Interleukin-33 induces the enzyme tryptophan hydroxylase 1 to promote inflammatory group 2 innate lymphoid cell-mediated immunity

Summary

Group 2 innate lymphoid cells (ILC2s) regulate immunity, inflammation and tissue homeostasis. Two distinct subsets of ILC2s have been described: steady-state natural ILC2s and inflammatory ILC2s, which are elicited following helminth infection. However, how tissue-specific cues regulate these two subsets of ILC2s and their effector functions remains elusive. Here, we report that interleukin-33 (IL-33) promotes the generation of inflammatory ILC2s (ILC2^INFLAM) via induction of the enzyme tryptophan hydroxylase 1 (Tph1). Tph1 expression was up-regulated in ILC2s upon activation with IL-33 or following helminth infection in an IL-33-dependent manner. Conditional deletion of Tph1 in lymphocytes resulted in selective impairment of ILC2^INFLAM responses and increased susceptibility to helminth infection. Further, RNA sequencing analysis revealed altered gene expression in Tph1 deficient ILC2s including inducible T-cell co-stimulator (Icos). Collectively, these data reveal a previously unrecognized function for IL-33, Tph1 and ICOS in promoting inflammatory ILC2 responses and type 2 immunity at mucosal barriers.

eTOC blurb:

IL-33 is a potent activator of type 2 immune responses via the stimulation of ILC2s, but the downstream pathways triggered in these cells are poorly defined. Flamar and colleagues show that IL-33 controls tryptophan hydroxylase 1 expression in ILC2s, which is required for type 2 immunity against worm infections.

Introduction

Immunity at body’s barrier surfaces is mediated by a wide array of tissue-resident immune cells, which constitute a first line of defense against infection (Fan and Rudensky, 2016; Klose and Artis, 2016; Rankin and Artis, 2018). Innate lymphoid cells (ILCs) are primarily tissue-resident lymphocytes, which are enriched at barrier surfaces (Gasteiger et al., 2015; Moro et al., 2016; Peng et al., 2013), and have emerged as important regulators of immunity, inflammation and tissue homeostasis (Artis and Spits, 2015; Eberl et al., 2015; Klose and Artis, 2016; Vivier et al., 2018). ILCs share functional diversity with helper T cells, characterized by the expression of similar lineage-specifying transcription factors and effector molecules. Although ILCs lack antigen-specific receptors, their localization at barrier surfaces allows them to quickly react to pathogenic and environmental stimuli (Diefenbach et al., 2014; Klose and Artis, 2016; Spits et al., 2013; Vivier et al., 2018).

Group 2 ILCs (ILC2s) have high expression of the lineage-specifying transcription factor GATA-3 and mediate diverse functions by producing a wide variety of cytokines and growth factors, such as interleukin (IL)-4, IL-5, IL-9, IL-13, amphiregulin. However, it is unknown whether individual populations of ILC2s produce all these effector molecules or whether functionally distinct ILC2 subsets are present in tissues. Similar to T helper-2 (Th2) cells, ILC2s trigger type 2 inflammation and have been implicated in many physiological and pathophysiological processes, including resistance to helminth infections, allergic inflammation, metabolic homeostasis, fibrosis and tissue repair (Hoyler et al., 2012; Klose and Artis, 2016; McHedlidze et al., 2013; Mjosberg et al., 2012; Monticelli et al., 2015; Monticelli et al., 2011; Moro et al., 2010; Neill et al., 2010; Spits et al., 2013; Vivier et al., 2018). ILC2s are activated via engagement of stimulatory receptors including glucocorticoid-induced tumor necrosis factor receptor (GITR) and inducible T-cell co-stimulator (ICOS) (Maazi et al., 2015; Nagashima et al., 2018; Paclik et al., 2015) and by cytokines, such as IL-25, IL-33 and thymic stromal lymphopoietin (Artis and Spits, 2015; Eberl et al., 2015; Klose and Artis, 2016; Vivier et al., 2018). Recently, it has been reported that in the context of infection with the nematode Nippostrongylus brasiliensis (N.brasiliensis) or after injection of recombinant IL-25 (rIL-25), a second population of ILC2s is induced in the lungs and mesenteric lymph nodes (mesLN), termed inflammatory ILC2s (ILC2^INFLAM) as opposed to natural ILC2 (ILC2^NAT), which reside in these tissues at steady state (Huang et al., 2015). Phenotypically, ILC2^INFLAM have high expression of the activation marker KLRG1 and IL-25 receptor (IL-17RB), but low expression of IL-33 receptor ST2 (T1) (Huang et al., 2015). Notably, ILC2^INFLAM are thought to differentiate from intestinal ILC2s (Huang et al., 2015; Huang et al., 2018). However, how ILC2^INFLAM subset is generated remains poorly understood.

IL-33 is an alarmin secreted by various cell types upon cell damage and is an important mediator of homeostasis of ILC2s and other immune cells in many tissues including, but not limited to, the intestine, lung, adipose tissue and skin (Brestoff et al., 2015; Halim et al., 2012; Kim et al., 2013; Mahlakoiv et al., 2019; Molofsky et al., 2015a; Monticelli et al., 2011; Moro et al., 2010; Rak et al., 2016). IL-33 plays a pivotal role in anti-helminth immunity (Hung et al., 2013; Moro et al., 2010; Price et al., 2010). Further, IL-33 is closely linked to detrimental immune responses, such as allergic inflammation in mice and human (Halim et al., 2014; Imai et al., 2013; Li et al., 2015; Moffatt et al., 2010; Molofsky et al., 2015b; Salimi et al., 2013). Therefore, IL-33 and its receptor, ST2, expressed on ILC2s are central in the regulation of type 2 inflammation in health and disease.

Although transcriptome of mouse and human ILC2s in different tissues have been studied (Bjorklund et al., 2016; Gury-BenAri et al., 2016; Ricardo-Gonzalez et al., 2018; Robinette et al., 2015; Simoni et al., 2017; Yudanin et al., 2019), how population heterogeneity of ILC2s impacts the outcome of protective or pathologic immune responses remains elusive. Our work identified IL-33 as an important regulator of ILC2 subset heterogeneity in the mucosa, and in particular, for the transition to ILC2^INFLAM upon helminth infection. Furthermore, stimulation of ILC2s by IL-33 treatment or following N. brasiliensis infection resulted in the up-regulation of the transcript for tryptophan hydroxylase 1 (Tph1), the rate limiting enzyme in serotonin biosynthesis. Likewise, up-regulation of Tph1 was dependent on IL-33. Moreover, conditional deletion of Tph1 in lymphocytes resulted in defective ILC2^INFLAM responses and impaired expulsion of N. brasiliensis. Mechanistically, Tph1-deficiency was associated with delayed recruitment of ILC2^INFLAM to the mesenteric lymph nodes and altered expression of genes associated with co-stimulation and immune activation, including Icos, which was required for the generation of ILC2^INFLAM. Altogether, our data provide evidence of a previously unrecognized IL-33-Tph1-ILC2^INFLAM pathway regulating type 2 immunity.

Results

IL-33 regulates inflammatory ILC2s

To study how IL-33 regulates tissue heterogeneity of the ILC2 subsets during type 2 inflammation, we infected IL-33-deficient (Il33^−/−) and Il33^+/+ mice with the intestinal worm parasite N. brasiliensis and performed flow cytometry analysis of ILC2s from the mesLN using the published markers KLRG1 and CD25 (IL-2Rα chain) to identify ILC2s (Hoyler et al., 2012). Of note, in addition to lineage negative (Lin⁻) KLRG1⁺ CD25⁺ ST2⁺ ILC2 subset (termed natural ILC2s, ILC2^NAT) present in naïve mice, N. brasiliensis infection elicited a second population of Lin⁻ KLRG1⁺ cells, which were CD25⁻ and ST2⁻ (termed inflammatory ILC2s, ILC2^INFLAM), and which were reduced in Il33^−/− mice on day 7 and day 10 following infection with N. brasiliensis (Fig. 1a–f; Suppl. Fig. 1a–d). In addition, intestinal worm burden was significantly higher on day 7 and day 10 post-infection in Il33^−/− mice as previously published (Hung et al., 2013), suggesting that the IL-33-dependent generation of ILC2^INFLAM could be important for worm expulsion (Fig. 1c,f). Phenotypically, KLRG1⁺ CD25⁻ cells were CD127^low CD90^low Sca-1^low c-Kit⁺ ST2⁻ CCR9^high, consistent with previous reports in the literature (Fig. 1g) (Huang et al., 2015; Huang et al., 2018).

Figure 1: IL-33 regulates inflammatory ILC2s.

(a-c) Il33^+/+ and Il33^−/− mice were infected with N. brasiliensis or left uninfected and analyzed on day 7. (a) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. dpi: day post-infection. (b) Percentage (Mean + SD, uninfected n=3, Il33^+/+ n=5 and Il33^−/− n=5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ ILC2s (ILC2^NAT) among Lin⁻ cells in the mesenteric lymph nodes. (c) Worm burden in the small intestine. Each symbol represents data from one mouse. Data are pooled from two independent experiments. (d-f) Ill33^+/+ and Il33^−/− mice were infected with N. brasiliensis or left uninfected and analyzed on day 10. (d) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. dpi: day post-infection. (e) Percentage (Mean + SD, uninfected n=6, Il33^+/+ n=8 and Il33^−/− n=5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ ILC2s (ILC2^NAT) among Lin⁻ cells in the mesenteric lymph nodes. (f) Worm burden in the small intestine. Each symbol represents data from one mouse. Data are representative of two independent experiments.

(g) Wild-type mice were infected with N. brasiliensis and analyzed on day 7. Flow cytometry histogram overlays of surface marker expression in inflammatory (ILC2^INFLAM, blue) and natural (ILC2^NAT, red) ILC2s. Cells are gated on Lin⁻ CD45⁺ lymphocytes, KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT). Data are representative of two independent experiments.

