Abstract
Although acute promyelocytic leukemia (APL) is one of the most characterized forms of acute myeloid leukemia (AML), the molecular mechanisms involved in the development and progression of this disease are still a matter of study. APL is defined by the PML-RARA rearrangement as a consequence of the translocation t(15;17)(q24;q21). However, this abnormality alone is not able to trigger the whole leukemic phenotype and secondary cooperating events might contribute to APL pathogenesis. Additional somatic mutations are known to occur recurrently in several genes, such as FLT3, WT1, NRAS and KRAS, whereas mutations in other common AML genes are rarely detected, resulting in a different molecular profile compared to other AML subtypes. How this mutational spectrum, including point mutations in the PML-RARA fusion gene, could contribute to the 10%–15% of relapsed or resistant APL patients is still unknown. Moreover, due to the uncertain impact of additional mutations on prognosis, the identification of the APL-specific genetic lesion is still the only method recommended in the routine evaluation/screening at diagnosis and for minimal residual disease (MRD) assessment. However, the gene expression profile of genes, such as ID1, BAALC, ERG, and KMT2E, once combined with the molecular events, might improve future prognostic models, allowing us to predict clinical outcomes and to categorize APL patients in different risk subsets, as recently reported. In this review, we will focus on the molecular characterization of APL patients at diagnosis, relapse and resistance, in both children and adults. We will also describe different standardized molecular approaches to study MRD, including those recently developed. Finally, we will discuss how novel molecular findings can improve the management of this disease.
Keywords: acute promyelocytic leukemia, APL, NGS, minimal residual disease, MRD, PML-RARA, isoform, relapse, splicing
1. Introduction
Acute promyelocytic leukemia (APL) is a biologically and clinically distinct subtype of acute myeloid leukemia (AML) with unique molecular pathogenesis, clinical manifestations and treatment that is cytogenetically characterized by a balanced translocation t(15;17) (q24;q21) [1,2,3]. This translocation involves the retinoic acid receptor alpha (RARA) gene on chromosome 17 and the promyelocytic leukemia (PML) gene on chromosome 15 that results in a PML-RARA fusion gene [4,5,6,7]. This fusion gene has been demonstrated to be responsible for cellular transformation, and confers a particular sensitivity to treatment with differentiating agents such as all-trans-retinoic acid (ATRA) plus chemotherapy or ATRA plus arsenic-trioxide (ATO), converting this once fatal leukemia into a highly curable disease both for pediatric and adult patients (cure rates of approximately 90%) [8,9,10,11]. The present review discusses some of the most recent findings concerning the molecular genetics of APL, beyond the PML-RARA fusion gene and its variants, both at diagnosis and relapse; and includes the main strategies for minimal residual disease (MRD) monitoring in patients.
2. Pathophysiology of APL
The PML-RARA fusion gene is the most critical event involved in the pathogenesis of APL. This derives from a cytogenetic translocation leading to the rearrangement of PML and RARA genes [4,5,6,7].
PML is located in chromosome band 15q24, and contains nine exons producing several alternative spliced transcripts [12]. All the PML isoforms share the N-terminal region, harboring the RING-B-Box-Coiled-coil/tripartite motif (RBCC/TRIM) domain (encoded by exons 1 to 3); but differ either in the central (exons 4, 5 and 6) or in the C-terminal regions, due to alternative splicing (Figure 1). PML I, the longest one, which is distributed both in the nucleus and in the cytoplasm, is the only isoform containing a nuclear export signal (NES, exon 9) domain [12,13]. PML is mainly involved in tumor suppression and genomic instability [12,14,15,16], through it has constitutive or transient interactions with more than 170 proteins [17]. Most of these interactions are mediated either by the RBCC domain, which allows PML multimerization and organization in subnuclear structure, defined as nuclear bodies (NBs) [14,18,19]; or by other PML isoform-specific domains [20,21,22]. Therefore, through the creation of different binding interfaces, PML can be involved in several functional pathways, including p53-dependent and -independent apoptosis and senescence [23,24,25,26], stem cell self-renewal [16,27], epigenetic regulation and transcription of hematopoietic stem cells [20,21,28,29].
RARA is located in chromosome band 17q21, and comprises 10 exons encoding two isoforms, RARA1 and RARA2. Due to alternative promoter and exon usage, and alternative splicing, RARA isoforms differ from one another in the N-terminal Activation Function 1 (AF-1) domain (Figure 1) [30]. The RARA protein is a member of the nuclear receptor superfamily with high homology (90%) with RARB and RARG. This serves as a nuclear transcription factor when it is activated by retinoids, a class of molecules that are vitamers of vitamin A [31]. In the presence of the ligands, RARA forms heterodimers with retinoid X receptor (RXR) cofactor in order to bind specific cis-acting motifs (i.e., retinoic acid responsive elements, RARE), within the promoter region of the targeted gene (e.g., RARA2) [31,32]. However, in the absence of ligands, RARA/RXR dimers interact with nuclear corepressors, such as the silencing mediator of retinoid and thyroid hormone receptor (SMRT) and the nuclear receptor corepressor (N-CoR). The protein complexes thus formed cooperate with scaffolding proteins involved in the regulation of the gene transcription (i.e., Switch-Independent 3 A or B, Sin3A or Sin3B) and histone deacetylases (HDACs), resulting in nucleosome assembly and transcriptional repression [33]. Through this ligand presence-dependent switch, RARA acts as a differentiating agent of normal myeloid hematopoietic cells [34].
In APL, PML-RARA alters the nuclear structure of NBs, leading to their disruption into nuclear microspeckles [17]. This is likely due to the lack of the SUMO-binding motif within the PML moiety of the chimeric protein [14], and is a diagnostic hallmark of APL [17]. The PML-RARA oncogenic activity is exerted both through a dominant-negative and a gain-of-function effect [35,36]. This seems to be possible since PML-RARA fusion protein keeps the capacity to multimerize (conferred by the PML moiety) with several classes of protein, including the same PML, and other transcription and epigenetic factors [37,38,39]. On the one hand, PML-RARA produces a block of myeloid differentiation at the promyelocytic stage [40,41]. In this case, PML-RARA represses the transcription of several genes implicated in myeloid differentiation, such as those involved in the differentiation towards the granulocyte lineage, in a manner insensitive to physiological levels of retinoic ligands [42,43]. On the other hand, PML-RARA confers a survival and proliferative advantage to leukemic cells, resulting in the progressive accumulation of promyelocytes in the bone marrow of APL patients [36,44]. In this case, PML-RARA-RXR complexes mainly recognize atypical RAREs and interact with genomic regions characterized by a distinct pattern of chromatin modifications [39,45].
PML-RARA functions can be restored by the administration of two drugs, commonly used in clinical practice—ATRA and ATO [46,47]. These induce the PML-RARA degradation by binding to the RARA and PML parts of the fusion protein, respectively. Therefore, ATRA turns PML-RARA into a transcriptional activator, as a consequence of the release of several corepressors, including epigenetic enzymes (e.g., HDACs and DNA methyltransferases) and the interaction with a series of coactivators (e.g., coactivator-1, multi-protein complex including the cellular coactivator p300), leading to a more accessible chromatin [48]. On the other side, ATO induces different posttranscriptional modifications at the second B-box (B2) domain of the PML moiety, resulting in the change of the PML-RARA organization from microspeckles to NBs [47,49].
Mouse models have been used to elucidate most of the mechanisms described above and underlying the APL pathogenesis [50]. Transgenic and knock-in PML-RARA mice express a myeloproliferative disease phenotype and evolve to APL with a significant period of latency (6 to 18 months) and incomplete penetrance (15%–20% up to 90%, depending on the model) [40,41,51]. Nevertheless, these models have been a useful tool to investigate, among others, the oncogenic role of PML-RARA fusion and of its reciprocal [37,44,52], the co-existing events to the t(15;17) [53], the immune modulation of APL [54,55], and the mechanisms of response to therapy [56,57,58]. An alternative strategy for animal model production is to engraft human cells into immunodeficient mice strains [58,59,60]. Recently, Reinisch and colleagues demonstrated how to improve the engraftment of the xenotransplant by inducing the creation of a humanized bone marrow microenvironment. Remarkably, this approach allowed the researchers to identify the APL-initiating cells, associating them to committed myeloid CD34−/lo GMP-like population [60].
3. PML-RARA Typical Isoforms
Four groups contributed to the identification of the chromosome breakpoints of the t(15;17) in the early 1990s [4,5,6,7]. These comprised three breakpoint clusters in three genomic regions (i.e., breakpoint cluster region, bcr) of the PML gene: in intron 6 (between exons 6 and 7), in exon 6, and in intron 3 (between exons 3 and 4), commonly known also as bcr1, bcr2 and bcr3, respectively (Figure 1) [61]. However, only one breakpoint in intron 2 has been identified in the RARA gene [61]. Depending on the breakpoint used and as a result of splicing, three different PML-RARA fusion transcripts can be generated, including the long (also known as L or bcr1 isoform), variant (V or bcr2), and short (S or bcr3) isoforms, respectively. In the case of bcr1 and bcr3 isoforms, exon 3 of RARA is spliced with exon 6 or 4 of PML, respectively [61]. These are the most common PML-RARA transcripts, identified in up to 90%–95% of patients. On the other hand, bcr2 isoform is produced from more complex splicing, resulting in the creation of a novel exon–exon junction between a cryptic donor splice site in PML exon 6 (GAAgtgagg, cDNA position 1685) and the acceptor splice site of exon 3 in RARA [62,63]. The same bcr have been reported in pediatric APL, with frequencies comparable with adults and mainly depending on the ethnic group [11,64]. Open reading frame is preserved in all cases, suggesting an oncogenic potential of the produced fusion proteins during APL onset and evolution.
Although all the patients harboring the t(15;17) express at least one of the PML-RARA isoforms, the reciprocal RARA-PML fusion is found only in 70% to 80% of them, either as RARA1- and RARA2-PML (breakpoints between exons 4 and 5), or only as RARA1-PML (breakpoints upstream of exon 4) [65,66]. Therefore, expression of the reciprocal chimeric protein might not be required for APL development.
4. PML-RARA Atypical Isoforms
In addition to the typical PML-RARA isoforms, sporadic cases of t(15;17)-positive APL patients with atypical breakpoints, resulting in rare fusion transcripts, have been described (Table 1). Although the biological significance of many of these variants is still being debated, the analysis of their sequence is critical for understanding the causal molecular mechanisms and MRD monitoring [67]. Atypical bcr2, also defined as V-forms, are the most frequent variants [61,62,63,68,69]. These are characterized by cDNA deletions of either the distal region of PML exon 6 (from 8 to 146 nucleotides), or the entire exon 6, as a result of a mis-splicing event or a genomic break within PML exon 6 (rarely in PML exon 5). Likewise, atypical bcr2 are frequently associated with insertions of three to 127 extra nucleotides (1 to 42 extra amino acids) of genomic DNA from RARA intron 2 [63,68,69,70,71,72,73,74]. In most of the cases, V-forms are “private”, being observed in single APL patients. However, a few cases share the activation of a novel donor splice site in PML exon 6 [72,73], or express a minor PML-RARA transcript with exon 5 skipped [72,74].
Table 1.
