Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Sep 19.
Published in final edited form as: Methods Mol Biol. 2022;2521:191–206. doi: 10.1007/978-1-0716-2441-8_10

Bioengineered RNA Therapy in Patient-Derived Organoids and Xenograft Mouse Models

Mei-Juan Tu 1, Colleen M Yi 1, Gavin M Traber 1, Ai-Ming Yu 1
PMCID: PMC9484490  NIHMSID: NIHMS1834217  PMID: 35732999

Abstract

Therapeutic RNAs, such as antisense oligonucleotides (ASOs), aptamers, small-interfering RNAs (siRNAs), microRNAs (miRs or miRNAs), messenger RNAs (mRNAs), and guide RNAs (gRNAs), represent a novel class of modalities that not only increase the molecular diversity of medications but also expand the range of druggable targets. To develop noncoding RNA therapeutics for the treatment of cancer diseases, we have established a novel robust RNA bioengineering platform to achieve high-yield and large-scale production of true biologic RNA agents, which are proven to be functional in the control of target gene expression and effective in the management of tumor progression in various models. Herein, we describe the methods for bioengineered RNA (BioRNA or BERA) therapy in patient-derived organoids (PDOs) in vitro and patient-derived xenograft (PDX) mouse models in vivo. The efficacy of a BioRNA, miR-1291, in the inhibition of pancreatic cancer PDO and PDX growth is exemplified in this chapter.

Keywords: Bioengineer, Noncoding RNA, microRNA, siRNA, Cancer, Therapy, PDO, PDX

1. Introduction

With the understanding of RNA biological functions and roles in diseases as well as the development of RNA technologies, such as manufacturing and formulation, there is growing interest in developing therapeutic RNAs for the treatment or prevention of diseases [1]. Indeed, a number of RNA medications have been approved by the United State Food and Drug Administration (FDA) for the treatment of various types of disorders, including antisense oligonucleotides (ASOs) (e.g., fomivirsen, mipomersen, eteplirsen, nusinersen, inotersen, golodirsen, viltolarsen, and casimersen), RNA aptamer (e.g., pegaptanib), small interfering RNAs (siRNAs) (e.g., patisiran, givosiran, and lumasiran) [1]. In addition, two messenger RNA (mRNA) vaccines (BNT162b2 and mRNA-1273) were also approved under the emergency use authorization for the prevention of unprecedented COVID-19 pandemic. RNAs have emerged as a novel class of modalities, complementary to small-molecule and protein therapeutics, in that RNAs not only increase the molecular diversity of medications but also expand the range of druggable targets [1].

The development of therapeutic RNAs, as well as basic biological and biomedical research, is dominated by the use of RNA agents made by chemical synthesis or in vitro transcription [2, 3]. To overcome the limitations of synthetic RNA agents such as potential side effects associated with extensive artificial modifications, large efforts have been made toward the development of in vivo approaches to produce true biological RNA molecules that are absent of artificial modifications and folded in living cells [4–7]. Very recently we have established a novel robust technology to achieve high-yield and large-scale production of recombinant or bioengineered noncoding RNA agents (BERAs or BioRNAs) that are comprised of various types of payloads small RNAs, including microRNAs (miRNAs), siRNAs and RNA aptamers, by using particular transfer RNA fused pre-miRNA as a carrier [8–11]. Our data have further demonstrated that high-quality BioRNAs are functional in selectively controlling target gene expression and effective in reducing cancer cell proliferation, tumor progression and metastasis in a variety of models [9, 10, 12–15].

Proper preclinical models are warranted to evaluate the efficacy of new anticancer therapies both in vivo and in vitro. While immortalized carcinoma cell lines are easily maintained and widely used for in vitro studies and readily employed for the generation of xenograft mouse models for in vivo therapy studies, there is a high attrition when translating preclinical findings into clinical investigations. One major cause of the discrepancy is the genetic changes of cells with long-term in vitro maintenance. Alternatively, low-pass patient-derived organoid (PDO) models and patient-derived xenograft (PDX) mouse models, being developed directly from fresh patient tumors and demonstrated to recapitulate the heterogeneity and original profiles of patient tumors [16, 17], have been increasingly used in preclinical cancer therapy studies. Our lab has successfully established a number of pancreatic cancer PDO and PDX models for cancer research, including the assessment of new anticancer therapies [13, 18].

Herein, we describe the protocols for the investigation of anticancer efficacy of bioengineered RNAs in clinically relevant PDO and PDX models in vitro and in vivo, respectively, which are also applicable for the determination of gene functions using BioRNA agents in these models. Details are provided in the following sections for rigorous studies on biologic RNA therapy using pancreatic cancer PDO and PDX models.