(h,i) Wild-type mice were injected with PBS or IL-33 for three consecutive days and analyzed one day later. (h) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (i) Percentage (Mean + SD, n=5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Each symbol represents data from one mouse. Data are representative of three independent experiments.

(j,k) Small intestinal ILC2s from Il1rl1^+/+ and Il1rl1^−/− mice were sorted and cultured in vitro for 3 days in the presence of the indicated combination of cytokines. (j) Flow cytometry histogram overlays of surface ST2 expression. Cells are gated on live lymphocytes. (k) ST2 geometric mean fluorescence intensity (gMFI) on ILC2s from Il1rl1^+/+ mice (n=9 for all except IL-25 and IL-33 n=6). Each symbol represents paired data from one mouse. Data are pooled from three independent experiments.

(l,m) ILC2s from mesenteric lymph nodes of Vfl33 transgenic and wild-type (WT) mice. (l) Flow cytometry plots of ILC2s from mesenteric lymph nodes of Vfl33 transgenic and WT mice. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (m) Percentage (Mean + SD, WT n=9 and Vfl33 n=8) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Each symbol represents data from one mouse. Data are from two independent experiments combined.

(n,o) ILC2s from small intestinal lamina propria of Il33^+/+ and Il33^−/− mice. (n) Flow cytometry plots of ILC2s from small intestinal lamina propria of Il33^+/+ and Il33^−/− mice. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (o) Percentage (Mean + SD, Il33^+/+ n=5 and Il33^−/− n=4) of KLRG1⁺ ST2⁻ and KLRG1⁺ ST2⁺ cells among Lin⁻ cells in the small intestinal lamina propria. Each symbol represents data from one mouse. Data are from two independent experiments.

(p,q) ILC2s from small intestinal lamina propria of Il17rb^+/+ and Il17rb7^−/− mice. (p) Flow cytometry plots of ILC2s from small intestinal lamina propria of Il17rb^+/+ and Il17rb^−/− mice. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (q) Percentage (Mean + SD, Il17rb^+/+ n=9 and Il17rb^−/− n=10) of KLRG1⁺ ST2⁻ and KLRG1⁺ ST2⁺ cells among Lin⁻ cells in the small intestinal lamina propria. Each symbol represents data from one mouse. Data are from two independent experiments combined. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 and n.s., not significant. See also Suppl. Fig. 1.

Next, we tested whether administration of recombinant IL-33 (rIL-33) could promote ILC2^INFLAM generation. Four days after administration of rIL-33, we detected increased frequencies of KLRG1⁺ CD25⁻ ILC2^INFLAM in the mesLN of wild-type mice, which were barely detectable in PBS-treated mice (Fig. 1h,i and Suppl. Fig. 1e–h). Since ILC2^INFLAM were initially reported to be elicited upon IL-25 administration (Huang et al., 2015), we compared the capacity of IL-25 and IL-33 at stimulating ILC2^INFLAM in vivo. While both cytokines were capable of eliciting ILC2^INFLAM, rIL-25 treatment resulted in a stronger recruitment of ILC2^INFLAM to mesLN (Suppl. Fig. 1i,j). Moreover, injection of rIL-33 in IL-25 receptor-deficient (Il17rb^−/−) mice resulted in diminished induction of ILC2^INFLAM compared to wild-type mice, suggesting that the two cytokines might cooperatively elicit ILC2^INFLAM responses (Suppl. Fig. 1k,l). To further dissect how IL-25 and IL-33 support the generation of ILC2^INFLAM , we carried out in vitro cultures using sort-purified ILC2s from small intestinal (Si) lamina propria and tested whether combinations of the two cytokines promote down-regulation of ST2, a hallmark of ILC2^INFLAM. Addition of recombinant IL-33 to the culture medium resulted in modest down-regulation of ST2, whereas stimulation with IL-25 lead to strong up-regulation of ST2 (Fig. 1j,k). In contrast, in vitro cultures of ILC2s together with rIL-33 and rIL-25 resulted in a loss of ST2 expression comparable to that of ST2-deficient (Il1rl1^−/−) ILC2s (Fig. 1j). Therefore, taken together these data strongly suggest that IL-25 and IL-33 are both required and jointly promote ILC2^INFLAM induction.

Since ILC2^INFLAM are thought to originate from ILC2 in the intestine (Huang et al., 2015; Huang et al., 2018), we analyzed transgenic mice, which over-express IL-33 selectively under the villin promoter in intestinal epithelial cells (Vfl33) (He et al., 2018). Consistent with our previous findings, more ILC2^INFLAM were recovered from the mesLN of Vfl33 mice compared to wild-type control mice suggesting that tissue-specific expression of IL-33 in the intestine is sufficient to promote generation of ILC2^INFLAM (Fig. 1l,m).

To investigate the heterogeneity of ST2⁻ ILC2s in tissues, we purified leukocytes from the lung, epididymal white adipose tissue (eWAT), mesLN, Si and colon lamina propria of wild-type mice, and analyzed ST2 expression on ILC2s among these different tissues. KLRG1⁺ ILC2s were predominantly ST2⁺ at steady state in all tissues examined, except in the Si, in which a significant proportion of ILC2s were ST2⁻ (Suppl. Fig. 1m,n). We hypothesized that the down-modulation of ST2 might already occur at steady state in the Si in response to the IL-33 receptor being constantly engaged by IL-33. Indeed, immunofluorescence staining revealed that IL-33 was constitutively highly expressed in Si mucosa (Suppl. Fig. 1o). We next investigated whether IL-33 affects ST2 expression in Si lamina propria at steady state using Il33^−/− mice. As expected, a higher proportion of Si ILC2s expressed ST2 in Il33^−/− mice compared to Il33^+/+ mice, suggesting that ILC2s are constantly activated by IL-33, resulting in down-modulation of ST2 expression on ILC2s even at steady state in the intestine (Fig. 1n,o). Similar analysis in Il17rb^−/− mice revealed reduced frequencies of ST2⁻ ILC2s in the Si lamina propria compared to wild-type control mice (Fig. 1p,q). Collectively, we conclude from these experiments that IL-33 and IL-25 cooperatively induce the generation and are required for the induction of ILC2^INFLAM following N. brasiliensis infection.

Tph1 is expressed in ILC2s and up-regulated upon cell activation

To identify genes closely linked to ILC2 activation, we treated wild-type mice with PBS or rIL-33 and compared the transcriptome of sort-purified Si ILC2s. As expected, activation of Si ILC2s resulted in the up-regulation of genes associated with proliferation (Mki67) and effector cytokines (Il5, Il13 and Areg) (Fig. 2a). One of the genes that exhibited most striking differential expression between control and rIL-33-treated animals was the transcript for tryptophan hydroxylase 1 (Tph1), the rate-limiting enzyme in serotonin biosynthesis (Fig. 2a, b). Up-regulation of Tph1 mRNA expression after rIL-33 treatment was confirmed by quantitative PCR (qPCR) and flow cytometry analyses, and was specific to Si ILC2s since we did not detect expression of Tph1 in other immune cells including Th2 cells, regulatory T (Treg) cells and mononuclear phagocytes (Fig. 2c–f). We verified that Si ILC2s were able to produce serotonin (5-hydroxytryptamine, 5-HT) in vitro as measured by ELISA from culture supernatants and ex vivo by immunofluorescence (Suppl. Fig. 2a,b). Expression of Tph1 in Si ILC2s was independent of intestinal microbiota since germ-free (GF) mice had comparable Tph1 mRNA expression as mice kept under specific-pathogen-free (SPF) conditions (Fig. 2g). Besides being highly up-regulated after ILC2 activation, the gene Tph1 drew our attention because it was selectively expressed in ILC2s at steady state, but not in other innate and adaptive lymphocytes we examined (Fig. 2h,i), consistent with previous data reporting that Tph1 is regulated by the lineage-specifying transcription factor for ILC2s, GATA-3 (Robinette et al., 2015; Yagi et al., 2014). In addition, Tph1 mRNA expression in ILC2s was comparable to that of mast cells (Nowak et al., 2012; Ringvall et al., 2008) and higher in enterochromaffin cells, which express chromogranin A (Chga) and represent the main source of serotonin in the gastrointestinal tract (Gershon, 2013; Lund et al., 2018; Yadav et al., 2008) (Fig. 2j and Suppl. Fig. 2c). Small intestinal ILC2s had the highest Tph1 mRNA expression compared to ILC2s derived from other tissues at steady state (Fig. 2k). Furthermore, Tph1 mRNA expression was significantly higher in ILC2^NAT compared to ILC2^INFLAM, suggesting that Tph1 mediates the transition of ST2⁺ ILC2s into an ST2⁻ ILC2s phenotype in Si lamina propria at steady state (Fig. 2l). Consistent with previous reports (Yagi et al., 2014), we detected the expression of the serotonin receptor (Htr1b) transcript, which was expressed in higher amounts in ILC2^NAT compared to ILC2^INFLAM (Suppl. Fig. 2d). Since the administration of rIL-33 induced Tph1 mRNA expression (Fig. 2a–c), we tested whether Tph1 mRNA expression at steady state required IL-33 signal. Indeed, Tph1 mRNA expression was reduced in Si ILC2s sort-purified from Il33^−/− mice compared to wild-type mice (Fig. 2m). Altogether, these data provide evidence that Tph1 is specifically expressed in intestinal ILC2s, further up-regulated upon ILC2 activation, and controlled by IL-33.

Figure 2: Tph1 is expressed in ILC2s and up-regulated upon cell activation.

(a) Heat map of the indicated gene expression Z-scores of small intestinal ILC2s from PBS- or IL-33-treated wild-type mice as measured by RNA-seq. Each column represents a single mouse.