Type, Reported Cases | PML, Breakpoint | PML, Splice Site | Genomic Insertions | RARA, Breakpoint | RARA, Splice Site | Reference |
---|---|---|---|---|---|---|
Typical isoforms | ||||||
Bcr1 (58–75% of pts) | Intron 6 | CAGgtaggg | Intron 2 | ctctagCCA | [61,75,76] | |
Bcr2 (5–10% of pts) | Exon 6 | GAAgtgagg | Intron 2 | ctctagCCA | [61,75,76] | |
Bcr3 (15–33% of pts) | Intron 3 | CAGgtgagt | Intron 2 | ctctagCCA | [61,75,76] | |
Atypical isoforms | ||||||
Bcr1 | ||||||
2 pts | Exon 7a | TCGgtgagt | Intron 2 | ctctagCCA | [70,77] | |
1 pt | Exon 7a | TGGtgatca | T + chr17:12049-12168 (119 nt) | Intron 2 | ctctagCCA | [74] |
1 pt | Exon 7a | CAGctcgga | chr17: 40342767-40342865 (100 nt) | Intron 2 | ctctagCCA | [78] |
1 pt | Exon 7a | TCGgtgagt | chr15:74036990-74037095 (106 nt) + ATCT | Exon 3 | cagcccTCC | [67] |
1 pt | Exon 7b | GGAtccgct | Intron 2 | ctctagCCA | [77] | |
1 pt | Exon 7b | CGCcttcgc | Exon 3 | agcagcAGT | [79] | |
1 pt | Exon 7c | GATcgctgg | tctgtgctctgtacaacag (19 nt, reverse inserted sequence originated from PML Exon 7c complementary sequence) | Intron 2 | ctctagCCA | [80] |
Bcr2 | ||||||
2 pts | Exon 6 | GAGctcccc | Intron 2 | ctctagCCA | [72,73] | |
1 pt | Exon 6 | GCCagtggc | chr17: 40338105-40338139 (35 nt) | Intron 2 | ctctagCCA | [70] |
1 pt | Exon 6 | GGCaaggtt | ccttg (5 nt from RARA) | Intron 2 | ctctagCCA | [71] |
1 pt | Exon 6 | GGAggggaa | chr17: 15582-15596 (15 nt) | Intron 2 | ctctagCCA | [74] |
1 pt | Exon 6 | CCGgagcag | aagcccgtcttccttttag (19 nt from RARA) | Intron 2 | ctctagCCA | [69] |
1 pt | Exon 6 | GAGctcccc | gagtccttctgcaggaagaggagagattg (29 nt from RARA) | Intron 2 | ctctagCCA | [63] |
1 pt | Exon 6 | TCCccggag | tcccctcttctctctctag (19 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | CTAgcccca | tggacacacaggttggag (18 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | TAGccccag | tcttagag (8 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | GTCatagga | chr17:40343445-40343571 (127 nt) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | GAAgtgagg | Intron 2 | ctctagCCA | ||
1 pt | Exon 6 | CCCaacagc | gaaggactggacacacaggttggag (25 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | GCAaccacg | gag | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | AACcacgtg | gcccggcacacatacaat (18 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | ACGtggcca | gagcca | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | CGTggccag | actctttcttagag (14 nt from RARA) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | TGGccagtg | gag | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | GCGccgggg | Intron 2 | ctctagCCA | ||
1 pt | Exon 6 | GCCggggag | chr17:40342828-40342867 (40 nt) | Intron 2 | ctctagCCA | |
1 pt | Exon 6 | CCGgggagg | agtttggg (8 nt from RARA) | Intron 2 | ctctagCCA | |
Bcr3 | ||||||
2 pts | Intron 4 | CTGgtgaga | Intron 2 | ctctagCCA | [73,74] | |
1 pt | Intron 4 | unknown | Intron 2 | unknown | [81] | |
1 pt | Intron 4 | CTGgtgaga | chr15:74050024-74050143 (120 nt) | Intron 2 | ctctagCCA | [74] |
1 pt | Intron 4 | CTGgtgaga | cccccagtt | Exon 1 of RARA2 | catctgCAG | [82] |
1 pt | Intron 4 | CTGgtgaga | chr17:40343186-40343225 (40 nt) | Intron 2 | ctctagCCA | [83] |
Reported isoforms have been compared with the reference sequences of PML and RARA (GenBank accession numbers: NM_033238.2; NM_000964.3). “PML and RARA splice site” columns show the nucleotides involved in exon–exon boundaries between PML and RARA (upper cases) genes, as well as genomic nucleotides that are spliced-out (lower cases) from the fusion transcripts. In addition, inserted sequences are shown in uppercase when they were of unknown origin and in lowercase when it was possible to define their origin. Pt, patient. Nt, nucleotides.
Atypical cases of bcr1 with breakpoints located downstream of PML intron 6 have also been reported. In these cases, the donor splice site of exon 7a or 7b is spliced directly with RARA exon 3 [70,77,79], or indirectly through the insertion of genomic DNA (19 to 119 nucleotides) from PML intron 7 or RARA intron 2, respectively [67,74,78,80]. Notably, Yi and colleagues reported a case in which a reverse sequence of 19 nucleotides originated from PML exon 7c complementary sequence was inserted between part of exon 7c (308 nucleotides) and RARA exon 3 [80]. In addition, partial deletions of RARA exon 3 have also been observed both in atypical bcr1 as well as in bcr3 transcripts [67,73,79]. These rare bcr3 isoforms originate from breakpoints located downstream of PML exon 4, which is then commonly involved in the splicing with RARA exon 3 [73,74,81,82,83]. In this case, as for bcr2 and bcr1 variants, insertions of genomic DNA sequences might also occur at the junction between PML and RARA genes [74,82,83]. Among others, a short insertion of nine nucleotides (CCCCCAGTT) of unknown origin has been reported in a PML-RARA fusion between PML exon 4 and part of the exon 1 of RARA2. This was the first time that a fusion transcript involving the alternative isoform of RARA was found in an APL patient [82].
5. Responsiveness to Treatment of APL Patients Depending on PML-RARA Isoforms
Both typical and atypical PML-RARA isoforms have been correlated with diverse prognosis and responsiveness to treatments (e.g., ATRA), likely due to the different PML domains retained in the fusion protein. However, the results from the different studies are controversial, mainly because of the substantial clinical heterogeneity associated. Some reports have shown that bcr3 patients would have a poor prognosis and an aggressive disease course [84], as well as patients harboring PML breakpoints downstream of intron 6 [67,70,75,77]. However, other studies have described cases with a good prognosis, or at least similar to that of APL patients with typical transcripts, even in the presence of atypical isoforms [67,72,78,80]. Therefore, according to the most recent recommendations, standard therapy should not be changed based on the PML-RARA isoforms [85].
6. APL Molecular Variants
In roughly 1% to 2% of APL patients, novel translocations other than t(15;17) at either the cytogenetic or molecular level have been identified. To date, 12 molecular fusion variants of APL have been described, all involving the RARA gene [86] (Table 2). The ZBTB16 (formerly PLZF)-RARA fusion, derived from the t(11;17)(q23;q21) rearrangement [87], has been reported in more than 30 patients, making it the most frequent APL molecular variant [85,86]. Other reported translocations led to the rearrangement of RARA gene with NPM1 [88], NUMA1 [89], STAT5B [90], PRKAR1A [91], FIP1L1 [92], BCOR [93], NABP1 (formerly OBFC2A) [94], TBL1XR1 (formerly TBLR1) [95], GTF2I [96], IRF2BP2 [97], and FNDC3B [98]. Although the detection of these APL molecular variants can escape standard molecular diagnosis, their characterization is essential for the appropriate management and treatment of patients, since a variable sensitivity to treatment has been reported [85] (Table 2).
Table 2.
APL molecular Variants | Translocations | ATRA Sensitivity | ATO Sensitivity | No. of Cases Reported | Gene Other Than PML, Breakpoint | Gene Other Than PML, Splice Site | Genomic Insertions | RARA, Breakpoint | RARA, Splice Site | Reference |
---|---|---|---|---|---|---|---|---|---|---|
ZBTB16 (PLZF)-RARA | t(11;17) (q23;q21) | Poorly responsive | Poorly responsive | >30 [85] | Intron 3 | CAGgtaggc | Intron 2 | ctctagCCA | [102] | |
Intron 4 | CTGgtgagt | Intron 2 | ctctagCCA | [102] | ||||||
NPM1-RARA | t(5;17) (q35;q21) | Sensitive | ND | 5 [103] | Intron 5 | CAGgtagag | Intron 2 | ctctagCCA | [103] | |
Intron 5 | CAGgtagag | 79 nt with no homology to sequences in the GenBank or EMBL databases | Intron 2 | ctctagCCA | [104] | |||||
Intron 4 | TAGgtatgt | Intron 2 | ctctagCCA | [103] | ||||||
NUMA1 (NUMA)-RARA | t(11;17) (q13;q21) | Sensitive | ND | 1 | Intron 23 | CAGgtgagg | Intron 2 | ctctagCCA | [89] | |
STAT5B-RARA | der(17) | Poorly responsive | Poorly responsive | 11 [105] | Intron 15 | CTCgtgagt | Intron 2 | ctctagCCA | [90,105] | |
PRKAR1A-RARA | t(17;17) (q21;q24) or del(17) (q21;q24) | Sensitive | Sensitive | 1 | Intron 2 | AAGgtaaaa | Intron 2 | ctctagCCA | [91] | |
FIP1L1-RARA | t(4;17) (q12;q21) | Sensitive in 1 case | ND | 2 | Intron 15 | ATGgtaagt | Intron 2 | ctctagCCA | [92] | |
Intron 13 | CGGgtaaat | Intron 2 | ctctagCCA | [106] | ||||||
BCOR-RARA | t(X;17) (p11;q21) | Sensitive in 2 cases | Insensitive in 1 case | 2 | Intron 12 | CAGgtatga | Intron 2 | ctctagCCA | [93] | |
Exon 12 | CAGgtagaa | Intron 2 | ctctagCCA | [107] | ||||||
NABP1 (OBFC2A) -RARA | t(2;17) (q32;q21) | Sensitive in vitro | ND | 1 | Intron 5 | TGGgtaaga | Intron 2 | ctctagCCA | [94] | |
TBL1XR1 (TBLR1)-RARA | t(3;17) (q26;q21) | Insensitive | ND | 4 [108] | Intron 5 | CAAgtgagc | Intron 2 | ctctagCCA | [95] | |
Intron 5 | CAAgtgagc | * | Intron 2 | ctctagCCA | [108] | |||||
GTF2I-RARA | t(7;17) (q11;q21) | Sensitive | Sensitive | 1 | Intron 6 | TAGgtaagt | Intron 2 | ctctagCCA | [96] | |
IRF2BP2-RARA | t(1;17) (q42;q21) | Sensitive | Sensitive | 5 [109] | Exon 2 | TGTcccctg | Intron 2 | ctctagCCA | [97,109] | |
Exon 1 | AAGgtgcgg | Intron 2 | ctctagCCA | [110] | ||||||
Intron 1 | CAGgtaggg | Intron 2 | ctctagCCA | [111] | ||||||
Exon 1 | CAGgcaggt | Intron 2 | ctctagCCA | [111,112] | ||||||
FNDC3B-RARA | t(1;17) (q42;q21) | Sensitive | Sensitive | 1 | Intron 24 | AAGgtgtgt | Intron 2 | ctctagCCA | [98] |
Genes involved in APL molecular variants are reported according to the HUGO Gene Nomenclature Committee (https://www.genenames.org/). Previous symbols are reported in brackets. * According to molecular analysis, RARA on chromosome 17 had a 12-kbp deletion, of which a small region was inserted into chromosome X and the major part was inserted within TBL1XR1 gene between exons 5 and 6 on chromosome 3 [108].
In addition, two AML resembling APL cases with no RARA gene implication have been reported both involving the retinoid acid receptor gamma gene (RARG, 12q13.13). In the first case, RARG was fused to the nucleoporin 98 (NUP98) gene to produce the NUP98-RARG transcript [99]. In the second case, RARG was fused to the PML gene in a patient with the hypergranular subtype of APL [100]. Due to the early discontinuation of ATRA in both patients, the sensitivity to ATRA treatment was not certain in these cases, although in vitro studies suggest that at least NUP98-RARG rearrangement might be resistant to this drug [101].
7. Additional Molecular Events to PML-RARA
Although PML-RARA rearrangement is the cytogenetic hallmark of APL, in vitro studies performed on transgenic mice support the hypothesis that secondary cooperating genetic events accumulated over time are essential to ultimately trigger the whole leukemic phenotype [113,114]. A wide number of genomic alterations have been associated with APL, but only some of them occur recurrently [115,116,117]. This links with the peculiar morphology and distinctive clinical features compared with other forms of AML.
7.1. Additional Chromosomal Abnormalities
Almost half of pediatric and adult APL patients harbor further chromosomal alterations (ACAs) in addition to the t(15;17) identified by conventional cytogenetics [11,118]. As in other AML subtypes [119], deletion 7q and trisomy 8 are the most prevalent alterations. The gain of additional material by chromosome 8 leads to MYC deregulation in APL cells [120] that can act in cooperation with the PML-RARA fusion gene [121,122,123]. Other alterations have also been identified, but less frequently and in a non-recurrent manner (≤3%) [118,124,125]. With the probable exception of complex karyotypes with three or more ACAs [126], it is accepted that ACAs do not affect the prognosis of patients with APL.
In addition, studies carried out by single-nucleotide polymorphism array (SNP-A) tools have shown that acquired non-recurrent cytogenetic cryptic (i.e., submicroscopic) variations are relatively common and impact negatively on the outcome of APL patients [124,125]. However, most of these studies lack paired germinal samples, sparking controversy on those copy number alterations not reported in public databases and thus categorized as acquired variations. By contrast, studies carried out with a matched germline sample have revealed a mean of 0.93 cryptic lesions per case, suggesting that few additional aberrations are needed in this type of leukemias [125], in contrast to multiple micro-deletions that are usually found in other types of leukemias, such as acute lymphoblastic leukemia [127].
