Filters were washed with 10 ml ice‐cold 5% TCA and dried. The filters were analyzed using an LS6500 multipurpose scintillation counter (Beckman Coulter). Initial velocities for aminoacylation were calculated for all tRNA concentrations. Data were fit to the Michaelis–Menten steady‐state model to determine the K _M and V _max values.

4.6. Crystallography and structure determination

Pseudomonas aeruginosa GlnRS was cloned, expressed, and purified for crystallography as described.28 In preparation for crystallography, the GlnRS protein was concentrated to 20.0 mg/ml (SSGCID batch ID PsaeA.18222.aB1.PW37623), and incubated with 2.5 mM MgCl₂ and 2.5 mM AMPPNP for 10 min at 290 K. Crystals were then grown at 290 K by sitting drop vapor diffusion with 0.4 μl of protein/ligand complex mixed with 0.4 μl of a condition based on Microlytic MCSG1, well c2:23% (w/v)PET‐3350, 0.2 M lithium sulfate, and 0.1 M Bis‐Tris:HCl (pH 6.5). Crystals were looped and soaked in reservoir solution supplemented with 20% ethylene glycol, 2.5 mM l‐glutamine, 2.5 mM MgCl₂, and 2.5 mM AMPPNP and flash‐frozen in liquid nitrogen. Data were collected at 100 K on a Rayonix MX‐225 mm CCD detector at a wavelength of 0.97872 Å on beamline 21‐ID‐F at Life Sciences Collaborative Access Team (LS‐CAT) at the Advanced Photon Source (APS, Argonne, IL). Data were reduced with the XDS/XSCALE package (REF).29 The structure was solved using molecular replacement with BALBES30 and 1NYL as a starting model. Iterative rounds of manual model building and automated refinement were carried out using Coot31 and Phenix.32 The structure was quality checked with Molprobity.33

4.7. Chemical compound screening

The tRNA aminoacylation assay was developed into a screening platform for the identification of inhibitory compounds using SPA technology. Screening reactions were carried out in 96‐well microtiter plates. Test compounds, dissolved in 100% DMSO (2 μl of compound; 3.3 mM), were equilibrated by the addition of 33 μl of the component mixture described above and incubated at ambient temperature for 15 min. Control reactions contained DMSO in the absence of a compound. Other control assays to yield an assay baseline were carried out in the presence of 50 μM EDTA. The concentration of P. aeruginosa GlnRS was 0.12 μM. Reactions were initiated by the addition of 15 μl E. coli tRNA (~1.0 μM tRNA^Gln) and incubated for 1 hr at 37°C. Reactions were stopped by the addition of 5 μl of 0.5 M EDTA. Four hundred micrograms of yttrium silicate (Ysi) poly‐l‐lysine coated SPA beads (Perkin‐Elmer) in 150 μl of 300 mM citric acid were added to the reaction and allowed to incubate at room temperature for 1 hr. Reactions were analyzed using a 1450 Microbeta (Jet) liquid scintillation/luminescent counter (Wallac). Assays to determine IC₅₀ values were performed with the test compounds serially diluted from 200 to 0.4 μM. The IC₅₀ was determined by fitting the data to a Sigmoidal Dose–Response Model using XLfit (IDBS).

4.8. Microbiological assays

Broth microdilution MIC testing was carried out according to Clinical Laboratory Standards Institute guidelines M7‐A7.34 MIC values were determined against a panel of bacteria, which included E. coli (ATCC® 25922), E. coli TolC mutant, Enterococcus faecalis (ATCC® 29212), Haemophilus influenzae (ATCC® 49766), Moraxella catarrhalis (ATCC® 25238), P. aeruginosa (ATCC® 47085), P. aeruginosa PAO200 (efflux pump mutant), P. aeruginosa hypersensitive strain (ATCC® 35151), Staphylococcus aureus (ATCC® 29213), and Streptococcus pneumonia (ATCC® 49619).

Time‐kill studies were performed using M. catarrhalis and S. aureus based on the MIC assay results, according to CLSI document M26‐A.35 Growth media was Brain Heart Infusion and Trypticase Soy Broth from Remel (Lenexa, KS). The compound concentration was four times the MIC.

4.9. In vitro cytotoxicity test

The toxic effect of each compound on the growth of human cell cultures was determined as described using human embryonic kidney 293 cells (HEK‐293).15 MTT assays were carried out in triplicate at each compound concentration (25–400 μg/ml). Student's two‐tiered t test was utilized to assess statistical significance.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Supporting information

Supplemental Figure S1. Purification of P. aeruginosa GlnRS. Purified P. aeruginosa GlnRS was analyzed on a 4–20% SDS‐PAGE gel and the protein bands were visualized by staining with Coomassie blue. Lane #1, contains 10‐200 kDa protein standard; lane #2 contains 4 μg of purified P. aeruginosa GlnRS; and lane #3 contains 2 μg of purified P. aeruginosa GlnRS. To ensure that optimum conditions were used in the aminoacylation assay during the screening campaign, the concentration of all non‐enzymatic components yielding the highest enzymatic output was determined. This included the Mg divalent ionic compound best suited for GlnRS activity. We first test the preference for MgCl₂ versus MgOAc (Suppl. Fig. S2). Spermine is a polyamine that stabilizes the helical structure of nucleic acids and has historically been used in aminoacylation assays. Finally, to maintain a low level of cost for radiolabeled glutamine, the concentration of amino acid that would give the best results in the screening assay was determined.

Supplemental Figure S2. Titration of non‐enzymatic components of the aminoacylation assay to determine the concentration to be used in the screening assay. First, to determine the ionic compound yielding Mg⁺⁺ best suited for the GlnRS aminoacylation assay, (A) MgCl₂ and (B) MgOAc were tested. Next, a titration of spermine (C) to determine the optimal amount to be used in the screening assay. Finally, the [³H]glutamine (50 cpm/pmol) was monitored to determine the lowest concentration yielding optimal activity. Free [³H]glutamine bound by the SPA beads was minimal and was subtracted from [³H]glutamine ligated to tRNA^Gln at each concentration of glutamine.

Table S1. The conservation of amino acids in P. aeruginosa GlnRS relative to GlnRS from various other eubacteria

Table S2. MIC values of the hit compounds observed to inhibit the activity of P. aeruginosa GlnRS.

Table S3. Minimum inhibitory concentration of quality control antibiotics against the panel of pathogenic bacteria.

Escamilla Y, Hughes CA, Abendroth J, et al. Glutaminyl‐tRNA Synthetase from Pseudomonas aeruginosa: Characterization, structure, and development as a screening platform. Protein Science. 2020;29:905–918. 10.1002/pro.3800