(b) RNA-seq volcano plot of differential gene expression between small intestinal ILC2s from IL-33- (positive log2FC) and PBS- (negative log²FC) treated wild-type mice. FC: fold change.

(c) Expression of Tph1 in ILC2s sorted from small intestine of PBS- or IL-33-treated wild-type mice as determined by qPCR analysis (Mean + SD, PBS n= 8 and IL-33 n= 9). Each symbol represents data from one mouse. Data are from three independent experiments combined.

(d,e) Tph1 expression in small intestinal ILC2s. (d) Flow cytometry histogram overlays of Tph1 expression in small intestinal ILC2s. Cells are gated on Lin⁻ CD45⁺ KLRG1⁺ lymphocytes. (e) Tph1 mean fluorescence intensity (MFI) (Mean + SD, n= 4). Each symbol represents data from one mouse. Data are representative of two independent experiments.

(f) Expression of Tph1 in various cell subsets sorted from small intestine of PBS- or IL-33-treated Il4^Gfp/Gfp mice as determined by qPCR analysis (Mean + SD, n= 6). MNP: mononuclear phagocytes; Each symbol represents data from one mouse. Data are from two independent experiments combined.

(g) Expression of Tph1 in small intestinal ILC2s from germ-free (GF) mice and mice kept under specific-pathogen-free (SPF) conditions as determined by qPCR analysis (Mean + SD, n= 4). Each symbol represents data from one mouse.

(h) Heat map of the indicated gene expression Z-scores of small intestinal ILC2s and ILC3s from wild-type mice as measured by RNA-seq. Each column represents a single mouse.

(i) Expression of Tph1 in the indicated sorted lymphocyte populations from wild-type mice as determined by qPCR analysis (Mean + SD, n= 3). Spleen B, T cells and NK: natural killer cells; bone marrow ILC2p: ILC2 progenitors; small intestinal ILC1s, ILC2s, CCR6⁺ and CCR6⁻ ILC3s. Each symbol represents data from one mouse. Data are representative of three biological replicates.

(j) Expression of Tph1 in various cell subsets sorted from small intestine of wild-type mice as determined by qPCR analysis (Mean + SD, n= 7-8). MC: mast cells; IEC: intestinal epithelial cells; EC: enterochromaffin cells. Each symbol represents data from one mouse. Data are from two independent experiments combined.

(k) Expression of Tph1 in sorted ILC2s from the indicated organs of wild-type mice as determined by qPCR analysis (Mean + SD, n= 5-7). eWAT: epididymal white adipose tissue; mesLN: mesenteric lymph nodes; Si: small intestine. Each symbol represents data from one mouse. Data are from three independent experiments combined.

(l) Expression of Tph1 in sorted KLRG1⁺ ST2⁻ ILC2s and KLRG1⁺ ST2⁺ ILC2s from small intestine of wild-type mice as determined by qPCR analysis (Mean + SD, n= 5). Each symbol pair represents data from one mouse. Data are representative of two independent experiments.

(m) Expression of Tph1 in sorted small intestinal ILC2s from Il33^+/+ and Il33^−/− mice as determined by qPCR analysis (Mean + SD, Il33^+/+ n= 5 and Il33^−/− n= 4). Each symbol represents data from one mouse. Data are representative of two independent experiment combined. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 and n.s., not significant. See also Suppl. Fig. 2.

Tph1 up-regulation in ILC2s upon helminth infection is dependent on IL-33

Next, we tested whether Tph1 is induced during a physiological type 2 immune response after infection with N. brasiliensis. Tph1 mRNA expression was strongly up-regulated in ILC2s sorted from mesLN of wild-type mice following N. brasiliensis infection, suggesting a potential role for Tph1 in anti-helminth immunity (Fig. 3a–c). Up-regulation of Tph1 mRNA expression upon helminth infection was not observed in other lymphocyte populations we examined (Fig. 3d). Given the up-regulation of Tph1 mRNA expression following ILC2 activation, we then asked whether IL-33 was necessary for the induction of Tph1 mRNA expression in ILC2s. Unlike wild-type ILC2s, mesLN ILC2s sorted from Il33^−/− mice failed to up-regulate expression of Tph1 mRNA following N. brasiliensis infection, thus demonstrating the essential role of IL-33 in Tph1 mRNA regulation (Fig. 3e). These results show that the expression of the gene Tph1 in ILC2s can be modulated upon N. brasiliensis infection and is dependent on IL-33.

Figure 3: Helminth infection induces Tph1 up-regulation in ILC2s, which is dependent on IL-33.

(a) RNA-seq volcano plot of differential gene expression between ILC2s from mesenteric lymph nodes of naïve (negative log₂FC) and N. brasiliensis (n.b.)-infected (positive log₂FC) wild-type mice. FC: fold change.

(b) Heat map of the indicated gene expression Z-scores of ILC2s from mesenteric lymph nodes of naïve and N. brasiliensis (N.b.)-infected wild-type mice as measured by RNA-seq. Each column represents a single mouse.

(c) Expression of Tph1 in sorted ILC2s from mesenteric lymph nodes of naïve and N. brasiliensis (N.b.)-infected wild-type mice as determined by qPCR analysis (Mean + SD, n= 3). Each symbol represents data from one mouse. Data are representative of three independent experiments.

(d) Expression of Tph1 in sorted ILC2s and the indicated lymphocyte populations from mesenteric lymph nodes (mesLN) of naïve and N. brasiliensis-infected wild-type mice as determined by qPCR analysis (Mean + SD, n= 4). mesLN: mesenteric lymph nodes. Each symbol represents data from one mouse. Data are representative of four biological replicates.

(e) Expression of Tph1 in sorted ILC2s from mesenteric lymph nodes of naïve and N. brasiliensis (N.b.)-infected Il33^+/+ and Il33^−/− mice as determined by qPCR analysis. (Mean + SD, n= 5-12). Each symbol represents data from one mouse. Data are from three independent experiments combined. **p < 0.01, and n.s., not significant.

Tph1 deletion in lymphocytes results in increased susceptibility to N. brasiliensis infection and reduced inflammatory ILC2 response

To further test whether Tph1 plays a pivotal role in resistance to helminth infection, we generated genetically ablated mice, in which Tph1 was conditionally deleted in lymphocytes using a Cre recombinase under the Il7r promoter (Il7r^Cre/+ Tph1^flox/flox, Tph1^Δ/Δ) (Schlenner et al., 2010; Yadav et al., 2008). Consequently, Tph1 mRNA expression was undetectable in Si ILC2s from Tph1^Δ/Δ mice (Fig. 4a). We also noticed that Tph1^Δ/Δ mice exhibited reduced frequencies of ST2⁻ ILC2s in the Si compared to control mice suggesting that Tph1 might indeed be involved in the generation of ILC2^INFLAM (Fig. 4b,c). Next, we functionally investigated the phenotype of Tph1^Δ/Δ mice using the N. brasiliensis infection model. Notably, Tph1^Δ/Δ mice had higher intestinal worm burden compared to their littermate controls on day 7 after infection (Fig. 4d). Since we found that Tph1 is regulated by IL-33 (Fig. 2a–f and m; Fig. 3a–e), we administered rIL-33 to Tph1^Δ/Δ as well as to Il33^−/− mice and examined how this affects worm resistance. Administration of exogenous IL-33 to Tph1^Δ/Δ mice rescued their susceptibility to N. brasiliensis infection suggesting that Tph1-defciency could be overcome by supraphysiological stimulation with rIL-33 (Suppl. Fig. 3a).

Figure 4: Mice with specific deletion of Tph1 in lymphocytes are susceptible to N. brasiliensis infection and have reduced inflammatory ILC2 response.

(a) Expression of Tph1 (Mean + SD, n= 4) in sorted ILC2s from small intestine of Tph1^+/+ and Tph1^Δ/Δ mice as determined by qPCR analysis. Each symbol represents data from one mouse. Data are representative of two independent experiments.

(b,c) ILC2s from small intestinal lamina propria of Tph1^+/+ and Tph1^Δ/Δ mice. (b) Flow cytometry plots of ILC2s from small intestinal lamina propria of Tph1^+/+ and Tph1^Δ/Δ mice. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (c) Percentage (Mean + SD, Tph1^+/+ n=14 and Tph1^Δ/Δ n=11) of KLRG1⁺ ST2⁻ ILC2s and KLRG1⁺ ST2⁺ ILC2s cells among Lin⁻ cells in the small intestinal lamina propria. Each symbol represents data from one mouse. Data are from three independent experiments combined.

(d) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and analyzed on day 7. Worm burden in the small intestine (Mean + SD, Tph1^+/+ n= 8, Tph1^+/+ n= 12). Each symbol represents data from one mouse. Data are representative of four independent experiments.

(e,f) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and analyzed on day 5. (e) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. dpi: day post-infection. (f) Percentage (Mean + SD, n= 5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Each symbol represents data from one mouse. Data are representative of three independent experiments.

(g,h) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and analyzed on day 7. (g) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. dpi: day post-infection. (h) Percentage (Mean + SD, n= 10) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Each symbol represents data from one mouse. Data are from two independent experiments combined.

(i) Correlation between percentage of ILC2s and worm burden (Mean + SD, Tph1^+/+ n= 35 and Tph1^Δ/Δ n= 37). Spearman correlation coefficient r are indicated. Each symbol represents data from one mouse. Data are from four independent experiments combined.

(j-l) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and treated with an anti-CD4 depleting antibody and analyzed on day 7. (j) Worm burden in the small intestine. dpi: day post-infection. (k) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (l) Percentage (Mean + SD, Tph1^+/+ n=5 and Tph1^Δ/Δ n=7) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) cells KLRG1⁺ CD25⁺ (ILC2^NAT) among Lin⁻ cells in the mesenteric lymph nodes. Each symbol represents data from one mouse. Data are representative of two independent experiments.