7.2. Gene Mutations at Diagnosis, Relapse and Resistance
The genetic features of APL have been analyzed by next-generation sequencing (NGS) approaches, showing a mutational landscape different from other myeloid malignancies [115,116,128] (Figure 2). This molecular profile is defined by recurrent alterations in genes associated with signaling pathways (FLT3, NRAS, KRAS), tumor suppression (WT1), chromatin organization (ARID1B and ARID1A), oncogenes (SALL4, MED12, NSD1), and rarer mutations in other AML-pathways, including NPM1 mutations, DNA methylation (DNMT3A, IDH1/2 and TET2), or epigenetic regulation (ASXL1) [115,116,123,128]. Although mutations in epigenetic modifier genes (i.e., DNMT3A, TET2, IDH1, IDH2, and ASXL1) jointly represent less than 6% of APL cases, these have been associated with a poor prognosis with regard to overall survival and disease free survival [129].
FLT3-ITD and FLT3-D835 mutations in the FLT3 gene are the most frequent co-occurring events to PML-RARA both in pediatric and adult APL, representing up to 40% of cases, mainly associated with elevated white blood cell (WBC) counts [11,130]. However, the prognostic implication of these mutations remains controversial. While a recent meta-analysis found that FLT3 mutations are associated with elevated WBC counts and poorer clinical outcomes [130], in the largest study reported so far, we were unable to demonstrate an independent prognostic value of these mutations when WBC count was included in multivariable analysis [131]. It has been found that alterations in FLT3-ITD impedes retinoic acid, but no arsenic, responses in a murine model [132], and that ATRA and ATO selectively exert synergistic cytotoxicity against FLT3-ITD AML cells via co-inhibition of FLT3 signaling pathway [133,134]. Once in the clinical arena, results from a small series of low-to-intermediate risk patients with APL suggest the antileukemic advantage of ATRA plus ATO in patients with FLT3-ITD [133,134]. Nevertheless, these studies have been considered not evidence-based enough to recommend any FLT3-oriented therapy in APL out of clinical trials [85].
In addition to FLT3, the profile of mutations in pediatric APL is similar to adult patients, where recurrent mutations in WT1, USP9X, NRAS, and ARID1A are strongly related to de novo APL and in WT1 with relapsed APL [11,64]. Likewise, additional mutations have been detected in a non-recurrent manner, affecting, mainly, MAPK pathway (BRAF, KIT, PDGFRA) or transcriptional regulation (MED12, KDM6A) in both, adult and pediatric patients [64,135]. Underlying the heterogeneity of genes implicated in the disease, in silico strategies, based on network enrichment analysis, have identified aberrant gene interactions within pathways potentially implicated in APL leukemogenesis [128]. Therefore, related biological functions may have a similar effect on leukemogenesis, requiring a few concerted molecular events to develop the APL phenotype. Therefore, the alteration of key cellular pathways caused by diverse but not necessarily frequent or recurrent mutations could promote the arising and maintenance of APL [115,116,123,128]. However, further analyses are required to confirm this assumption.
At diagnosis, about 70% of APL patients harbor a mean of 0.96 somatic mutations (range 0–2) additionally to PML-RARA rearrangement [115,116,123,128,135]. However, this average is greater at relapse, with a mean of three additional somatic mutations (range 0–61), mostly acquired through the disease course [115,116,123,128,135]. These mutations are mainly localized in NRAS, RUNX1 and ARID1B, and rarely found in newly diagnosed APL, suggesting their possible role as predictive markers of relapse [136,137]. More recently, point mutations in the PML-RARA fusion gene have been described in up to 30% of the relapsed cases [136] (Figure 1). These studies suggested that mutations occurred in the two moieties of PML-RARA could contribute to 10–15% of patients who relapse or those eventually resistant to treatment by targeted therapy with ATRA and ATO [136,138]. PML mutations are thought to inhibit ATO binding whereas RARA mutations could reduce the affinity to ATRA binding [136,138]. In many cases, these mutations in PML or RARA are already present in a low burden at diagnosis, as unveiled by NGS, and expanded under treatment selection during disease evolution, acquiring, occasionally, mutations in other genes [136]. Therefore, the early finding of these mutations emerges as a possible future approach to modify therapeutic strategies. All the described mutations are located in critical domains identified as hotspots in PML (A216) and RARA (R272, T285 and S287) (Figure 1) [138,139], and appear to be mutually exclusive with FLT3 mutations, suggesting their different role in leukemogenesis and disease progression. Additional novel alterations have been described in both PML (A224G) and RARA (L220P, L224I, W225C, C235F, L290V, and T291A) moieties. Moreover, concomitant mutation patterns have been identified in a non-recurrent manner during the evolution of the disease, affecting genes involved in pathways associated with clonal hematopoietic expansion, such as signaling pathways (JAK2), DNA methylation (DNMT3A and TET2), epigenetic regulation (ASXL1), splicing (SRSF2), transcriptional factors (ETV6), and tumor suppression (TP53) [136]. In addition, mutations present at diagnosis in WT1, epigenetic or kinase factor genes would be retained in the relapse, promoting the acquisition of additional aberrations, while in NRAS or FLT3 they would disappear, allowing access to new molecular subclones involved in the relapse [135,137]. Accordingly, two different models of disease progression have been suggested: model 1, in which relapse may originate from the persistence of the dominant founder clone, present at diagnosis, which survived and evolved into the relapse clone, expanding with an unclear mechanism; and model 2, where mutated subclones arise under selective pressure of treatment and with the acquisition of novel mutations, which resulted in the clonal expansion of the affected cells [136]. In model 1, patients might have oncogenic alterations and/or mutations, either inherited or acquired, that conferred a resistance mechanism to treatment. In model 2, the founder clone was displaced at relapse by new subclones, probably due to selective pressure through competition between subclones or as a consequence of the chemotherapy. In this second model, where subclones are totally different from the diagnostic clones, is especially relevant the development of new management strategies that allow us to detect those cases in which the treatment will fail [136,140]. Ongoing studies focused on clonal evolution and resistance suggest the use of new retinoid molecules, together with ATRA or ATO treatments, with novel therapeutic targets acting through alternative molecular mechanisms [129,140]. However, further investigation in several clinical trial settings is warranted.
Together with somatic mutations, aberrantly expressed genes have been identified in APL patients. For example, a recent study has revealed that the down-regulation of IRF8 driven by PML-RARA could trigger the advent and preservation of the leukemic clone in a mouse model, contributing to the acquisition of cooperative genomic events [42]. In addition, the expression profile of genes such as ID1, BAALC, ERC, WT1 and KMT2E, alongside additional molecular events (such FLT3-ITD status and ∆Np73/TAp73 expression ratio), could improve the treatment outcome prediction in high-risk APL patients (Figure 2). Consequently, an integrative score in APL (ISAPL), combining gene mutations with expression analysis, has been proposed, categorizing patients in two different sets with significant differences in remission rate, relapse and survival [141]. The ISAPL could assist in more narrowly monitoring the measurable MRD and design of improved treatment schemes.
The gene expression pattern of APL has also been investigated with an elegant chemo-genomic strategy to identify novel molecular targets and drugs for the treatment of patients. By comparing the transcriptional profiles of APL cases with those induced by gene mutations or drugs, Chen and collaborators identified a list of at least 15 proteins (i.e., PML, RARA, ABL1, AFF1, BCR, CEBPA, FGFR1, FOS, HDAC3, MEIS1, NPM1, NUP98, PDGFRB, PTEN, and SPI1) potentially able to revert the transcriptional patterns of APL when properly targeted with specific drugs [142].
8. Standardized Molecular Approaches to Study Minimal Residual Disease
Although roughly 90% of newly diagnosed APL patients achieve long-term remission having received only targeted therapy, a considerable proportion of those patients relapsed with no evidence of predictive clinical parameters [115,116,123,128]. As a target for MRD, the ready detection of PML-RARA transcript at the post-consolidation phase by modern PCR-based techniques could improve outcome prediction through the rapid accurate assessment of the response to treatment [143,144]. Several retrospective studies have pointed out that molecular relapse is an independent prognostic factor which precedes the reappearance of APL blasts [84,145,146,147,148,149,150]. Successive studies established that negative longitudinal PCR assays performed on bone marrow after completing therapy are strongly related with long-term remission. In addition, molecular assessment previous to stem cell transplantation predicts the risk of relapse after stem cell engraftment [150,151,152,153,154,155,156]. Consequently, several expert panels, including the European Leukemia Net and the US international working Group with the NCCN, recommended in the 2003 Guidelines the establishment of molecular response, defined as undetectable PML-RARA transcript by PCR test with sensitivity of 10−4 [157], as a valuable end point during the follow-up. Thus, the eventual detection of molecular relapse in early stages allows treatment intervention that could improve the outcome of these patients [158].
Initial studies analyzed the presence of PML-RARA transcript after treatment by nested RT-PCR [159,160,161]. However, real time quantitative approaches (qRT-PCR), which afford comparable sensitivity but are more readily standardized, are the current gold standard strategy for molecular monitoring in APL [162]. A number of large studies have proved that the most important MRD end point in APL treated with ATRA- or ATO-based therapies is the achievement of PCR negativity for PML-RARA at the end of consolidation therapy [10,134,144,163,164,165,166,167]. However, it is controversial whether serial PCR measurements of PML-RARA during treatment are of value outside of clinical trials [168]. Recently, the MRD consensus document of the European Leukemia Net recommended not changing the treatment plan for an individual with detectable levels of PML-RARA before the end of consolidation [169]. Furthermore, given the low rates of relapse observed in patients presenting with low and intermediate risk of disease (by Sanz score) [170], MRD analysis in these patients should be performed in bone marrow until the patient achieves MRD negativity and then should be terminated. Only patients with high risk APL should continue sequential MRD monitoring after completion of therapy for at least 2 years [169].
Although quantification using peripheral blood is an attractive option, a study comparing both sources showed that conversion to PCR positivity was detected earlier in bone marrow than in peripheral blood [144]. However, the main limitation is that the qRT-PCR technique provides unreliable results when the tumor burden is very low (within the threshold of sensitivity). The need for more sensitive PCR techniques is driven to improve clinical decision-making. A new alternative method in monitoring MRD is droplet digital PCR (ddPCR), which provides an accurate and highly sensitive absolute quantification of the PML-RARA transcript, including atypical PML-RARA fusion transcripts [74,171]. Using this new method, residual transcripts could be detected independently of the kinetics of molecular relapse, which is APL transcript-specific and not time-dependent [171]. For instance, this technique could be a feasible and valuable tool in order to improve risk stratification at diagnosis and complement MRD monitoring, especially for patients scored as to be at high risk of relapse. Nevertheless, further studies should be performed to validate and standardize this method for MRD monitoring in APL.
9. Conclusions
In an era of medicine in which several novel cases of targeted therapy are emerging for AML (e.g., Midostaurin for FLT3mut, and Enasidenib for IDHmut), APL has been a pioneer, considering that this has been a reality for this neoplasm for 30 years [8,172]. It should be noted that the introduction of ATRA and ATO into clinical practice has been accompanied by a huge number of studies at molecular level, which we have tried to revise to the best of our knowledge, to understand the pathophysiology of the disease and its responsiveness to treatment. However, many aspects remain to be further studied, since early death rate still reaches 15%, and up to 10% of patients relapse or become resistant. As we described in this review, genomics has made it possible to widen the APL genetic landscape. However, it should be through the integration of genomics with other -omic science (i.e., epigenomics, transcriptomics and metabolomics) that we might broaden our perspective and explain the hitherto unsolved issues. This represents a great challenge for researchers in the near future, but some of the pillars seem to have already been built with the proposal, among others, of the first integrative score [141].
Acknowledgments
This review is dedicated to the memory of our mentor and friend Prof. Francesco Lo Coco, who dedicated over 30 years of his life to the study of Acute Promyelocytic Leukemia.
Author Contributions
A.L. and M.I. contributed equally to this work. A.L. and M.I.; writing—original draft preparation, A.L., M.I., C.S., M.Á.S., E.B. and J.C.; writing—review and editing, J.C.; supervision. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by research funding from FEDER funds (CIBERONC [CB16/12/00284]), Instituto de Salud Carlos III grants PI16/01113, PI16/00665, PI18/1472, PI19/00812, PI19/00730, FI19/00059 as well as from the Conselleria de Educación, Cultura y Deporte PROMETEOII/2015/008, GVA/2018/004 and GV/2019/084. A.L. is recipient of a fellowship from the Fundación Española de Hematología y Hemoterapia.
Conflicts of Interest
The authors declare no conflict of interest.