(m,n) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and analyzed on day 10. (m) Worm burden in the small intestine (Mean + SD, Tph1^+/+ n= 22, Tph1^Δ/Δ n= 14). Each symbol represents data from one mouse. Data are from three independent experiments combined dpi: day post-infection. (n) Lipocalin in feces measured by ELISA (Mean + SD, Tph1^+/+ n= 12, Tph1^Δ/Δ n= 9). Each symbol represents data from one mouse. Data are from two independent experiments combined. *p < 0.05, **p < 0.01, ****p < 0.0001 and n.s., not significant. See also Suppl. Fig. 3.

To investigate how Tph1 regulates type 2 immunity, we then analyzed Tph1^Δ/Δ and control mice on day 5 after infection, when the intestinal immune response is triggered. Detailed flow cytometry analysis of mesLN ILC2s revealed that ILC2^NAT were present in comparable proportions in Tph1^Δ/Δ mice, whereas ILC2^INFLAM cells were reduced on day 5 after infection (Fig. 4e,f). It should be noted that ILC2^INFLAM were previously linked to resistance against N. brasiliensis infection (Huang et al., 2015; Huang et al., 2018). On day 7 post-infection, ILC2^INFLAM were detectable in the mesLN of Tph1^Δ/Δ mice, but were still reduced compared to control mice (Fig. 4g,h), suggesting a delay in the recruitment to the mesLN rather than a defect in ILC2^INFLAM generation. The ILC2^NAT response in the mesLN of Tph1^Δ/Δ mice was also affected on day 7 after infection (Fig. 4g,h). However, we did not detect differences in the expression of inflammatory cytokines Il25 and Il33 in the intestines of Tph1^Δ/Δ and Tph1^+/+ mice after N. brasiliensis infection (Suppl. Fig 3b). In addition, there was a significant negative correlation between ILC2s and worm burden in Tph1^Δ/Δ and control mice (Fig. 4i).

Although T cells expressed very low amounts of Tph1 mRNA at steady state and after N. brasiliensis infection (Fig. 2i and Fig. 3d), we investigated whether Tph1^Δ/Δ mice were still more susceptible to N. brasiliensis infection after depletion of CD4⁺ T cells. Indeed, after treatment with an anti-CD4 depleting antibody, Tph1^Δ/Δ mice had higher worm burden and exhibited decreased ILC2^INFLAM response (Fig. 4j–l and Suppl. Fig. 3c,d). Together, these data indicate that Tph1-dependent defects in ILC2^INFLAM responses occur in the absence of CD4⁺ T cells and that they are critical for anti-helminth immunity.

To investigate whether this increased parasite susceptibility in Tph1^Δ/Δ mice resulted in a defect in worm clearance, we analyzed worm burden on day 10 after infection, when wild-type mice have completely expelled the parasite (Fig. 4m). Consistent with a defective type 2 immune response, Tph1^Δ/Δ mice failed to expel N. brasiliensis on day 10 and still depicted hallmarks of intestinal inflammation measured by lipocalin ELISA (Fig. 4n). Therefore, these data suggest that Tph1 expression in ILC2s controls ILC2^INFLAM expansion following helminth infection, and that Tph1 is required for the differentiation of ILC2^NAT into ILC2^INFLAM.

Tph1 deletion leads to defective ILC2 activation

To further uncover the molecular mechanisms by which Tph1 promotes ILC2 activation and the transition of ILC2^NAT into ILC2^INFLAM, we performed RNA sequencing (RNA-seq) of sorted Si ILC2s at steady state, and ILC2^NAT and ILC2^INFLAM from mesenteric lymph nodes on day 7 at the peak of N. brasiliensis infection from Tph1^Δ/Δ and control mice. Principal component (PC) analysis plots showed that Si ILC2s, and ILC2^NAT and ILC2^INFLAM from mesLNs clustered by genotype, and that Tph1 deletion drove a specific transcriptomic signature (Suppl. Fig. 4a, b). Despite the difference in location, Si ILC2s and mesLN ILC2^INFLAM and ILC2^NAT shared an array of genes down-regulated in Tph1^Δ/Δ mice (Fig. 5a–d), which were significantly enriched in gene ontology (GO) terms associated with cell division, regulation of cellular component and microtubule-based movements and could be linked to ILC2 activation and migration (Suppl. Fig. 4c–e). Further analysis of the commonly down-regulated genes in Tph1^Δ/Δ from naïve Si ILC2s or mesLN ILC2^INFLAM and ILC2^NAT from N. brasiliensis-infected mice revealed that Tph1 deletion modulates expression of genes associated with the regulation of immune response, including activating or inhibitory cell surface receptors, such as Tigit, Cd244 (2B4), Ctla4 and Icos (Fig. 5a–c). Among these genes, inducible T-cell co-stimulator (Icos) was of particular interest because it has previously been connected to either ILC2 activation in allergic asthma models or susceptibility to helminth infections (Maazi et al., 2015; Miyahira et al., 2003; Paclik et al., 2015). Reduced Icos mRNA and protein expression on Tph1 deficient ILC2s following N. brasiliensis infection was confirmed by qPCR and flow cytometry analyses (Fig. 5e and Suppl. Fig. 4f). Consistent with the role of ICOS in the regulation of ILC2^INFLAM, administration of a blocking antibody against ICOS in vivo resulted in decreased frequencies of ST2⁻ ILC2s in Si at steady state (Fig. 5f,g). When administered during N. brasiliensis infection, treatment with an anti-ICOS blocking antibody caused a decrease in ILC2^INFLAM recruitment to the mesLN (Fig. 5h,i). We concluded from these data that ICOS indeed promotes the generation of ILC2^INFLAM. Next, to further investigate how Tph1 and ICOS are functionally linked, we treated Tph1^+/+ and Tph1^Δ/Δ mice with a blocking antibody against ICOS following N. brasiliensis infection and compared ILC2^INFLAM responses in anti-ICOS- or isotype-treated mice from both genotypes. Blocking of ICOS during helminth infection resulted in defective expansion of ILC2^INFLAM in Tph1^+/+ mice comparable to that of Tph1^Δ/Δ mice, but had no further effect on ILC2^INFLAM recruitment in Tph1^Δ/Δ mice (Fig. 5j). Therefore, these data support a model in which Tph1 regulates ICOS expression in order to promote ILC2^INFLAM and anti-helminth immunity. Taken together, we concluded that the delayed and defective ILC2^INFLAM responses observed in Tph1^Δ/Δ mice following helminth infection are partially mediated by ICOS.

Figure 5: Tph1^Δ/Δ mice have defective ILC2 activation.

(a-d) RNA-seq of sorted ILC2s from the small intestine and ILC2^INFLAM and ILC2^NAT from mesenteric lymph nodes of Tph1^+/+ and Tph1^Δ/Δ mice on day 7 after N. brasiliensis infection. (a-c) Heat maps showing expression of the 50 genes most significantly down-regulated (smallest p value) in Tph1^Δ/Δ as measured by RNA-seq. Heat map color indicates row Z score of log₁₀(normalized counts + 1). Each column represents a single mouse. Si: small intestine; mesLN: mesenteric lymph nodes. (a) (Si: Tph1^+/+ n= 4 and Tph1^Δ/Δ n= 3). (b) (mesLN ILC2^INFLAM: Tph1^+/+ n= 4 and Tph1^Δ/Δ n= 4). (c) mesLN ILC2^NAT: Tph1^+/+ n= 4 and Tph1^Δ/Δ n= 3). (d) Venn diagram of the significantly differentially expressed genes down-regulated in Tph1^Δ/Δ mice for each ILC2 population. Numbers denote the numbers of differentially expressed genes. Si: small intestine; mesLN: mesenteric lymph nodes.

(e) ICOS geometric mean fluorescent intensity (gMFI) on KLRG1⁺ CD25⁻ ILC2s from the mesenteric lymph nodes of Tph1^+/+ and Tph1^Δ/Δ mice on day 7 after N. brasiliensis infection (Tph1^+/+ n= 6 and Tph1^Δ/Δ n= 5). Each symbol represents data from one mouse. Data are representative of two independent experiments.

(f,g) Wild-type mice were treated with an anti-ICOS blocking antibody or isotype control (IgG) and analyzed on day 7. (f) Flow cytometry plots of ILC2s from intestinal lamina propria. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (g) Percentage (Mean + SD, n= 5) of KLRG1⁺ ST2⁻ ILC2s and KLRG1⁺ ST2⁺ ILC2s among Lin⁻ cells in intestinal lamina propria. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Each symbol represents data from one mouse. Data are representative of three independent experiments.

(h,i) Wild-type mice were infected with N. brasiliensis and treated with an anti-ICOS blocking antibody or isotype control (IgG) and analyzed on day 5. (h) Flow cytometry plots of ILC2s from mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Numbers denote percentage of cells in each gate. (i) Percentage (Mean + SD, n= 5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Each symbol represents data from one mouse. Data are representative of two independent experiments.

(j) Tph1^+/+ and Tph1^Δ/Δ mice were infected with N. brasiliensis and treated with an anti-ICOS blocking antibody or isotype control (IgG) and analyzed on day 5. Percentage (Mean + SD, Tph1^+/+ + IgG n=8 Tph1^Δ/Δ + IgG n= 5, Tph1^+/+ + anti-ICOS n=8 and Tph1^Δ/Δ anti-ICOS n= 5) of KLRG1⁺ CD25⁻ (ILC2^INFLAM) and KLRG1⁺ CD25⁺ (ILC2^NAT) cells among Lin⁻ cells in the mesenteric lymph nodes. Cells are gated on Lin⁻ CD45⁺ lymphocytes. Each symbol represents data from one mouse. Data are representative of four independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 and n.s., not significant. See also Suppl. Fig. 4.