References
- 1.Bennett J.M., Catovsky D., Daniel M.T., Flandrin G., Galton D.A.G., Gralnick H.R., Sultan C. Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group. Br. J. Haematol. 1976;33:451–458. doi: 10.1111/j.1365-2141.1976.tb03563.x. [DOI] [PubMed] [Google Scholar]
- 2.Golomb H.M., Rowley J.D., Vardiman J.W., Testa J.R., Butler A. “Microgranular” acute promyelocytic leukemia: A distinct clinical, ultrastructural, and cytogenetic entity. Blood. 1980;55:253–259. doi: 10.1182/blood.V55.2.253.253. [DOI] [PubMed] [Google Scholar]
- 3.Castoldi G.L., Liso V., Specchia G., Tomasi P. Acute promyelocytic leukemia: Morphological aspects. Leukemia. 1994;8:1441–1446. [PubMed] [Google Scholar]
- 4.de Thé H., Chomienne C., Lanotte M., Degos L., Dejean A. The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus. Nature. 1990;347:558–561. doi: 10.1038/347558a0. [DOI] [PubMed] [Google Scholar]
- 5.Borrow J., Goddard A.D., Sheer D., Solomon E. Molecular analysis of acute promyelocytic leukemia breakpoint cluster region on chromosome 17. Science. 1990;249:1577–1580. doi: 10.1126/science.2218500. [DOI] [PubMed] [Google Scholar]
- 6.Alcalay M., Zangrilli D., Pandolfi P.P., Longo L., Mencarelli A., Giacomucci A., Rocchi M., Biondi A., Rambaldi A., Lo Coco F. Translocation breakpoint of acute promyelocytic leukemia lies within the retinoic acid receptor alpha locus. Proc. Natl. Acad. Sci. USA. 1991;88:1977–1981. doi: 10.1073/pnas.88.5.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lemons R.S., Eilender D., Waldmann R.A., Rebentisch M., Frej A.K., Ledbetter D.H., Willman C., McConnell T., O’Connell P. Cloning and characterization of the t(15;17) translocation breakpoint region in acute promyelocytic leukemia. Genes. Chromosomes Cancer. 1990;2:79–87. doi: 10.1002/gcc.2870020202. [DOI] [PubMed] [Google Scholar]
- 8.Lo-Coco F., Avvisati G., Vignetti M., Thiede C., Orlando S.M., Iacobelli S., Ferrara F., Fazi P., Cicconi L., Di Bona E., et al. Retinoic acid and arsenic trioxide for acute promyelocytic leukemia. N. Engl. J. Med. 2013;369:111–121. doi: 10.1056/NEJMoa1300874. [DOI] [PubMed] [Google Scholar]
- 9.Burnett A.K., Russell N.H., Hills R.K., Bowen D., Kell J., Knapper S., Morgan Y.G., Lok J., Grech A., Jones G., et al. Arsenic trioxide and all-trans retinoic acid treatment for acute promyelocytic leukaemia in all risk groups (AML17): Results of a randomised, controlled, phase 3 trial. Lancet. Oncol. 2015;16:1295–1305. doi: 10.1016/S1470-2045(15)00193-X. [DOI] [PubMed] [Google Scholar]
- 10.Iland H.J., Collins M., Bradstock K., Supple S.G., Catalano A., Hertzberg M., Browett P., Grigg A., Firkin F., Campbell L.J., et al. Use of arsenic trioxide in remission induction and consolidation therapy for acute promyelocytic leukaemia in the Australasian Leukaemia and Lymphoma Group (ALLG) APML4 study: A non-randomised phase 2 trial. Lancet. Haematol. 2015;2:e357–e366. doi: 10.1016/S2352-3026(15)00115-5. [DOI] [PubMed] [Google Scholar]
- 11.Conneely S.E., Stevens A.M. Advances in Pediatric Acute Promyelocytic Leukemia. Children. 2020;7:11. doi: 10.3390/children7020011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jensen K., Shiels C., Freemont P.S. PML protein isoforms and the RBCC/TRIM motif. Oncogene. 2001;20:7223–7233. doi: 10.1038/sj.onc.1204765. [DOI] [PubMed] [Google Scholar]
- 13.Cheng X., Kao H.Y. Post-translational modifications of PML: Consequences and implications. Front. Oncol. 2012;2:210. doi: 10.3389/fonc.2012.00210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhong S., Müller S., Ronchetti S., Freemont P.S., Dejean A., Pandolfi P.P. Role of SUMO-1-modified PML in nuclear body formation. Blood. 2000;95:2748–2752. doi: 10.1182/blood.V95.9.2748.009k31a_2748_2752. [DOI] [PubMed] [Google Scholar]
- 15.Salomoni P., Pandolfi P.P. The role of PML in tumor suppression. Cell. 2002;108:165–170. doi: 10.1016/S0092-8674(02)00626-8. [DOI] [PubMed] [Google Scholar]
- 16.Viale A., De Franco F., Orleth A., Cambiaghi V., Giuliani V., Bossi D., Ronchini C., Ronzoni S., Muradore I., Monestiroli S., et al. Cell-cycle restriction limits DNA damage and maintains self-renewal of leukaemia stem cells. Nature. 2009;457:51–56. doi: 10.1038/nature07618. [DOI] [PubMed] [Google Scholar]
- 17.Lallemand-Breitenbach V., de Thé H. PML nuclear bodies. Cold Spring Harb. Perspect. Biol. 2010;2:a000661. doi: 10.1101/cshperspect.a000661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bernardi R., Pandolfi P.P. Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat. Rev. Mol. Cell Biol. 2007;8:1006–1016. doi: 10.1038/nrm2277. [DOI] [PubMed] [Google Scholar]
- 19.de Thé H., Le Bras M., Lallemand-Breitenbach V. Acute promyelocytic leukemia, arsenic, and PML bodies. J. Cell Biol. 2012;198:11–21. doi: 10.1083/jcb.201112044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yoshida H., Ichikawa H., Tagata Y., Katsumoto T., Ohnishi K., Akao Y., Naoe T., Pandolfi P.P., Kitabayashi I. PML-retinoic acid receptor alpha inhibits PML IV enhancement of PU.1-induced C/EBPepsilon expression in myeloid differentiation. Mol. Cell. Biol. 2007;27:5819–5834. doi: 10.1128/MCB.02422-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Nguyen L.A., Pandolfi P.P., Aikawa Y., Tagata Y., Ohki M., Kitabayashi I. Physical and functional link of the leukemia-associated factors AML1 and PML. Blood. 2005;105:292–300. doi: 10.1182/blood-2004-03-1185. [DOI] [PubMed] [Google Scholar]
- 22.Xu Z.X., Zou W.X., Lin P., Chang K.S. A role for PML3 in centrosome duplication and genome stability. Mol. Cell. 2005;17:721–732. doi: 10.1016/j.molcel.2005.02.014. [DOI] [PubMed] [Google Scholar]
- 23.Matt S., Hofmann T.G. Crosstalk between p53 modifiers at PML bodies. Mol. Cell. Oncol. 2018;5:e1074335. doi: 10.1080/23723556.2015.1074335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ivanschitz L., Takahashi Y., Jollivet F., Ayrault O., Le Bras M., de Thé H. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence. Proc. Natl. Acad. Sci. USA. 2015;112:14278–14283. doi: 10.1073/pnas.1507540112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bischof O., Kirsh O., Pearson M., Itahana K., Pelicci P.G., Dejean A. Deconstructing PML-induced premature senescence. EMBO J. 2002;21:3358–3369. doi: 10.1093/emboj/cdf341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ito K., Bernardi R., Morotti A., Matsuoka S., Saglio G., Ikeda Y., Rosenblatt J., Avigan D.E., Teruya-Feldstein J., Pandolfi P.P. PML targeting eradicates quiescent leukaemia-initiating cells. Nature. 2008;453:1072–1078. doi: 10.1038/nature07016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ito K., Carracedo A., Weiss D., Arai F., Ala U., Avigan D.E., Schafer Z.T., Evans R.M., Suda T., Lee C.H., et al. A PML-PPAR-δ pathway for fatty acid oxidation regulates hematopoietic stem cell maintenance. Nat. Med. 2012;18:1350–1358. doi: 10.1038/nm.2882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang G., Tian Y., Hu Q., Xiao X., Chen S. PML/RARa blocks the differentiation and promotes the proliferation of acute promyelocytic leukemia through activating MYB expression by transcriptional and epigenetic regulation mechanisms. J. Cell. Biochem. 2018;120:1210–1220. doi: 10.1002/jcb.27077. [DOI] [PubMed] [Google Scholar]
- 29.Khan M.M., Nomura T., Kim H., Kaul S.C., Wadhwa R., Shinagawa T., Ichikawa-Iwata E., Zhong S., Pandolfi P.P., Ishii S. Role of PML and PML-RARalpha in Mad-mediated transcriptional repression. Mol. Cell. 2001;7:1233–1243. doi: 10.1016/S1097-2765(01)00257-X. [DOI] [PubMed] [Google Scholar]
- 30.Zelent A., Guidez F., Melnick A., Waxman S., Licht J.D. Translocations of the RARalpha gene in acute promyelocytic leukemia. Oncogene. 2001;20:7186–7203. doi: 10.1038/sj.onc.1204766. [DOI] [PubMed] [Google Scholar]
- 31.Collins S.J. The role of retinoids and retinoic acid receptors in normal hematopoiesis. Leukemia. 2002;16:1896–1905. doi: 10.1038/sj.leu.2402718. [DOI] [PubMed] [Google Scholar]
- 32.Leroy P., Nakshatri H., Chambon P. Mouse retinoic acid receptor alpha 2 isoform is transcribed from a promoter that contains a retinoic acid response element. Proc. Natl. Acad. Sci. USA. 1991;88:10138–10142. doi: 10.1073/pnas.88.22.10138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nagy L., Kao H.Y., Chakravarti D., Lin R.J., Hassig C.A., Ayer D.E., Schreiber S.L., Evans R.M. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell. 1997;89:373–380. doi: 10.1016/S0092-8674(00)80218-4. [DOI] [PubMed] [Google Scholar]
- 34.Kastner P., Lawrence H.J., Waltzinger C., Ghyselinck N.B., Chambon P., Chan S. Positive and negative regulation of granulopoiesis by endogenous RARα. Blood. 2001;97:1314–1320. doi: 10.1182/blood.V97.5.1314. [DOI] [PubMed] [Google Scholar]
- 35.Lo-Coco F., Hasan S.K. Understanding the molecular pathogenesis of acute promyelocytic leukemia. Best Pr. Res. Clin. Haematol. 2014;27:3–9. doi: 10.1016/j.beha.2014.04.006. [DOI] [PubMed] [Google Scholar]
- 36.Pandolfi P.P. Oncogenes and tumor suppressors in the molecular pathogenesis of acute promyelocytic leukemia. Hum. Mol. Genet. 2001;10:769–775. doi: 10.1093/hmg/10.7.769. [DOI] [PubMed] [Google Scholar]
- 37.Lin R.J., Evans R.M. Acquisition of oncogenic potential by RAR chimeras in acute promyelocytic leukemia through formation of homodimers. Mol. Cell. 2000;5:821–830. doi: 10.1016/S1097-2765(00)80322-6. [DOI] [PubMed] [Google Scholar]
- 38.Minucci S., Maccarana M., Cioce M., De Luca P., Gelmetti V., Segalla S., Di Croce L., Giavara S., Matteucci C., Gobbi A., et al. Oligomerization of RAR and AML1 transcription factors as a novel mechanism of oncogenic activation. Mol. Cell. 2000;5:811–820. doi: 10.1016/S1097-2765(00)80321-4. [DOI] [PubMed] [Google Scholar]
- 39.Saeed S., Logie C., Francoijs K.J., Frigè G., Romanenghi M., Nielsen F.G., Raats L., Shahhoseini M., Huynen M., Altucci L., et al. Chromatin accessibility, p300, and histone acetylation define PML-RARα and AML1-ETO binding sites in acute myeloid leukemia. Blood. 2012;120:3058–3068. doi: 10.1182/blood-2011-10-386086. [DOI] [PubMed] [Google Scholar]
- 40.He L.Z., Tribioli C., Rivi R., Peruzzi D., Pelicci P.G., Soares V., Cattoretti G., Pandolfi P.P. Acute leukemia with promyelocytic features in PML/RARalpha transgenic mice. Proc. Natl. Acad. Sci. USA. 1997;94:5302–5307. doi: 10.1073/pnas.94.10.5302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Grisolano J.L., Wesselschmidt R.L., Pelicci P.G., Ley T.J. Altered myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha under control of cathepsin G regulatory sequences. Blood. 1997;89:376–387. doi: 10.1182/blood.V89.2.376. [DOI] [PubMed] [Google Scholar]