Discussion

In addition to circulating in the peripheral blood and lymphatics, the multilayered cellular composition of the immune system requires that some immune cell subsets establish permanent tissue residency. Tissue-resident immune cells share common hallmarks, as a sign of tissue residency (Fan and Rudensky, 2016; Klose and Artis, 2016; Rankin and Artis, 2018). While data assessing the whole transcriptome of tissue-resident cells such as ILC2s have been recently published (Bjorklund et al., 2016; Gury-BenAri et al., 2016; Ricardo-Gonzalez et al., 2018; Robinette et al., 2015; Simoni et al., 2017; Yudanin et al., 2019), how tissue-specific cues regulate distinct ILC2 subsets and the associated protective or pathogenic responses remains incompletely defined.

This study provides evidence for a previously unrecognized function of IL-33 and Tph1 in the regulation and the generation of CD25⁻ ST2⁻ ILC2^INFLAM from intestine-resident ILC2s, the regulation of ILC2^INFLAM and their impact on resistance to worm infections. Although the importance of IL-33 in expulsion of helminth parasites, such as N. brasiliensis and Strongyloides venezuelensis, is well established (Hung et al., 2013; Moro et al., 2010; Neill et al., 2010; Yasuda et al., 2012), the essential role of IL-33 in promoting ILC2^INFLAM responses has not been recognized. To date, IL-25 was the only cytokine reported to be essential for the generation of ILC2^INFLAM (Huang et al., 2015) and the current model of ILC2^INFLAM differentiation proposes that these cells are constantly generated in the intestine under the control of IL-25 (Huang et al., 2018). Using gain- and loss-of-function approaches, we demonstrated that IL-33 was necessary and sufficient for the induction of ILC2^INFLAM. Furthermore, transgenic overexpression of IL-33 in intestinal epithelial cells is sufficient for recruiting ILC2^INFLAM to the mesenteric lymph nodes. The finding that both IL-25 and IL-33 were necessary and sufficient to generate ILC2^INFLAM responses in vivo raises an important question on how these two cytokines act on ILC2s converting them into ILC2^INFLAM. It is unlikely that IL-25 alone promotes the generation of ST2⁻ ILC2s in vivo since adding IL-25 to ILC2 cultures in vitro lead to up-regulation of the IL-33 receptor, ST2; and a combination of IL-25 and IL-33 together resulted in ST2 down-regulation. The up-regulation of ST2 after in vitro stimulation with IL-25 may indicate that the small intestinal ST2⁺ ILC2s need to receive a second signal, such as IL-33, as a checkpoint to transition into ILC2^INFLAM and promote type 2 inflammation. Therefore, we propose a model in which transition of ILC2^NAT into ILC2^INFLAM is controlled by signals from two distinct parenchymal cells types; IL-25 produced by epithelial tuft cells (Gerbe et al., 2016; Howitt et al., 2016; von Moltke et al., 2016) and now IL-33 presumably derived from intestinal stromal cells (Dahlgren et al., 2019; Kinchen et al., 2018; Mahlakoiv et al., 2019; Rana et al., 2019; Spallanzani et al., 2019). Together, our findings argue that IL-25 and IL-33 are both required and jointly regulate the generation of ILC2^INFLAM.

Our data support a model where ILC2^INFLAM are derived from intestinal ILC2s in the lamina propria, which then migrate to mesenteric lymph nodes upon activation by IL-33, IL-25 and potentially other factors. In accordance with this model, we found that IL-33-dependent intestinal ILC2s had the highest expression of transcript for tryptophan hydroxylase 1 (Tph1), the rate-liming enzyme in serotonin biosynthesis, compared to ILC2s derived from other tissues at steady state, suggesting that Tph1 is a sign of tissue adaptation and regulates transition of small intestinal ILC2s into ILC2^INFLAM. Taken together, this study provides insights into the alarmin-dependent heterogeneity of ILC2 subsets in tissues and the consequences of this heterogeneity on protective immunity at barrier surfaces.

How immune responses in non-lymphoid tissues, such as mucosal surfaces, are initiated and amplified, but also constrained is poorly understood. To date, the functional consequences of Tph1 in ILC2s have remained unknown (Robinette et al., 2015; Yagi et al., 2014). Both gain- and loss-of-function experiments at steady state and during helminth infection indictate that Tph1 expression in ILC2s was tightly contolled by IL-33. Furthermore, we found that the deletion of Tph1 in lymphocytes resulted in impaired ILC2 responses, decreased type 2 inflammation and increased susceptibility to helminth infection. Mechanistically, we observed that Tph1 deficiency was associated with delayed recruitment of ILC2^INFLAM to the mesenteric lymph nodes. Altogether, these data demonstrate a non-redundant role for Tph1 downstream of IL-33 in driving ILC2^INFLAM responses and type 2 immunity. However, administration of rIL-33 could rescue the susceptibility of Tph1^Δ/Δ mice to N. brasiliensis infection. These results suggest that stimulation of type 2 immunity with supraphysiological doses of rIL-33, which is also known to stimulate many other immune cells, including basophils, mast cells and T cells, could overcome Tph1 deficiency and contribute to the rescue of the phenotype observed in Tph1^Δ/Δ mice (Alvarez et al., 2019; Bonilla et al., 2012; Cohen et al., 2018; Moulin et al., 2007). Recombinant IL-33 administration likely triggers the release of type 2 cytokines from these additional immune cells thus promoting type 2 immunity through Tph1-independent mechanisms in other cell types. Our knowledge of the regulators of ILC2^INFLAM was limited so far to the alarmin IL-25 and the sphingosine 1-phosphate receptor (Huang et al., 2015; Huang et al., 2018). However, since deleting Tph1 did not affect Il25 and Il33 expression in the intestine after N. brasiliensis infection, it is unlikely that Tph1 directly regulates one of these two alarmins, which promote recruitment of ILC2^INFLAM. Tph1 deletion resulted in altered expression of genes associated with the dysregulated immune response, including decreased activating cell surface receptors, such as inducible T-cell co-stimulator (Icos), which has previously been connected to either ILC2 activation in allergic asthma models or susceptibility to helminth infections (Maazi et al., 2015; Miyahira et al., 2003; Paclik et al., 2015). While our data now show that ICOS is required for the generation of ILC2^INFLAM thus providing a cellular mechanism for the failure of worm control, the direct molecular link between Tph1 and ICOS expression regulation requires further investigation.

We demonstrated that the deletion of Tph1 in lymphocytes results in increased susceptibility to helminth infection and decreased type 2 immunity. Augmented serotonin concentrations have been linked to an enhanced type 2 immune response in allergic asthma (Durk et al., 2013; Lechin et al., 1998), however, the function of serotonin in anti-helminth immunity is poorly understood. Although increased serotonin has been previously reported during worm infections and some studies suggest that serotonin influences immunity against worm infections (Murray et al., 1971; Wang et al., 2018), there is still a gap in knowledge in understanding how serotonin affects type 2 immunity against helminth infections. While it is well established that enterochromaffin cells of the gastrointestinal tract produce the majority of serotonin in the body, our study identifies ILC2s as an additional source of serotonin. Serotonin biology is very complex as serotonin is known to mediate local effects, and the deletion of either peripheral Tph1 or neuronal Tph2 results in either pro-inflammatory or anti-inflammatory effects during a colitis model, respectively (Gershon, 2012; Ghia et al., 2009; Margolis et al., 2014). Furthermore, the immune regulation by serotonin probably involves gradients, which are maintained at barrier surfaces. We demonstrated that Tph1 deficiency was associated with delayed recruitment of ILC2^INFLAM to the mesenteric lymph nodes, thus, providing a previously unrecognized mechanism for Tph1 to boost anti-helminth immunity. Whereas serotonin receptor agonists and antagonists are now employed for the treatment of functional gastrointestinal disorders, the physiological role of serotonin still remains incompletely understood partly because multiple serotonin receptor subtypes are present in the gut wall (Gershon and Tack, 2007). Serotonin receptors are also widely distributed on many types of immune cells that are recruited following infection by helminth parasites, such as dendritic cells, macrophages, eosinophils and T cells (Herr et al., 2017; Wang et al., 2018). In addition, serotonin has been reported to be a chemotactic gradient factor for cell migration, such as dendritic cells and T cells (Magrini et al., 2011; Muller et al., 2009). ILC2^INFLAM were shown to migrate via the lymphatic vessels from the intestine to the mesenteric lymph nodes (Huang et al., 2018). We confirmed that ILC2 express the serotonin receptor Htr1b, as previously reported (Yagi et al., 2014) and could sense serotonin. Thus, serotonin could potentially act as an autocrine or paracrine stimulator of ILC2 function or ILC2 migration. Notably, ILC2 have been described to exhibit paracrine or autocrine behavior through ICOS - ICOSL interaction, and IL-9 secretion and sensing via IL-9 receptor expression (Maazi et al., 2015; Miyahira et al., 2003; Paclik et al., 2015; Turner et al., 2013; Wilhelm et al., 2011). Given the role of serotonin in regulating intestinal motility through coordinated actions of the enteric nervous system and muscular contraction via serotonin receptors expression on both cell types (Gershon, 2013; Zeisel et al., 2018), a direct effect on muscle contraction and therefore on worm expulsion cannot be excluded, but also fails to explain the cellular phenotype of ILC2^INFLAM. Furthermore, ILC2-derived serotonin may have potential receptor-independent effects and may be acting as a post-translational modifier of transcriptional or GTPase activity, a process known as serotonylation(Farrelly et al., 2019; Walther et al., 2003). Lastly, we cannot exclude an effect of Tph1 and/or serotonin on cell metabolism (Wilhelm et al., 2017).

Collectively, our data identifify a signaling circuit through which alarmins lead to increased transcription of the gene encoding the enzyme tryptophan hydroxylase 1 in lymphocytes to selectively regulate heterogeneity of ILC2 subsets in tissues. Therefore, our study provides insights into the regulation of type 2 immunity at mucosal barriers with potential implications for allergy, immunity to infection and tissue homeostasis.

STAR Methods

Lead Contact and Materials Availability: Lead author: David Artis (dartis@med.cornell.edu)

Mouse strains

Wild-type C57BL/6 mice were purchased from The Jackson Laboratories. Tph1^fl/fl (Yadav et al., 2008), Ilr7^Cre/+ (Schlenner et al., 2010), Il33^−/− (provided by Amgen Inc. through Taconic Farms) (Louten et al., 2011), Vfl33 (He et al., 2018), Il17rb^−/− (Neill et al., 2010), and Il1rl1^−/− (Townsend et al., 2000) on a C57BL/6 background, and Il4^Gfp/Gfp (Mohrs et al., 2001) on a BALB/c background were bred at Weill Cornell Medicine or at Charite. Germ-free on a C57BL/6 background were bred within sterile vinyl isolators at Weill Cornell Gnotobiotic Mouse Facility and monitored for germ-free status by weekly aerobic and anaerobic culturing. Sex and age-matched animals were used for experiments if not otherwise indicated. We did not use randomization to assign animals to experimental groups. No animals were excluded from the analyses. All animal experiments were approved and are in accordance with the local animal care committees.

Isolation of cells from the lamina propria, mesenteric lymph nodes, lung and fat tissue

Small intestine or colon was removed, cleaned from remaining fat tissue and washed in ice-cold PBS (Sigma-Aldrich). Peyer’s patches were eliminated, small intestine was opened longitudinally and washed in ice-cold PBS. Dissociation of epithelial cells was performed by incubation on a shaker at 37°C in HBSS (Sigma-Aldrich) containing 10 mM Hepes and 5 mM EDTA (both Thermo Fisher Scientific) or 1 mM DTT (Sigma-Aldrich) two times for 15 min. After each step, samples were vortexed and the epithelial fraction discarded. Afterwards, remaining tissue was chopped into small pieces and enzymatic digestion was performed using 4% FBS, Dispase II (5 U/ml; Thermo Fisher Scientific), Collagenase III (1 mg/ml; Worthington) and DNaseI (0.5 mg/ml; Sigma-Aldrich). Leukocytes were further enriched by Percoll gradient centrifugation (Sigma-Aldrich). Mesenteric lymph nodes were chopped and incubated in RPMI 1640 medium (Sigma-Aldrich) supplemented with 1% BSA (Sigma-Aldrich), Collagenase II (1 mg/ml; Sigma-Aldrich) and DNaseI (20 ng/ml) for 20 min on a shaker at 37°C. Cells were then dissociated using a pasteur pipette, and filtered through a 70 μm cell strainer. Lungs were chopped and incubated in RPMI medium supplemented with Liberase TM (50 μg/ml; Roche) and DNaseI (20 ng/ml) for 1 h at 37°C. The remaining tissues were mashed with a syringe plunger and single cell suspensions were filtered through a 40 μm cell strainer. Leukocytes were then further enriched by 40% Percoll gradient centrifugation and red blood cells were lysed with ACK lysing buffer (Lonza). Epididymal white adipose tissue was removed and incubated in RPMI medium supplemented with Collagenase II (1 mg/ml), DNaseI (20 ng/ml) for 45 min on a shaker at 37°C and 10 mM EDTA was added for the last 5 min of incubation. After incubation, samples were spun down, the adipocyte layer was aspirated, and the cells were filtered through a 70 μm cell strainer. Mast cells were obtained by lavage of the peritoneal cavity with 10 ml ice cold HBSS supplemented with 1 mM EDTA. For intestinal epithelial cell isolation, intestines were treated as described above and washed in pre-warmed 37°C DMEM (Sigma-Aldrich) with 10% FBS, followed by washes in pre-warmed 37°C PBS, then dissociated in HBSS supplemented with 2 mM EDTA, 1 mM DTT and 5% FBS, filtered through a 100 μm cell strainer, and further enriched by 40%/20% Percoll gradient centrifugation.

Flow cytometry and cell sorting

Dead cells were routinely excluded with Fixable Aqua Dead Cell Stain or SYTOX Blue Dead Cell Stain (both from Thermo Fisher Scientific). Single cell suspensions were incubated on ice with anti-CD16/CD32 (93) antibody (Biolegend) and the following conjugated antibodies in PBS (Ca²⁺ and Mg²⁺-free, Sigma-Aldrich). Lineage-positive cells were excluded by staining for CD3ε (145-2C11), CD5 (53-7.3), FcεRI (Mar-1), NK1.1 (PK136), NKp46 (29A1.4), B220 (RA3-6B2), CD19 (eBio1D3 (1D3)), CD11b (M1/70) and CD11c (N418). For surface staining the following antibodies were used: KLRG1 (2F1), CD45 (30-F11), CD4 (GK1.5 and RM4-5), CD8α (53-6.7), Sca-1 (D7), c-Kit (2B8), CD25 (PC61), CD127 (A7R34), CCR9 (9B1), CD90.2 (53-2.1), ST2 (DIH9 and RMST2-2), ICOS (7E.17G9), CD326 (G8.8), CD24 (M1/69) and MHC Class II (I-A/I-E) (M5/115.15.2). GATA3 (TWAJ) and Tph1 (EP1311Y, OriGene) were stained using the Foxp3 transcription factor staining buffer set (eBioscience). All antibodies used in flow cytometry were purchased from eBioscience, Biolegend or BD Biosciences if not otherwise indicated. Mast cells were identified as CD45⁺ Lin⁻ FcεR1α⁺ CD117⁺, intestinal epithelial cells as CD45⁻ CD326⁺ CD24⁻, enterochromaffin cells CD45⁻ CD326⁺ CD24⁺, Treg cells as CD45⁺ CD3⁺ CD4⁺ CD25⁺ IL-4-GFP⁻, Th2 cells as CD45⁺ CD3⁺ CD4⁺ CD25⁻ IL-4-GFP⁺ and mononuclear phagocytes as CD45⁺ CD11b⁺ CD11c⁺ MHC-II⁺. All flow cytometry experiments were acquired using a custom configuration Fortessa flow cytometer and the FACS Diva software (BD Biosciences) and analyzed with FlowJo V9.9.3 or V10.4.2 software (TreeStar) or sort-purified by using a custom configuration FACSAria cell sorter (BD Biosciences).

Quantitative real-time PCR

Tissues and sorted cells were homogenized in Trizol (Thermo Fisher Scientific) and stored at −80°C. RNA was extracted with chloroform and RNA concentration was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). Reverse transcription of total RNA was performed using the High Capacity cDNA Reverse Transcription kit according to the protocol provided by the manufacturer (Thermo Fisher Scientific). Reaction was detected on a QuantStudio 6 Flex Real-Time PCR (Thermo Fisher Scientific) using the following TaqMan Gene Expression Assays (Applied Biosystems): Tph1 (Mm01202614_m1), Chga (Mm00514341_m1), Icos (Mm00497600_m1), Cxcr6 (Mm00472858_m1), Tigit (Mm03807522_m1) and Htr1b (Mm00439377_s1) or Sybr green primers Trim12a (5′ CCTGTCTGTCTGAACCTGATGG 3′ and 5′ GGCTTGAACATTTTGAGCCTCT 3′), Ermn (5′ CTGAGACACTGAGCGGGAC 3′ and 5′ CAACCTTGTAGTATGCCTGGG 3′), Lgmn (5′ TGGACGATCCCGAGGATGG 3′ and 5′ GTGGATGATCTGGTAGGCGT3′), Il25 (QT00134645, Qiagen) and Il33 (QT00135170, Qiagen). Gene expression was normalized as n-fold difference to the housekeeping gene Hprt1 (Mm00446968_m1) or Actb (QT01136772, Qiagen). Relative quantification of gene expression was performed with the QuantStudio Real-Time PCR software version 1.0 (Thermo Fisher Scientific).

Helminth infection and in vivo experiments

Third-stage larvae (L3) of N. brasiliensis were purified with a Baermann apparatus. After washing three times in PBS, living worms were counted. On day 0, 500 purified worms were injected subcutaneously in PBS. In addition, in some experiments an anti-CD4 depleting antibody (clone GK1.5, 250 μg/mouse, in house) was injected intraperitoneally (i.p.) at day 0 and day 2, 4, and 6 of N. brasiliensis infection. In some experiments, anti-ICOS antibody (500 μg/mouse, Bioxcell) and rat IgG isotype control (500 μg/mouse, Sigma-Aldrich) were injected i.p. at day 1 and day 3 of N. brasiliensis infection and analyzed on day 5 post-infection, or treated with anti-ICOS antibody or rat IgG isotype control every other day for six days and analyzed one day later. In some experiments, mice were treated with carrier-free recombinant murine IL-33 (1 μg/mouse, R&D Systems) intravenously (i.v.) and analyzed 24 h later or treated with IL-33 (500 ng/mouse) or IL-25 (250μg/mouse, R&D Systems) i.p. for three consecutive days and analyzed one day later. In the IL-33 rescue experiments, mice were injected i.p. with IL-33 (12.5 μg/kg body weight/day) (Brestoff et al., 2015) from day 1 to day 6 of N. brasiliensis infection and analyzed 24 h later.