- 42.Gaillard C., Surianarayanan S., Bentley T., Warr M.R., Fitch B., Geng H., Passegué E., de Thé H., Kogan S.C. Identification of IRF8 as a potent tumor suppressor in murine acute promyelocytic leukemia. Blood Adv. 2018;2:2462–2466. doi: 10.1182/bloodadvances.2018018929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Gaillard C., Tokuyasu T.A., Rosen G., Sotzen J., Vitaliano-Prunier A., Roy R., Passegué E., De Thé H., Figueroa M.E., Kogan S.C. Transcription and methylation analyses of preleukemic promyelocytes indicate a dual role for PML/RARA in leukemia initiation. Haematologica. 2015;100:1064–1075. doi: 10.3324/haematol.2014.123018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Kamashev D., Vitoux D., de Thé H. PML–RARA-RXR Oligomers Mediate Retinoid and Rexinoid/cAMP Cross-Talk in Acute Promyelocytic Leukemia Cell Differentiation. J. Exp. Med. 2004;199:1163–1174. doi: 10.1084/jem.20032226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Martens J.H.A., Brinkman A.B., Simmer F., Francoijs K.J., Nebbioso A., Ferrara F., Altucci L., Stunnenberg H.G. PML-RARalpha/RXR Alters the Epigenetic Landscape in Acute Promyelocytic Leukemia. Cancer Cell. 2010;17:173–185. doi: 10.1016/j.ccr.2009.12.042. [DOI] [PubMed] [Google Scholar]
- 46.Zhu J., Gianni M., Kopf E., Honoré N., Chelbi-Alix M., Koken M., Quignon F., Rochette-Egly C., de Thé H. Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor alpha (RARalpha) and oncogenic RARalpha fusion proteins. Proc. Natl. Acad. Sci. USA. 1999;96:14807–14812. doi: 10.1073/pnas.96.26.14807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Lallemand-Breitenbach V., Jeanne M., Benhenda S., Nasr R., Lei M., Peres L., Zhou J., Zhu J., Raught B., de Thé H. Arsenic degrades PML or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat. Cell Biol. 2008;10:547–555. doi: 10.1038/ncb1717. [DOI] [PubMed] [Google Scholar]
- 48.Freedman L.P. Increasing the complexity of coactivation in nuclear receptor signaling. Cell. 1999;97:5–8. doi: 10.1016/S0092-8674(00)80708-4. [DOI] [PubMed] [Google Scholar]
- 49.Sahin U., De Thé H., Lallemand-Breitenbach V. PML nuclear bodies: Assembly and oxidative stress-sensitive sumoylation. Nucleus. 2014;5:499–507. doi: 10.4161/19491034.2014.970104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Lallemand-Breitenbach V., Zhu J., Kogan S., Chen Z., de Thé H. Opinion: How patients have benefited from mouse models of acute promyelocytic leukaemia. Nat. Rev. Cancer. 2005;5:821–827. doi: 10.1038/nrc1719. [DOI] [PubMed] [Google Scholar]
- 51.Westervelt P., Lane A.A., Pollock J.L., Oldfather K., Holt M.S., Zimonjic D.B., Popescu N.C., DiPersio J.F., Ley T.J. High-penetrance mouse model of acute promyelocytic leukemia with very low levels of PML-RARalpha expression. Blood. 2003;102:1857–1865. doi: 10.1182/blood-2002-12-3779. [DOI] [PubMed] [Google Scholar]
- 52.Pollock J.L., Westervelt P., Kurichety A.K., Pelicci P.G., Grisolano J.L., Ley T.J. A bcr-3 isoform of RARalpha-PML potentiates the development of PML-RARalpha-driven acute promyelocytic leukemia. Proc. Natl. Acad. Sci. USA. 1999;96:15103–15108. doi: 10.1073/pnas.96.26.15103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Wartman L.D., Larson D.E., Xiang Z., Ding L., Chen K., Lin L., Cahan P., Klco J.M., Welch J.S., Li C., et al. Sequencing a mouse acute promyelocytic leukemia genome reveals genetic events relevant for disease progression. J. Clin. Investig. 2011;121:1445–1455. doi: 10.1172/JCI45284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Pollock J.L., Lane A.A., Schrimpf K., Ley T.J. Murine acute promyelocytic leukemia cells can be recognized and cleared in vivo by adaptive immune mechanisms. Haematologica. 2005;90:1042–1049. [PubMed] [Google Scholar]
- 55.Padua R.A., Larghero J., Robin M., le Pogam C., Schlageter M.H., Muszlak S., Fric J., West R., Rousselot P., Phan T.H., et al. PML-RARA-targeted DNA vaccine induces protective immunity in a mouse model of leukemia. Nat. Med. 2003;9:1413–1417. doi: 10.1038/nm949. [DOI] [PubMed] [Google Scholar]
- 56.Lallemand-Breitenbach V., Guillemin M.C., Janin A., Daniel M.T., Degos L., Kogan S.C., Bishop J.M., de Thé H. Retinoic acid and arsenic synergize to eradicate leukemic cells in a mouse model of acute promyelocytic leukemia. J. Exp. Med. 1999;189:1043–1052. doi: 10.1084/jem.189.7.1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Rego E.M., He L.Z., Warrell R.P., Wang Z.G., Pandolfi P.P. Retinoic acid (RA) and As2O3 treatment in transgenic models of acute promyelocytic leukemia (APL) unravel the distinct nature of the leukemogenic process induced by the PML-RARalpha and PLZF-RARalpha oncoproteins. Proc. Natl. Acad. Sci. USA. 2000;97:10173–10178. doi: 10.1073/pnas.180290497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kosugi H., Ito M., Yamamoto Y., Towatari M., Ito M., Ueda R., Saito H., Naoe T. In vivo effects of a histone deacetylase inhibitor, FK228, on human acute promyelocytic leukemia in NOD / Shi-scid/scid mice. Jpn. J. Cancer Res. 2001;92:529–536. doi: 10.1111/j.1349-7006.2001.tb01126.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Matsushita H., Yahata T., Sheng Y., Nakamura Y., Muguruma Y., Matsuzawa H., Tanaka M., Hayashi H., Sato T., Damdinsuren A., et al. Establishment of a humanized APL model via the transplantation of PML-RARA-transduced human common myeloid progenitors into immunodeficient mice. PLoS ONE. 2014;9:e111082. doi: 10.1371/journal.pone.0111082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Reinisch A., Thomas D., Corces M.R., Zhang X., Gratzinger D., Hong W.J., Schallmoser K., Strunk D., Majeti R. A humanized bone marrow ossicle xenotransplantation model enables improved engraftment of healthy and leukemic human hematopoietic cells. Nat. Med. 2016;22:812–821. doi: 10.1038/nm.4103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Pandolfi P.P., Alcalay M., Fagioli M., Zangrilli D., Mencarelli A., Diverio D., Biondi A., Lo Coco F., Rambaldi A., Grignani F. Genomic variability and alternative splicing generate multiple PML/RAR alpha transcripts that encode aberrant PML proteins and PML/RAR alpha isoforms in acute promyelocytic leukaemia. EMBO J. 1992;11:1397–1407. doi: 10.1002/j.1460-2075.1992.tb05185.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Gallagher R.E., Li Y.P., Rao S., Paietta E., Andersen J., Etkind P., Bennett J.M., Tallman M.S., Wiernik P.H. Characterization of acute promyelocytic leukemia cases with PML-RAR alpha break/fusion sites in PML exon 6: Identification of a subgroup with decreased in vitro responsiveness to all-trans retinoic acid. Blood. 1995;86:1540–1547. doi: 10.1182/blood.V86.4.1540.bloodjournal8641540. [DOI] [PubMed] [Google Scholar]
- 63.Slack J.L., Willman C.L., Andersen J.W., Li Y.P., Viswanatha D.S., Bloomfield C.D., Tallman M.S., Gallagher R.E. Molecular analysis and clinical outcome of adult APL patients with the type V PML-RARalpha isoform: Results from intergroup protocol 0129. Blood. 2000;95:398–403. [PubMed] [Google Scholar]
- 64.Zhao J., Liang J.W., Xue H.L., Shen S.H., Chen J., Tang Y.J., Yu L.S., Liang H.H., Gu L.J., Tang J.Y., et al. The genetics and clinical characteristics of children morphologically diagnosed as acute promyelocytic leukemia. Leukemia. 2019;33:1387–1399. doi: 10.1038/s41375-018-0338-z. [DOI] [PubMed] [Google Scholar]
- 65.Goddard A.D., Borrow J., Freemont P.S., Solomon E. Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science. 1991;254:1371–1374. doi: 10.1126/science.1720570. [DOI] [PubMed] [Google Scholar]
- 66.Alcalay M., Zangrilli D., Fagioli M., Pandolfi P.P., Mencarelli A., Lo Coco F., Biondi A., Grignani F., Pelicci P.G. Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia. Proc. Natl. Acad. Sci. USA. 1992;89:4840–4844. doi: 10.1073/pnas.89.11.4840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Park T.S., Kim J.S., Song J., Lee K.A., Yoon S., Suh B., Lee J.H., Lee H.J., Kim J.K., Choi J.R. Acute promyelocytic leukemia with insertion of PML exon 7a and partial deletion of exon 3 of RARA: A novel variant transcript related to aggressive course and not detected with real-time polymerase chain reaction analysis. Cancer Genet. Cytogenet. 2009;188:103–107. doi: 10.1016/j.cancergencyto.2008.09.002. [DOI] [PubMed] [Google Scholar]
- 68.Yoshida H., Naoe T., Fukutani H., Kiyoi H., Kubo K., Ohno R. Analysis of the joining sequences of the t(15;17) translocation in human acute promyelocytic leukemia: Sequence non-specific recombination between the PML and RARA genes within identical short stretches. Genes. Chromosomes Cancer. 1995;12:37–44. doi: 10.1002/gcc.2870120107. [DOI] [PubMed] [Google Scholar]
- 69.Zhang Z., Xu Y., Jiang M., Kong F., Chen Z., Liu S., Li F. Identification of a new cryptic PML-RARα fusion gene without t(15;17) and biallelic CEBPA mutation in a case of acute promyelocytic leukemia: A case detected only by RT-PCR but not cytogenetics and FISH. Cancer Biol. Ther. 2020 doi: 10.1080/15384047.2019.1702398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Barragán E., Bolufer P., Martín G., Cervera J., Moreno I., Capote F.J., Rosique P., Sanz M.A. Identification of two atypical PML-RAR(alpha) transcripts in two patients with acute promyelocytic leukemia. Leuk. Res. 2002;26:439–442. doi: 10.1016/S0145-2126(01)00158-8. [DOI] [PubMed] [Google Scholar]
- 71.Bussaglia E., Guardia R., Nomdedéu J.F. A large exon 6 break in V-form acute promyelocytic leukemia: Relevance to clinical management. Leukemia. 2007;21:2356–2357. doi: 10.1038/sj.leu.2404799. [DOI] [PubMed] [Google Scholar]
- 72.Ismail S., Ababneh N., Awidi A. Identification of atypical PML-RARA breakpoint in a patient with acute promyelocytic leukemia. Acta Haematol. 2007;118:183–187. doi: 10.1159/000109471. [DOI] [PubMed] [Google Scholar]
- 73.Vizmanos J.L., Larrráyoz M.J., Odero M.D., Lasa R., González M., Novo F.J., Calasanz M.J. Two new molecular PML-RARalpha variants: Implications for the molecular diagnosis of APL. Haematologica. 2002;87:ELT37. [PubMed] [Google Scholar]
- 74.Iaccarino L., Divona M., Ottone T., Cicconi L., Lavorgna S., Ciardi C., Alfonso V., Travaglini S., Facchini L., Cimino G., et al. Identification and monitoring of atypical PML/RARA fusion transcripts in acute promyelocytic leukemia. Genes. Chromosomes Cancer. 2019;58:60–65. doi: 10.1002/gcc.22708. [DOI] [PubMed] [Google Scholar]
- 75.González M., Barragán E., Bolufer P., Chillón C., Colomer D., Borstein R., Calasanz M.J., Gómez-Casares M.T., Villegas A., Marugán I., et al. Pretreatment characteristics and clinical outcome of acute promyelocytic leukaemia patients according to the PML-RAR alpha isoforms: A study of the PETHEMA group. Br. J. Haematol. 2001;114:99–103. doi: 10.1046/j.1365-2141.2001.02915.x. [DOI] [PubMed] [Google Scholar]
- 76.Jovanovic J.V., Rennie K., Culligan D., Peniket A., Lennard A., Harrison J., Vyas P., Grimwade D. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia. Front. Oncol. 2011;1:35. doi: 10.3389/fonc.2011.00035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Chillón M.C., González M., García-Sanz R., Balanzategui A., González D., López-Pérez R., Mateos M.V., Alaejos I., Rayón C., Arbeteta J., et al. Two new 3′ PML breakpoints in t(15;17)(q22;q21)-positive acute promyelocytic leukemia. Genes. Chromosomes Cancer. 2000;27:35–43. doi: 10.1002/(SICI)1098-2264(200001)27:1<35::AID-GCC5>3.0.CO;2-W. [DOI] [PubMed] [Google Scholar]
- 78.Cenfra N., De Cave F., Minotti C., Ghia E., Rago A., Codacci Pisanelli G., Diverio D., Cimino G. An acute promyelocytic leukaemia patient with a new atypical promyelocytic leukemia breakpoint. Br. J. Haematol. 2008;142:854–856. doi: 10.1111/j.1365-2141.2008.07253.x. [DOI] [PubMed] [Google Scholar]
- 79.Cao Y., Yao L., Liu Y., Gu Q., Dong W., Wang Z., Wang F., Lin R., Xie X., Cen J., et al. An Atypical PML-RARA Rearrangement Resulting from Submicroscopic Insertion of the RARA Gene at the PML Locus with Novel Breakpoints within PML Exon 7b and RARA Exon 3. Acta Haematol. 2019;142:98–104. doi: 10.1159/000498842. [DOI] [PubMed] [Google Scholar]
- 80.Yi Y., Pei M., Xiao L., Sun L., Li J., Liu S., Shen J., Zhang G. Acute promyelocytic leukemia with insertion of PML exon 7c: A novel variant transcript related to good prognosis that is not detected with real-time polymerase chain reaction. Leuk. Lymphoma. 2013;54:2294–2296. doi: 10.3109/10428194.2013.767457. [DOI] [PubMed] [Google Scholar]
- 81.Kim M.J., Cho S.Y., Kim M.H., Lee J.J., Kang S.Y., Cho E.H., Huh J., Yoon H.J., Park T.S., Lee W.I., et al. FISH-negative cryptic PML-RARA rearrangement detected by long-distance polymerase chain reaction and sequencing analyses: A case study and review of the literature. Cancer Genet. Cytogenet. 2010;203:278–283. doi: 10.1016/j.cancergencyto.2010.08.026. [DOI] [PubMed] [Google Scholar]
- 82.Jezísková I., Rázga F., Gazdová J., Doubek M., Jurcek T., Korístek Z., Mayer J., Dvoráková D. A case of a novel PML/RARA short fusion transcript with truncated transcription variant 2 of the RARA gene. Mol. Diagn. Ther. 2010;14:113–117. doi: 10.1007/BF03256361. [DOI] [PubMed] [Google Scholar]
- 83.Rabade N., Raval G., Chaudhary S., Subramanian P.G., Kodgule R., Joshi S., Tembhare P., Hasan S.K., Jain H., Sengar M., et al. Molecular Heterogeneity in Acute Promyelocytic Leukemia—a Single Center Exp. India. Mediterr. J. Hematol. Infect. Dis. 2018;10:e2018002. doi: 10.4084/mjhid.2018.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Huang W., Sun G.L., Li X.S., Cao Q., Lu Y., Jiang G.S., Jang G.S., Zhang F.Q., Chai J.R., Wang Z.Y., et al. Acute promyelocytic leukemia: Clinical relevance of two major PML-RAR alpha isoforms and detection of minimal residual disease by retrotranscriptase/polymerase chain reaction to predict relapse. Blood. 1993;82:1264–1269. doi: 10.1182/blood.V82.4.1264.1264. [DOI] [PubMed] [Google Scholar]
- 85.Sanz M.A., Fenaux P., Tallman M.S., Estey E.H., Löwenberg B., Naoe T., Lengfelder E., Döhner H., Burnett A.K., Chen S.J., et al. Management of acute promyelocytic leukemia: Updated recommendations from an expert panel of the European LeukemiaNet. Blood. 2019;133:1630–1643. doi: 10.1182/blood-2019-01-894980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Baba S.M., Pandith A.A., Shah Z.A., Baba R.A. Pathogenetic implication of fusion genes in acute promyelocytic leukemia and their diagnostic utility. Clin. Genet. 2019;95:41–52. doi: 10.1111/cge.13372. [DOI] [PubMed] [Google Scholar]
- 87.Chen Z., Brand N.J., Chen A., Chen S.J., Tong J.H., Wang Z.Y., Waxman S., Zelent A. Fusion between a novel Krüppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. EMBO J. 1993;12:1161–1167. doi: 10.1002/j.1460-2075.1993.tb05757.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Corey S.J., Locker J., Oliveri D.R., Shekhter-Levin S., Redner R.L., Penchansky L., Gollin S.M. A non-classical translocation involving 17q12 (retinoic acid receptor alpha) in acute promyelocytic leukemia (APML) with atypical features. Leukemia. 1994;8:1350–1353. [PubMed] [Google Scholar]
- 89.Wells R.A., Catzavelos C., Kamel-Reid S. Fusion of retinoic acid receptor alpha to NuMA, the nuclear mitotic apparatus protein, by a variant translocation in acute promyelocytic leukaemia. Nat. Genet. 1997;17:109–113. doi: 10.1038/ng0997-109. [DOI] [PubMed] [Google Scholar]
- 90.Arnould C., Philippe C., Bourdon V., Gregoire M.J., Berger R., Jonveaux P. The signal transducer and activator of transcription STAT5b gene is a new partner of retinoic acid receptor alpha in acute promyelocytic-like leukaemia. Hum. Mol. Genet. 1999;8:1741–1749. doi: 10.1093/hmg/8.9.1741. [DOI] [PubMed] [Google Scholar]
- 91.Catalano A., Dawson M.A., Somana K., Opat S., Schwarer A., Campbell L.J., Iland H. The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia. Blood. 2007;110:4073–4076. doi: 10.1182/blood-2007-06-095554. [DOI] [PubMed] [Google Scholar]
- 92.Kondo T., Mori A., Darmanin S., Hashino S., Tanaka J., Asaka M. The seventh pathogenic fusion gene FIP1L1-RARA was isolated from a t(4;17)-positive acute promyelocytic leukemia. Haematologica. 2008;93:1414–1416. doi: 10.3324/haematol.12854. [DOI] [PubMed] [Google Scholar]
- 93.Yamamoto Y., Tsuzuki S., Tsuzuki M., Handa K., Inaguma Y., Emi N. BCOR as a novel fusion partner of retinoic acid receptor alpha in a t(X;17)(p11;q12) variant of acute promyelocytic leukemia. Blood. 2010;116:4274–4283. doi: 10.1182/blood-2010-01-264432. [DOI] [PubMed] [Google Scholar]
- 94.Won D., Shin S.Y., Park C.J.J., Jang S., Chi H.S.S., Lee K.H.H., Lee J.O.O., Seo E.J.J. OBFC2A/RARA: A novel fusion gene in variant acute promyelocytic leukemia. Blood. 2013;121:1432–1435. doi: 10.1182/blood-2012-04-423129. [DOI] [PubMed] [Google Scholar]
- 95.Chen Y., Li S., Zhou C., Li C., Ru K., Rao Q., Xing H., Tian Z., Tang K., Mi Y., et al. TBLR1 fuses to retinoid acid receptor α in a variant t(3;17)(q26;q21) translocation of acute promyelocytic leukemia. Blood. 2014;124:936–945. doi: 10.1182/blood-2013-10-528596. [DOI] [PubMed] [Google Scholar]
- 96.Li J., Zhong H.Y., Zhang Y., Xiao L., Bai L.H., Liu S.F., Zhou G.B., Zhang G.S. GTF2I-RARA is a novel fusion transcript in a t(7;17) variant of acute promyelocytic leukaemia with clinical resistance to retinoic acid. Br. J. Haematol. 2015;168:904–908. doi: 10.1111/bjh.13157. [DOI] [PubMed] [Google Scholar]
- 97.Yin C.C., Jain N., Mehrotra M., Zhagn J., Protopopov A., Zuo Z., Pemmaraju N., DiNardo C., Hirsch-Ginsberg C., Wang S.A., et al. Identification of a novel fusion gene, IRF2BP2-RARA, in acute promyelocytic leukemia. J. Natl. Compr. Canc. Netw. 2015;13:19–22. doi: 10.6004/jnccn.2015.0005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Cheng C.K., Wang A.Z., Wong T.H.Y., Wan T.S.K., Cheung J.S., Raghupathy R., Chan N.P.H., Ng M.H.L. FNDC3B is another novel partner fused to RARA in the t(3;17)(q26;q21) variant of acute promyelocytic leukemia. Blood. 2017;129:2705–2709. doi: 10.1182/blood-2017-02-767707. [DOI] [PubMed] [Google Scholar]
- 99.Such E., Cervera J., Valencia A., Barragán E., Ibañez M., Luna I., Fuster O., Perez-Sirvent M.L., Senent L., Sempere A., et al. A novel NUP98/RARG gene fusion in acute myeloid leukemia resembling acute promyelocytic leukemia. Blood. 2011;117:242–245. doi: 10.1182/blood-2010-06-291658. [DOI] [PubMed] [Google Scholar]
- 100.Ha J.S., Do Y.R., Ki C.S., Lee C., Kim D.H., Lee W., Ryoo N.H., Jeon D.S. Identification of a novel PML-RARG fusion in acute promyelocytic leukemia. Leukemia. 2017;31:1992–1995. doi: 10.1038/leu.2017.167. [DOI] [PubMed] [Google Scholar]
- 101.Such E., Cordón L., Sempere A., Villamón E., Ibañez M., Luna I., Gómez-Seguí I., López-Pavía M., Alonso C., Lo-Coco F., et al. In vitro all-trans retinoic acid sensitivity of acute myeloid leukemia blasts with NUP98/RARG fusion gene. Ann. Hematol. 2014;93:1931–1933. doi: 10.1007/s00277-014-2073-5. [DOI] [PubMed] [Google Scholar]
- 102.Licht J.D., Chomienne C., Goy A., Chen A., Scott A.A., Head D.R., Michaux J.L., Wu Y., DeBlasio A., Miller W.H. Clinical and molecular characterization of a rare syndrome of acute promyelocytic leukemia associated with translocation (11;17) Blood. 1995;85:1083–1094. doi: 10.1182/blood.V85.4.1083.bloodjournal8541083. [DOI] [PubMed] [Google Scholar]
- 103.Nicci C., Ottaviani E., Luatti S., Grafone T., Tonelli M., Motta M.R., Malagola M., Marzocchi G., Martinelli G., Baccarani M., et al. Molecular and cytogenetic characterization of a new case of t(5;17)(q35;q21) variant acute promyelocytic leukemia. Leukemia. 2005;19:470–472. doi: 10.1038/sj.leu.2403645. [DOI] [PubMed] [Google Scholar]
- 104.Redner R.L., Rush E.A., Faas S., Rudert W.A., Corey S.J. The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood. 1996;87:882–886. doi: 10.1182/blood.V87.3.882.bloodjournal873882. [DOI] [PubMed] [Google Scholar]
- 105.Ciangola G., Gurnari C., Paterno G., Mirabile M., Angelini M., Lavorgna S., Ottone T., Travaglini S., Cicconi L., LoCoco F. STAT5b-RARa-positive acute myeloid leukemia: Diagnostic and therapeutic challenges of a rare AML subtype. Leuk. Res. 2019;78:21–23. doi: 10.1016/j.leukres.2019.01.004. [DOI] [PubMed] [Google Scholar]
- 106.Menezes J., Acquadro F., de la Villa C.P.P., García-Sánchez F., Álvarez S., Cigudosa J.C. FIP1L1/RARA with breakpoint at FIP1L1 intron 13: A variant translocation in acute promyelocytic leukemia. Haematologica. 2011;96:1565–1566. doi: 10.3324/haematol.2011.047134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Ichikawa S., Ichikawa S., Ishikawa I., Takahashi T., Fujiwara T., Harigae H. Successful treatment of acute promyelocytic leukemia with a t(X;17)(p11.4;q21) and BCOR-RARA fusion gene. Cancer Genet. 2015;208:162–163. doi: 10.1016/j.cancergen.2015.01.008. [DOI] [PubMed] [Google Scholar]
- 108.Osumi T., Watanabe A., Okamura K., Nakabayashi K., Yoshida M., Tsujimoto S.I., Uchiyama M., Takahashi H., Tomizawa D., Hata K., et al. Acute promyelocytic leukemia with a cryptic insertion of RARA into TBL1XR1. Genes. Chromosomes Cancer. 2019;58:820–823. doi: 10.1002/gcc.22791. [DOI] [PubMed] [Google Scholar]
- 109.Liu Y., Xu F., Hu H., Wen J., Su J., Zhou Q., Qu W. A rare case of acute promyelocytic leukemia with IRF2BP2-RARA fusion; and literature review. Onco Targets Ther. 2019;12:6157–6163. doi: 10.2147/OTT.S217622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.Jovanovic J.V., Chillón M.C., Vincent-Fabert C., Dillon R., Voisset E., Gutiérrez N.C., Sanz R.G., Lopez A.A.M., Morgan Y.G., Lok J., et al. The cryptic IRF2BP2-RARA fusion transforms hematopoietic stem/progenitor cells and induces retinoid-sensitive acute promyelocytic leukemia. Leukemia. 2017;31:747–751. doi: 10.1038/leu.2016.338. [DOI] [PubMed] [Google Scholar]