RNA-seq analysis

2,000 ILC2s were sort-purified (Lin⁻ CD45⁺ CD127⁺ KLRG1⁺) from the lamina propria of the small intestine of naïve Il7r^Cre/+ Tph1^fl/fl (Tph1^Δ/Δ) and Il7r^Cre/+ (Tph1^+/+) control mice or from mesenteric lymph nodes (ILC2^NAT: Lin⁻ CD45⁺ KLRG1⁺ ST2⁺; ILC2^INFLAM: Lin⁻ CD45⁺ KLRG1⁺ ST2⁻) on day 7 after N. brasiliensis infection of Il7r^Cre/+ Tph1^fl/fl (Tph1^Δ/Δ) and Il7r^Cre/+ control (Tph1^+/+) mice. Sorted cells in 1x Single-Cell Lysis Buffer (Clontech Laboratories) and Protector RNase Inhibitor (Roche) were used to prepare RNA-seq libraries by the Epigenomics Core at Weill Cornell Medicine using the Clontech SMARTer® Ultra® Low Input RNA Kit V4 (Clontech Laboratories). Sequencing was performed on an Illumina HiSeq 2500 (Illumina), yielding 50 bp single-end reads. Raw sequencing reads were demultiplexed with Illumina CASAVA (v2.17). Adapters were trimmed from reads using FLEXBAR (v2.4) (Dodt et al., 2012) and reads were aligned to the NCBI GRCm38/mm10 mouse genome using the STAR aligner (v2.3.0) (Dobin et al., 2013) with default settings. Small intestinal ILC2s from PBS- and IL-33-treated mice (Fig. 2a,b) were sort-purified as previously described (Klose et al., 2017). RNA-seq libraries from small intestinal ILC2s of IL33-treated mice (Fig. 2a,b) were previously sequenced together with those from PBS-treated mice. Raw sequence data from the PBS-treated mice are available on the Gene Expression Omnibus (GEO) under the series GSE101625 (Klose et al., 2017), which also includes sequence data from small intestinal ILC2s and ILC3s from SPF mice (Fig. 2h). ILC2s from mesLN of naïve and N. brasiliensis-infected mice (Fig. 3a,b) were sort-purified as previously described (Moriyama et al., 2018). Raw RNA-seq data from mesLN ILC2s of naïve mice (Fig. 3a,b) were generated simultaneously with those from N. brasiliensis-infected mice, which have previously been made available through the GEO accession GSE108884 (Moriyama et al., 2018). Read counts per gene (RefSeq annotation) were determined using the Rsubread R package (Liao et al., 2013). One ILC2^NAT sample from the Tph1^Δ/Δ group was excluded from the analysis (Fig. 5c and Suppl. Fig. 4b,e) because its library size was anomalously small (fewer than 1000 mapped reads). Prior to differential expression analysis, genes were prefiltered, keeping only genes with at least 50 mapped reads in at least 2 samples. Differential expression analysis was performed using DESeq2 version 1.20.0 with default parameters and with a false discovery rate (FDR) of 0.1 (Love et al., 2014). Principal component analysis was performed after using DESeq2’s variance stabilizing transformation. Gene Ontology enrichment analysis was performed using the enrichGO function of the clusterProfiler R package (Yu et al., 2012) with the Biological Process (BP) ontology and using as background the set of all genes that passed DESeq2’s independent filtering function (that is, all genes that were assigned an adjusted p value by DESeq2). The resulting p values were adjusted to yield false discovery rates (FDR) with FDR < 0.1 taken to indicate significance.

Lipocalin-2 ELISA

For Lipocalin-2 ELISA, 2-3 fecal pellets from each mouse were collected, frozen and stored at −80°C until processed. Collected fecal material was homogenized in 500 μl PBS and fecal debris was eliminated by centrifugation at 10,000g for 5 min. The concentration of soluble Lipocalin-2 in the fecal supernatants was quantified using the Lipocalin-2/NGAL DuoSet ELISA system according to the manufacturers recommendations (R&D Systems).

Serotonin ELISA

Sort-purified small intestinal ILC2s were incubated in RPMI supplemented with 10% FCS previously treated with dextran-coated charcoal (0.25% wt/vol, Sigma-Aldrich) to absorb exogenous serotonin, 25 mM Hepes, 1 mM sodium pyruvate, 55 μM 2-Mercaptoethanol, 1x MEM non-essential amino acid solution, 2 mM L-Glutamine, 100 U/ml Penicillin and 100 μg/ml Streptomycin (all Gibco) in 96-well microtiter plates (Nunc) for 4 days at 37°C and 5% CO₂, in the presence of IL-2, IL-7 (both at 10 ng/ml, R&D Systems), IL-33 (30 ng/ml, R&D Systems) and 30 μm tranylcypromine hemisulfate (Focus Biomolecules). Serotonin released into culture supernatants was quantified using the Ultra Sensitive Serotonin enzyme immunoassay (EIA, Labor Diagnostika Nord), according to the manufacture’s protocol.

In vitro culture

Sort-purified intestinal ILC2s were cultured in DMEM with high glucose supplemented with 10% FBS, 10 mM Hepes, 1 mM sodium pyruvate, 1x MEM non-essential amino acid solution, 80 μM 2-Mercaptoethanol, 2 mM L-Glutamine, 100 U/ml Penicillin and 100 μg/ml Streptomycin in 96-well microtiter plates at 37°C and 5% CO₂ for 3 days, in the presence of IL-7, IL-25 and IL-33 (20 ng/ml each, all from Biolegend) as indicated.

Immunofluorescence microscopy

Intestine was fixed in 2% paraformaldehyde in PBS (Electron Microscopy Sciences) for 2 h on ice and incubated in 30% sucrose at 4°C overnight, followed by embedding in tissue freezing medium OCT (Leica) for cryocutting. 6 μm slices were prepared on microscopy slides, washed 3x in ice-cold PBS, blocked in 10% BSA, 0.3% Triton X-100 (Sigma-Aldrich) in PBS, treated with the Streptavidin/Biotin blocking kit (Vector laboratories) and stained. The following antibodies were used: mouse anti-serotonin (5HT-H209, Dako), hamster anti-CD3ε (eBio500A2, biotinylated, eBioscience), hamster anti-KLRG1 (2F1, PE, eBioscience), streptavidin (Alexa Fluor 647, BioLegend) , polyclonal goat anti-mouse IL-33 (R&D Systems), E-Cadherin (36/E-Cadherin, BD Pharmingen), donkey anti-goat IgG (Thermo Fisher Scientific) and goat anti-mouse IgG1 (Thermo Fisher Scientific). Nuclei were counterstain with DAPI (Thermo Fisher Scientific). Representative images were captured under an inverted Nikon Eclipse Ti microscope (Nikon).

Statistical analysis

P value of data sets was determined by paired or unpaired two-tailed Student’s t-test with 95% confidence interval. Normal distribution was assumed. If equal variances between two groups could not be assumed, Welch’s correction was performed. Difference in lipocalin-2 concentrations between two groups were assessed by a non-parametric Mann-Whitney test. The Spearman rank order correlation test was used to analyze correlation. All statistical tests were performed with Graph Pad Prism V7 software (GraphPad Software, Inc.). (*p <0.05; **p <0.01; ***p <0.001; ****p <0.0001 and n.s., not significant). Investigators were not blinded to group allocation during experiments.