- 111.Shimomura Y., Mitsui H., Yamashita Y., Kamae T., Kanai A., Matsui H., Ishibashi T., Tanimura A., Shibayama H., Oritani K., et al. New variant of acute promyelocytic leukemia with IRF2BP2-RARA fusion. Cancer Sci. 2016;107:1165–1168. doi: 10.1111/cas.12970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Mazharuddin S., Chattopadhyay A., Levy M.Y., Redner R.L. IRF2BP2-RARA t(1;17)(q42.3;q21.2) APL blasts differentiate in response to all-trans retinoic acid. Leuk. Lymphoma. 2018;59:2246–2249. doi: 10.1080/10428194.2017.1421761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 113.Mallardo M., Caronno A., Pruneri G., Raviele P.R., Viale A., Pelicci P.G., Colombo E. NPMc+ and FLT3_ITD mutations cooperate in inducing acute leukaemia in a novel mouse model. Leukemia. 2013;27:2248–2251. doi: 10.1038/leu.2013.114. [DOI] [PubMed] [Google Scholar]
- 114.Vassiliou G.S., Cooper J.L., Rad R., Li J., Rice S., Uren A., Rad L., Ellis P., Andrews R., Banerjee R., et al. Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat. Genet. 2011;43:470–475. doi: 10.1038/ng.796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Cancer Genome Atlas Research Network. Ley T.J., Miller C., Ding L., Raphael B.J., Mungall A.J., Robertson A.G., Hoadley K., Triche T.J., Laird P.W., et al. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N. Engl. J. Med. 2013;368:2059–2074. doi: 10.1056/NEJMoa1301689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116.Riva L., Ronchini C., Bodini M., Lo-Coco F., Lavorgna S., Ottone T., Martinelli G., Iacobucci I., Tarella C., Cignetti A., et al. Acute promyelocytic leukemias share cooperative mutations with other myeloid-leukemia subgroups. Blood Cancer J. 2013;3:e147. doi: 10.1038/bcj.2013.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 117.Lawrence M.S., Stojanov P., Mermel C.H., Robinson J.T., Garraway L.A., Golub T.R., Meyerson M., Gabriel S.B., Lander E.S., Getz G. Discovery and saturation analysis of cancer genes across 21 tumour types. Nature. 2014;505:495–501. doi: 10.1038/nature12912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Cervera J., Montesinos P., Hernández-Rivas J.M., Calasanz M.J., Aventín A., Ferro M.T., Luño E., Sánchez J., Vellenga E., Rayón C., et al. Additional chromosome abnormalities in patients with acute promyelocytic leukemia treated with all-trans retinoic acid and chemotherapy. Haematologica. 2010;95:424–431. doi: 10.3324/haematol.2009.013243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 119.Arber D.A., Orazi A., Hasserjian R., Thiele J., Borowitz M.J., Le Beau M.M., Bloomfield C.D., Cazzola M., Vardiman J.W. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood. 2016;127:2391–2405. doi: 10.1182/blood-2016-03-643544. [DOI] [PubMed] [Google Scholar]
- 120.Delgado M.D., Albajar M., Gomez-Casares M.T., Batlle A., León J. MYC oncogene in myeloid neoplasias. Clin. Transl. Oncol. 2013;15:87–94. doi: 10.1007/s12094-012-0926-8. [DOI] [PubMed] [Google Scholar]
- 121.Jones L., Wei G., Sevcikova S., Phan V., Jain S., Shieh A., Wong J.C.Y., Li M., Dubansky J., Maunakea M.L., et al. Gain of MYC underlies recurrent trisomy of the MYC chromosome in acute promyelocytic leukemia. J. Exp. Med. 2010;207:2581–2594. doi: 10.1084/jem.20091071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 122.Le Beau M.M., Davis E.M., Patel B., Phan V.T., Sohal J., Kogan S.C. Recurring chromosomal abnormalities in leukemia in PML-RARA transgenic mice identify cooperating events and genetic pathways to acute promyelocytic leukemia. Blood. 2003;102:1072–1074. doi: 10.1182/blood-2003-01-0155. [DOI] [PubMed] [Google Scholar]
- 123.Ronchini C., Brozzi A., Riva L., Luzi L., Gruszka A.M., Melloni G.E.M., Scanziani E., Dharmalingam G., Mutarelli M., Belcastro V., et al. PML-RARA-associated cooperating mutations belong to a transcriptional network that is deregulated in myeloid leukemias. Leukemia. 2017;31:1975–1986. doi: 10.1038/leu.2016.386. [DOI] [PubMed] [Google Scholar]
- 124.Nowak D., Klaumuenzer M., Hanfstein B., Mossner M., Nolte F., Nowak V., Oblaender J., Hecht A., Hütter G., Ogawa S., et al. SNP array analysis of acute promyelocytic leukemia may be of prognostic relevance and identifies a potential high risk group with recurrent deletions on chromosomal subband 1q31.3. Genes. Chromosomes Cancer. 2012;51:756–767. doi: 10.1002/gcc.21961. [DOI] [PubMed] [Google Scholar]
- 125.Gómez-Seguí I., Sánchez-Izquierdo D., Barragán E., Such E., Luna I., López-Pavía M., Ibáñez M., Villamón E., Alonso C., Martín I., et al. Single-nucleotide polymorphism array-based karyotyping of acute promyelocytic leukemia. PLoS ONE. 2014;9:e100245. doi: 10.1371/journal.pone.0100245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 126.Labrador J., Luño E., Vellenga E., Brunet S., González-Campos J., Chillón M.C., Holowiecka A., Esteve J., Bergua J., González-Sanmiguel J.D., et al. Clinical significance of complex karyotype at diagnosis in pediatric and adult patients with de novo acute promyelocytic leukemia treated with ATRA and chemotherapy. Leuk. Lymphoma. 2018;60:1146–1155. doi: 10.1080/10428194.2018.1522438. [DOI] [PubMed] [Google Scholar]
- 127.Mullighan C.G., Goorha S., Radtke I., Miller C.B., Coustan-Smith E., Dalton J.D., Girtman K., Mathew S., Ma J., Pounds S.B., et al. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature. 2007;446:758–764. doi: 10.1038/nature05690. [DOI] [PubMed] [Google Scholar]
- 128.Ibáñez M., Carbonell-Caballero J., García-Alonso L., Such E., Jiménez-Almazán J., Vidal E., Barragán E., López-Pavía M., LLop M., Martín I., et al. The Mutational Landscape of Acute Promyelocytic Leukemia Reveals an Interacting Network of Co-Occurrences and Recurrent Mutations. PLoS ONE. 2016;11:e0148346. doi: 10.1371/journal.pone.0148346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 129.Shen Y., Fu Y.K., Zhu Y.M., Lou Y.J., Gu Z.H., Shi J.Y., Chen B., Chen C., Zhu H.H., Hu J., et al. Mutations of Epigenetic Modifier Genes as a Poor Prognostic Factor in Acute Promyelocytic Leukemia Under Treatment With All-Trans Retinoic Acid and Arsenic Trioxide. EBioMedicine. 2015;2:563–571. doi: 10.1016/j.ebiom.2015.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 130.Picharski G.L., Andrade D.P., Fabro A.L.M.R., Lenzi L., Tonin F.S., Ribeiro R.C., Figueiredo B.C. The Impact of Flt3 Gene Mutations in Acute Promyelocytic Leukemia: A Meta-Analysis. Cancers. 2019;11:1311. doi: 10.3390/cancers11091311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 131.Barragán E., Montesinos P., Camos M., González M., Calasanz M.J., Román-Gómez J., Gómez-Casares M.T., Ayala R., López J., Fuster Ó., et al. Prognostic value of FLT3 mutations in patients with acute promyelocytic leukemia treated with all-trans retinoic acid and anthracycline monochemotherapy. Haematologica. 2011;96:1470–1477. doi: 10.3324/haematol.2011.044933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 132.Esnault C., Rahmé R., Rice K.L., Berthier C., Gaillard C., Quentin S., Maubert A.L., Kogan S., de Thé H. FLT3-ITD impedes retinoic acid, but not arsenic, responses in murine acute promyelocytic leukemias. Blood. 2019;133:1495–1506. doi: 10.1182/blood-2018-07-866095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 133.Wang L.N., Tang Y.L., Zhang Y.C., Zhang Z.H., Liu X.J., Ke Z.Y., Li Y., Tan H.Z., Huang L.B., Luo X.Q. Arsenic trioxide and all-trans-retinoic acid selectively exert synergistic cytotoxicity against FLT3-ITD AML cells via co-inhibition of FLT3 signaling pathways. Leuk. Lymphoma. 2017;58:2426–2438. doi: 10.1080/10428194.2017.1289522. [DOI] [PubMed] [Google Scholar]
- 134.Cicconi L., Divona M., Ciardi C., Ottone T., Ferrantini A., Lavorgna S., Alfonso V., Paoloni F., Piciocchi A., Avvisati G., et al. PML-RARα kinetics and impact of FLT3-ITD mutations in newly diagnosed acute promyelocytic leukaemia treated with ATRA and ATO or ATRA and chemotherapy. Leukemia. 2016;30:1987–1992. doi: 10.1038/leu.2016.122. [DOI] [PubMed] [Google Scholar]
- 135.Lehmann-Che J., Bally C., Letouzé E., Berthier C., Yuan H., Jollivet F., Ades L., Cassinat B., Hirsch P., Pigneux A., et al. Dual origin of relapses in retinoic-Acid resistant acute promyelocytic leukemia. Nat. Commun. 2018;9:1–8. doi: 10.1038/s41467-018-04384-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 136.Iaccarino L., Ottone T., Alfonso V., Cicconi L., Divona M., Lavorgna S., Travaglini S., Ferrantini A., Falconi G., Baer C., et al. Mutational landscape of patients with acute promyelocytic leukemia at diagnosis and relapse. Am. J. Hematol. 2019;94:1091–1097. doi: 10.1002/ajh.25573. [DOI] [PubMed] [Google Scholar]
- 137.Madan V., Shyamsunder P., Han L., Mayakonda A., Nagata Y., Sundaresan J., Kanojia D., Yoshida K., Ganesan S., Hattori N., et al. Comprehensive mutational analysis of primary and relapse acute promyelocytic leukemia. Leukemia. 2016;30:1672–1681. doi: 10.1038/leu.2016.69. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 138.Iaccarino L., Ottone T., Divona M., Cicconi L., Cairoli R., Voso M.T., Lo-Coco F. Mutations affecting both the rearranged and the unrearranged PML alleles in refractory acute promyelocytic leukaemia. Br. J. Haematol. 2016;172:909–913. doi: 10.1111/bjh.13910. [DOI] [PubMed] [Google Scholar]
- 139.Zhu H.H., Qin Y.Z., Huang X.J. Resistance to arsenic therapy in acute promyelocytic leukemia. N. Engl. J. Med. 2014;370:1864–1866. doi: 10.1056/NEJMc1316382. [DOI] [PubMed] [Google Scholar]
- 140.Noguera N.I., Catalano G., Banella C., Divona M., Faraoni I., Ottone T., Arcese W., Voso M.T. Acute Promyelocytic Leukemia: Update on the Mechanisms of Leukemogenesis, Resistance and on Innovative Treatment Strategies. Cancers. 2019;11:1591. doi: 10.3390/cancers11101591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 141.Lucena-Araujo A.R., Coelho-Silva J.L., Pereira-Martins D.A., Silveira D.R., Koury L.C., Melo R.A.M., Bittencourt R., Pagnano K., Pasquini R., Nunes E.C., et al. Combining gene mutation with gene expression analysis improves outcome prediction in acute promyelocytic leukemia. Blood. 2019;134:951–959. doi: 10.1182/blood.2019000239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 142.Chen S., Li X., Ma S., Xing X., Wang X., Zhu Z. Chemogenomics analysis of drug targets for the treatment of acute promyelocytic leukemia. Ann. Hematol. 2020 doi: 10.1007/s00277-019-03888-4. [DOI] [PubMed] [Google Scholar]
- 143.Jurcic J.G., Nimer S.D., Scheinberg D.A., DeBlasio T., Warrell R.P., Miller W.H. Prognostic significance of minimal residual disease detection and PML/RAR-alpha isoform type: Long-term follow-up in acute promyelocytic leukemia. Blood. 2001;98:2651–2656. doi: 10.1182/blood.V98.9.2651. [DOI] [PubMed] [Google Scholar]
- 144.Grimwade D., Jovanovic J.V., Hills R.K., Nugent E.A., Patel Y., Flora R., Diverio D., Jones K., Aslett H., Batson E., et al. Prospective minimal residual disease monitoring to predict relapse of acute promyelocytic leukemia and to direct pre-emptive arsenic trioxide therapy. J. Clin. Oncol. 2009;27:3650–3658. doi: 10.1200/JCO.2008.20.1533. [DOI] [PubMed] [Google Scholar]
- 145.Miller W.H., Kakizuka A., Frankel S.R., Warrell R.P., DeBlasio A., Levine K., Evans R.M., Dmitrovsky E. Reverse transcription polymerase chain reaction for the rearranged retinoic acid receptor alpha clarifies diagnosis and detects minimal residual disease in acute promyelocytic leukemia. Proc. Natl. Acad. Sci. USA. 1992;89:2694–2698. doi: 10.1073/pnas.89.7.2694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 146.Lo Coco F., Diverio D., Pandolfi P.P., Biondi A., Rossi V., Avvisati G., Rambaldi A., Arcese W., Petti M.C., Meloni G. Molecular evaluation of residual disease as a predictor of relapse in acute promyelocytic leukaemia. Lancet. 1992;340:1437–1438. doi: 10.1016/0140-6736(92)92625-P. [DOI] [PubMed] [Google Scholar]
- 147.Diverio D., Pandolfi P.P., Biondi A., Avvisati G., Petti M.C., Mandelli F., Pelicci G., Lo Coco F. Absence of reverse transcription-polymerase chain reaction detectable residual disease in patients with acute promyelocytic leukemia in long-term remission. Blood. 1993;82:3556–3559. doi: 10.1182/blood.V82.12.3556.3556. [DOI] [PubMed] [Google Scholar]
- 148.Laczika K., Mitterbauer G., Korninger L., Knöbl P., Schwarzinger I., Kapiotis S., Haas O.A., Kyrle P.A., Pont J., Oehler L. Rapid achievement of PML-RAR alpha polymerase chain reaction (PCR)-negativity by combined treatment with all-trans-retinoic acid and chemotherapy in acute promyelocytic leukemia: A pilot study. Leukemia. 1994;8:1–5. [PubMed] [Google Scholar]
- 149.Diverio D., Rossi V., Avvisati G., De Santis S., Pistilli A., Pane F., Saglio G., Martinelli G., Petti M.C., Santoro A., et al. Early detection of relapse by prospective reverse transcriptase-polymerase chain reaction analysis of the PML/RARalpha fusion gene in patients with acute promyelocytic leukemia enrolled in the GIMEMA-AIEOP multicenter “AIDA” trial. GIMEMA-AIEOP Multicente. Blood. 1998;92:784–789. doi: 10.1182/blood.V92.3.784. [DOI] [PubMed] [Google Scholar]
- 150.Burnett A.K., Grimwade D., Solomon E., Wheatley K., Goldstone A.H. Presenting white blood cell count and kinetics of molecular remission predict prognosis in acute promyelocytic leukemia treated with all-trans retinoic acid: Result of the Randomized MRC Trial. Blood. 1999;93:4131–4143. doi: 10.1182/blood.V93.12.4131. [DOI] [PubMed] [Google Scholar]
- 151.Mandelli F., Diverio D., Avvisati G., Luciano A., Barbui T., Bernasconi C., Broccia G., Cerri R., Falda M., Fioritoni G., et al. Molecular remission in PML/RAR alpha-positive acute promyelocytic leukemia by combined all-trans retinoic acid and idarubicin (AIDA) therapy. Gruppo Italiano-Malattie Ematologiche Maligne dell’Adulto and Associazione Italiana di Ematologia ed Oncologia Pe. Blood. 1997;90:1014–1021. [PubMed] [Google Scholar]
- 152.Meloni G., Diverio D., Vignetti M., Avvisati G., Capria S., Petti M.C., Mandelli F., Lo Coco F. Autologous bone marrow transplantation for acute promyelocytic leukemia in second remission: Prognostic relevance of pretransplant minimal residual disease assessment by reverse-transcription polymerase chain reaction of the PML/RAR alpha fusion gene. Blood. 1997;90:1321–1325. doi: 10.1182/blood.V90.3.1321. [DOI] [PubMed] [Google Scholar]
- 153.Sanz M.A., Martín G., Rayón C., Esteve J., González M., Díaz-Mediavilla J., Bolufer P., Barragán E., Terol M.J., González J.D., et al. A modified AIDA protocol with anthracycline-based consolidation results in high antileukemic efficacy and reduced toxicity in newly diagnosed PML/RARalpha-positive acute promyelocytic leukemia. PETHEMA group. Blood. 1999;94:3015–3021. [PubMed] [Google Scholar]
- 154.Lengfelder E., Reichert A., Schoch C., Haase D., Haferlach T., Löffler H., Staib P., Heyll A., Seifarth W., Saussele S., et al. Double induction strategy including high dose cytarabine in combination with all-trans retinoic acid: Effects in patients with newly diagnosed acute promyelocytic leukemia. German AML Cooperative Group. Leukemia. 2000;14:1362–1370. doi: 10.1038/sj.leu.2401843. [DOI] [PubMed] [Google Scholar]
- 155.Grimwade D., Lo Coco F. Acute promyelocytic leukemia: A model for the role of molecular diagnosis and residual disease monitoring in directing treatment approach in acute myeloid leukemia. Leukemia. 2002;16:1959–1973. doi: 10.1038/sj.leu.2402721. [DOI] [PubMed] [Google Scholar]
- 156.Holter Chakrabarty J.L., Rubinger M., Le-Rademacher J., Wang H.L., Grigg A., Selby G.B., Szer J., Rowe J.M., Weisdorf D.J., Tallman M.S. Autologous is superior to allogeneic hematopoietic cell transplantation for acute promyelocytic leukemia in second complete remission. Biol. Blood Marrow Transpl. 2014;20:1021–1025. doi: 10.1016/j.bbmt.2014.03.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 157.Cheson B.D., Bennett J.M., Kopecky K.J., Büchner T., Willman C.L., Estey E.H., Schiffer C.A., Doehner H., Tallman M.S., Lister T.A., et al. Revised recommendations of the International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia. J. Clin. Oncol. 2003;21:4642–4649. doi: 10.1200/JCO.2003.04.036. [DOI] [PubMed] [Google Scholar]
- 158.Lengfelder E., Lo-Coco F., Ades L., Montesinos P., Grimwade D., Kishore B., Ramadan S.M., Pagoni M., Breccia M., Huerta A.J.G., et al. Arsenic trioxide-based therapy of relapsed acute promyelocytic leukemia: Registry results from the European LeukemiaNet. Leukemia. 2015;29:1084–1091. doi: 10.1038/leu.2015.12. [DOI] [PubMed] [Google Scholar]
- 159.Grimwade D., Howe K., Langabeer S., Burnett A., Goldstone A., Solomon E. Minimal residual disease detection in acute promyelocytic leukemia by reverse-transcriptase PCR: Evaluation of PML-RAR alpha and RAR alpha-PML assessment in patients who ultimately relapse. Leukemia. 1996;10:61–66. [PubMed] [Google Scholar]
- 160.Martinelli G., Remiddi C., Visani G., Farabegoli P., Testoni N., Zaccaria A., Manfroi S., Cenacchi A., Russo D., Bandini G. Molecular analysis of PML-RAR alpha fusion mRNA detected by reverse transcription-polymerase chain reaction assay in long-term disease-free acute promyelocytic leukaemia patients. Br. J. Haematol. 1995;90:966–968. doi: 10.1111/j.1365-2141.1995.tb05228.x. [DOI] [PubMed] [Google Scholar]
- 161.Lo Coco F., Diverio D., Falini B., Biondi A., Nervi C., Pelicci P.G. Genetic diagnosis and molecular monitoring in the management of acute promyelocytic leukemia. Blood. 1999;94:12–22. doi: 10.1182/blood.V94.1.12.413a44_12_22. [DOI] [PubMed] [Google Scholar]
- 162.Gabert J., Beillard E., van der Velden V.H.J., Bi W., Grimwade D., Pallisgaard N., Barbany G., Cazzaniga G., Cayuela J.M., Cavé H., et al. Standardization and quality control studies of “real-time” quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia—A Europe Against Cancer program. Leukemia. 2003;17:2318–2357. doi: 10.1038/sj.leu.2403135. [DOI] [PubMed] [Google Scholar]
- 163.Santamaría C., Chillón M.C., Fernández C., Martín-Jiménez P., Balanzategui A., García Sanz R., San Miguel J.F., González M.G. Using quantification of the PML-RARalpha transcript to stratify the risk of relapse in patients with acute promyelocytic leukemia. Haematologica. 2007;92:315–322. doi: 10.3324/haematol.10734. [DOI] [PubMed] [Google Scholar]
- 164.Hu J., Liu Y.F., Wu C.F., Xu F., Shen Z.X., Zhu Y.M., Li J.M., Tang W., Zhao W.L., Wu W., et al. Long-term efficacy and safety of all-trans retinoic acid/arsenic trioxide-based therapy in newly diagnosed acute promyelocytic leukemia. Proc. Natl. Acad. Sci. USA. 2009;106:3342–3347. doi: 10.1073/pnas.0813280106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 165.Zhu H.H., Wu D.P., Jin J., Li J.Y., Ma J., Wang J.X., Jiang H., Chen S.J., Huang X.J. Oral tetra-arsenic tetra-sulfide formula versus intravenous arsenic trioxide as first-line treatment of acute promyelocytic leukemia: A multicenter randomized controlled trial. J. Clin. Oncol. 2013;31:4215–4221. doi: 10.1200/JCO.2013.48.8312. [DOI] [PubMed] [Google Scholar]
- 166.Zhu H.H., Huang X.J. Oral arsenic and retinoic acid for non-high-risk acute promyelocytic leukemia. N. Engl. J. Med. 2014;371:2239–2241. doi: 10.1056/NEJMc1412035. [DOI] [PubMed] [Google Scholar]
- 167.Chendamarai E., Balasubramanian P., George B., Viswabandya A., Abraham A., Ahmed R., Alex A.A., Ganesan S., Lakshmi K.M., Sitaram U., et al. Role of minimal residual disease monitoring in acute promyelocytic leukemia treated with arsenic trioxide in frontline therapy. Blood. 2012;119:3413–3419. doi: 10.1182/blood-2011-11-393264. [DOI] [PubMed] [Google Scholar]
- 168.Grimwade D., Jovanovic J.V., Hills R.K. Can we say farewell to monitoring minimal residual disease in acute promyelocytic leukaemia? Best Pr. Res. Clin. Haematol. 2014;27:53–61. doi: 10.1016/j.beha.2014.04.002. [DOI] [PubMed] [Google Scholar]
- 169.Schuurhuis G.J., Heuser M., Freeman S., Béné M.C., Buccisano F., Cloos J., Grimwade D., Haferlach T., Hills R.K., Hourigan C.S., et al. Minimal/measurable residual disease in AML: A consensus document from the European LeukemiaNet MRD Working Party. Blood. 2018;131:1275–1291. doi: 10.1182/blood-2017-09-801498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 170.Sanz M.A., Lo Coco F., Martín G., Avvisati G., Rayón C., Barbui T., Díaz-Mediavilla J., Fioritoni G., González J.D., Liso V., et al. Definition of relapse risk and role of nonanthracycline drugs for consolidation in patients with acute promyelocytic leukemia: A joint study of the PETHEMA and GIMEMA cooperative groups. Blood. 2000;96:1247–1253. [PubMed] [Google Scholar]
- 171.Brunetti C., Anelli L., Zagaria A., Minervini A., Minervini C.F., Casieri P., Coccaro N., Cumbo C., Tota G., Impera L., et al. Droplet Digital PCR Is a Reliable Tool for Monitoring Minimal Residual Disease in Acute Promyelocytic Leukemia. J. Mol. Diagn. 2017;19:437–444. doi: 10.1016/j.jmoldx.2017.01.004. [DOI] [PubMed] [Google Scholar]
- 172.DiNardo C.D., Wei A.H. How I treat acute myeloid leukemia in the era of new drugs. Blood. 2020;135:85–96. doi: 10.1182/blood.2019001239. [DOI] [PubMed] [Google Scholar]