Data availability

RNA-seq data is deposited in the GEO repository database under the series GSE145289.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-mouse CD16/32 (93)-Purified	Biolegend	Cat#101302
Anti-mouse CD3e (145-2C11)-PerCP-Cy5.5	eBioscience	Cat#45-0031-82
Anti-mouse CD3e (145-2C11)-PE-Cyanine7	eBioscience	Cat#25-0031-82
Anti-mouse CD5 (53-7.3)-PerCP-Cy5.5	eBioscience	Cat#45-0031-82
Anti-mouse CD5 (53-7.3)-PE-Cyanine7	eBioscience	Cat#25-0051-81
Anti-mouse FcεRI (Mar-1)-PerCP-Cy5.5	eBioscience	Cat#46-5898-82
Anti-mouse FcεRI (Mar-1)-APC	eBioscience	Cat#17-5898-82
Anti-mouse NK1.1 (PK136)-Alexa Fluor 700	eBioscience	Cat#56-5941-82
Anti-mouse NKp46 (29A1.4)-Alexa Fluor 700	eBioscience	Cat#56-3351-82
Anti-mouse B220 (RA3-6B2)-APC-eFluor 780	eBioscience	Cat#47-0452-82
Anti-mouse CD19 (eBio1D3 (1D3))-PerCP-Cy5.5	eBioscience	Cat#45-0193-82
Anti-mouse CD11b (M1/70)-APC-eFluor 780	eBioscience	Cat#47-0112-82
Anti-mouse CD11b (M1/70)-Alexa Fluor 700	eBioscience	Cat#56-0112-82
Anti-mouse CD11c (N418)-APC-eFluor 780	eBioscience	Cat#47-0114-82
Anti-mouse KLRG1 (2F1)-PE	eBioscience	Cat#12-5893-82
Anti-mouse KLRG1 (2F1)-FITC	eBioscience	Cat#11-5893-82
Anti-mouse KLRG1 (2F1)-APC	eBioscience	Cat#17-5893-82
Anti-mouse KLRG1 (2F1)-BV605	eBioscience	Cat#138419
Anti-mouse CD45 (30-F11)-BUV395	BD Biosciences	Cat#564279
Anti-mouse CD45 (30-F11)-BV605	Biolegend	Cat#103140
Anti-mouse CD4 (GK1.5)-BV421	Biolegend	Cat#100438
Anti-mouse CD4 (RM4-5)-BV421	Biolegend	Cat#100543
Anti-mouse CD4 (RM4-5)-BV650	Biolegend	Cat#100546
Anti-mouse CD4 (RM4-5)-BV605	Biolegend	Cat#100547
Anti-mouse CD8α (53-6.7)-BV650	Biolegend	Cat#100742
Anti-mouse CD8α (53-6.7)-BV605	Biolegend	Cat#100743
Anti-mouse Sca-1 (D7)-APC	eBioscience	Cat#17-5981-82
Anti-mouse c-Kit (2B8)-PE-Cyanine7	eBioscience	Cat#25-1171-82
Anti-mouse CD25 (PC61.5)-APC	eBioscience	Cat#17-0251-82
Anti-mouse CD25 (PC61.5)- PE-Cyanine7	eBioscience	Cat#25-0251-82
Anti-mouse CD127 (A7R34)-PE-Cyanine7	eBioscience	Cat#25-1271-82
Anti-mouse CD127 (A7R34)-BV421	Biolegend	Cat#135024
Anti-mouse CCR9 (9B1)-FITC	Biolegend	Cat#129706
Anti-mouse CCR9 (9B1)-PE	Biolegend	Cat#129708
Anti-mouse CD90.2 (53-2.1)-FITC	Biolegend	Cat#140304
Anti-mouse CD90.2 (HIS51)-APC	eBioscience	Cat#17-0900-82
Anti-mouse ICOS (7E.17G9)-PE	eBioscience	Cat#12-9942-82
Anti-mouse ST2 (RMST2-2)-Biotinylated	eBioscience	Cat#13-9333-82
Anti-mouse ST2 (RMST2-2)-SB600	eBioscience	Cat#63-9335-82
Anti-mouse CD326 (G8.8)-FITC	eBioscience	Cat#11-5791-82
Anti-mouse CD326 (G8.8)-APC	eBioscience	Cat#17-5791-82
Anti-mouse CD24 (M1/69)-PE	eBioscience	Cat#12-0242-82
Anti-mouse CD24 (M1/69)-BV421	Biolegend	Cat#101825
Anti-mouse MHC Class II (I-A/I-E) (M5/115.15.2)-eF450	eBioscience	Cat#48-5321-82
Anti-mouse GATA3 (TWAJ)	eBioscience	Cat#46-9966-42
Anti-mouse Tph1 (EP1311Y)	OriGene	Cat#TA300818
Anti-mouse ICOS antibody-Purified	Bioxcell	Cat#BE0059
Rat IgG isotype control-Purified	Sigma-Aldrich	Cat#I4131
Anti-mouse CD4 antibody (GK1.5)-Purified	This paper	N/A
Streptavidin-BV421	Biolegend	Cat#405225
Streptavidin-BV605	Biolegend	Cat#405229
Streptavidin-BV650	Biolegend	Cat#405232
Streptavidin-Alexa Fluor 647	Thermo Fisher Scientific	Cat#S32357
Mouse anti-serotonin (H209)	Dako	Cat#M0758
Hamster anti-CD3ε (eBio500A2)-biotinylated	eBioscience	Cat#13-0033-82
Polyclonal goat anti-mouse IL-33	R&D Systems	Cat#AF3626
Mouse anti-E-Cadherin (36/E-Cadherin)-Alexa Fluor 647	BD Pharmingen	Cat#560062
Donkey anti-goat IgG-Alexa 488	Thermo Fisher Scientific	Cat#A-11055
Goat anti-mouse IgG1-Alexa 488	Thermo Fisher Scientific	Cat#A-21121
DAPI	Thermo Fisher Scientific	Cat#D1306
Hepes (1 M)	Gibco	Cat#15630080
Sodium pyruvate (100 mM)	Gibco	Cat#11360070
MEM non-essential amino acid solution (100X)	Gibco	Cat#11140050
L-Glutamine (200 mM)	Gibco	Cat#25030081
Penicillin- Streptomycin (10,000 U/mL)	Gibco	Cat#15140122
Dulbecco's Modified Eagle Medium	Gibco	Cat#41965039
RPMI 1640 with L-glutamine	Corning	Cat#10-040-CV
Percoll	GE Healthcare	Cat#GE17-0891-01
BSA	Sigma-Aldrich	Cat#A6003
ACK lysing buffer	Lonza	Cat#12002-070
EDTA	Thermo Fisher Scientific	Cat#15575020
Bacterial and Virus Strains
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
DTT	Sigma-Aldrich	Cat#43815; CAS: 3483-12-3
Dispase II	Thermo Fisher Scientific	Cat#17105041; CAS: 42613-33-2
Collagenase III	Worthington	Cat#LS004183; CAS 9001-12-1
Collagenase II	Sigma-Aldrich	Cat#C6885; CAS: 9001-12-1
DNaseI	Sigma-Aldrich	Cat#D5025; 9003-98-9
Liberase TM	Roche	Cat#5401127001; CAS: 9001-12-1
Trizol	Invitrogen	Cat#15596026
Recombinant mouse IL-2	R&D Systems	Cat#402-ML
Recombinant mouse IL-7	R&D Systems	Cat#407-ML
Recombinant mouse IL-33	R&D Systems	Cat#3626-ML/CF
Recombinant mouse IL-7	Biolegend	Cat#577802
Recombinant mouse IL-33	Biolegend	Cat#580502
Recombinant mouse IL-25	Biolegend	Cat#587302
Recombinant mouse IL-25	R&D Systems	Cat#1399-IL
10X Single-Cell Lysis Buffer	Clontech Laboratories	Cat#635013
Dextran-coated charcoal	Sigma-Aldrich	Cat#C6241
Tranylcypromine hemisulfate	Focus Biomolecules	Cat#10-4535; CAS: 13492-01-8
2-Mercaptoethanol	Gibco	Cat#21985023; CAS: 60-24-2
16% paraformaldehyde	Electron Microscopy Sciences	Cat#15710; CAS: 30525-89-4
Freezing medium OCT	Leica	Cat#14020108926
Triton X-100	Sigma-Aldrich	Cat#T8787; CAS: 9002-93-1
Protector RNase Inhibitor	Roche	Cat#3335402001
Critical Commercial Assays
Live/Dead Fixable Aqua Dead Cell Stain Kit	Thermo Fisher Scientific	Cat#L34957
SYTOX Blue Dead Cell Stain	Thermo Fisher Scientific	Cat#S34857
Foxp3 transcription factor staining buffer set	eBioscience	Cat#00-5523-00
High Capacity cDNA Reverse Transcription kit	Applied Biosystems	Cat#4368814
TaqMan® Universal Master Mix II, with UNG	Applied Biosystems	Cat#4440038
Power SYBR™ Green PCR Master Mix	Applied Biosystems	Cat#4367660
SMARTer® Ultra® Low Input RNA Kit V4	Clontech Laboratories	Cat#634894
Lipocalin-2/NGAL DuoSet ELISA system	R&D Systems	Cat#DY1857
Ultra Sensitive Serotonin enzyme immunoassay	Labor Diagnostika Nord	Cat#BA E-5900
Deposited Data
Small intestinal ILC2 and ILC3 RNA-seq data	This paper; Klose et al., 2017	GEO: GSE101625
Mesenteric lymph node ILC2 RNA-seq data	This paper; Moriyama et al., 2018	GEO: GSE108884
Raw and analyzed data	This paper	GEO: GSE145289
Experimental Models: Cell Lines
Experimental Models: Organisms/Strains
Mouse: B6: C57BL/6	The Jackson Laboratories	RRID:IMSR JAX:000664
Mouse: B6: Tph1fl/fl	Yadav et al., 2008	N/A
Mouse: B6: Ilr7Cre/+	Schlenner et al., 2010	N/A
Mouse: B6: Il33−/−	Amgen Inc. through Taconic Farms; Louten et al., 2011	N/A
Mouse: B6: Vfl33	He et al., 2018	N/A
Mouse: B6: Il17rb−/−	Neill et al., 2010	N/A
Mouse: B6: Il1rl1−/−	Townsend et al., 2000	N/A
Mouse: BALB/c: Il4Gfp/Gfp	Mohrs et al., 2001	N/A
Nippostrongylus brasiliensis	Lawrence et al., 1996	N/A
Oligonucleotides
Tph1	Applied Biosystems	Cat#Mm01202614_m1
Chga	Applied Biosystems	Cat#Mm00514341_m1
Icos	Applied Biosystems	Cat#Mm00497600_m1
Cxcr6	Applied Biosystems	Cat#Mm00472858_m1
Tigit	Applied Biosystems	Cat#Mm03807522_m1
Htr1b	Applied Biosystems	Cat#Mm00439377_s1
Hprt1	Applied Biosystems	Cat#Mm00446968_m1
Trim12a (5′ CCTGTCTGTCTGAACCTGATGG 3′ and 5′ GGCTTGAACATTTTGAGCCTCT 3′)	Invitrogen	N/A
Ermn (5′ CTGAGACACTGAGCGGGAC 3′ and 5′ CAACCTTGTAGTATGCCTGGG 3′)	Invitrogen	N/A
Lgmn (5′ TGGACGATCCCGAGGATGG 3′ and 5′ GTGGATGATCTGGTAGGCGT3′)	Invitrogen	N/A
Il25	Qiagen	Cat#QT00134645
Il33	Qiagen	Cat#QT00135170
Actb	Qiagen	Cat#QT01136772
Recombinant DNA
Software and Algorithms
FACS Diva software	BD Biosciences	N/A
FlowJo V9.9.3 software	TreeStar	https://www.flowjo.com/solutions/flowjo/downloads
FlowJo V10.4.2 software	TreeStar	https://www.flowjo.com/solutions/flowjo/downloads
GraphPad Prism 7.0 software	GraphPad	https://www.graphpad.com
QuantStudio Real-Time PCR V1.0 software	Thermo Fisher Scientific	N/A
NanoDrop 2000 Spectrophotometer V1.0 software	Thermo Fisher Scientific	N/A
CASAVA (v2.17)	Illumina	N/A
FLEXBAR (v2.4)	Dodt et al., 2012	N/A
STAR aligner (v2.3.0)	Dobin et al., 2013	N/A
Rsubread R package	Liao et al., 2013	N/A
DESeq2 version 1.20.0	Love et al., 2014	N/A
clusterProfiler R package	Yu et al., 2012	N/A
Other

Highlights:

• IL-33 promotes inflammatory ILC2s

• Tph1 is up-regulated in ILC2s upon activation in an IL-33-dependent manner

• Il7r^Cre/+ Tph1^flox/flox mice are highly susceptible to helminth infections

• Tph1 regulates inflammatory ILC2 responses during helminth infection