2. Materials

2.1. Bioengineered RNA Therapy in PDO Models

2.1.1. Laboratory Equipment

  1. Water bath.

  2. CO2 tissue culture incubator (HEAR cell 150i, Bio-Rad).

  3. Sorvall Legend XTR Centrifuge (Thermo Fisher Scientific, Waltham, MA).

  4. Inverted microscope.

  5. Laboratory balances.

  6. Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA).

  7. 3-mL syringe with 23-G × 1 in. needle, sterile.

  8. Bottle-top filtration unit, 500 mL, 0.2 μm.

  9. Countess II Automated Cell Counter (Thermo Fisher Scientific).

  10. ImageXpress® Pico Automated Cell Imaging System (Molecular Devices, San Jose, CA).

2.1.2. Reagents (See Note 1) [19]

  1. L Wnt-3A (with a zeocin selection marker) and HA-Rspo1-Fc 293T cell culture medium, add 60 mL of FBS and 5 mL penicillin–streptomycin (10,000 U/mL) to 500 mL Dulbecco’s Modified Eagle Medium (DMEM), store at 4 °C.

  2. L Wnt-3A cell selection medium, add 62.5 μL of 100 mg/mL zeocin stock solution to 50 mL culture medium.

  3. HA-Rspo1-Fc 293T cell selection medium, add 150 μL of 100 mg/mL zeocin stock solution to 50 mL culture medium.

  4. HA-Rspo1-Fc 293T cell conditioning medium, add 5 mL GlutaMAX (100×), 5 mL of 1 M HEPES, and 5 mL of penicillin–streptomycin to 500 mL Advanced DMEM/F12, store at 4 °C.

  5. Basic medium, add 5 mL of HEPES buffer, 5 mL GlutaMAX, and 1.25 mL Primocin to 500 mL advanced DMEM/F12, store at 4 °C.

  6. Feeding medium, mix the following reagents, basic medium, 76 mL; 200 μL 0.5 mM A83-01; 200 μL mEGF (50 μg/mL); 200 μL mNoggin (100 μg/mL); 200 μL hFGF10 (100 μg/mL); 200 μL Gastrin I (10 μM); 500 μL 500 mM N-acetylcysteine; 2 mL 1 M nicotinammide; 4 mL 50× B-27 Supplement; 20 mL 10× R-Spondin 1-conditioned medium; 100 mL 2× Wnt3a-conditioned medium; 200 μL 1 M prostaglandin E2; 200 μL 10.5 mM Y-27632 (see Note 2). Store at 4 °C.

  7. Growth factor reduced Matrigel, thaw the Matrigel on ice or at 4 °C (see Note 3) and make 500–1000 μL aliquots. Store the aliquots at −20 °C.

  8. TrypLE Express.

  9. Phosphate buffered saline (PBS).

  10. 0.05% Trypsin-EDTA, phenol red.

  11. Lipofectamine™ 3000 Transfection Reagent.

  12. Opti-MEM™ I Reduced Serum Medium (Thermo Fisher Scientific).

  13. CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Madison, WI).

  14. LIVE/DEAD™ Viability/Cytotoxicity Kit, for mammalian cells (Thermo Fisher Scientific).

2.2. Bioengineered RNA Therapy in PDX Mouse Models

2.2.1. Laboratory Equipment

  1. 10-gauge trocar.

  2. Electric Shaver.

  3. #22 Scalpels.

  4. Electric caliper.

  5. 29 G 1/2 in., 500 μL, needle attached syringe.

  6. Electronic balance.

  7. NGC Quest™ 10 Chromatography System (Bio-Rad, Hercules, CA).

  8. BioFrac™ Fraction Collector (Bio-Rad).

  9. Enrich™ Q 10 × 100 column (Bio-Rad).

2.2.2. Reagents

  1. Antibiotic medium, add 500 μL of 100× Antibiotic-Antimycotic solution (Corning, Corning, NY) to 50 mL serum-free RPMI 1640 medium.

  2. Antibiotic PBS, add 500 μL of Antibiotic-Antimycotic solution to 50 mL PBS.

  3. Anesthetics, add 1 mL of 100 mg/mL ketamine and 100 μL of 100 mg/mL xylazine to 8.9 mL sterile PBS.

  4. In vivo-jetPEI Delivery reagent.

  5. Diethyl pyrocarbonate (DEPC)-treated water, add 1 mL DEPC (>97%) to a glass bottle containing 1 L of double distilled water (dd water). Screw the cap on tightly and stir for 2 h at room temperature using a magnetic stirrer. Autoclave at 121 °C for 30 min. Store at 4 °C.

  6. LB or 2× YT bacteria culture medium: Add 20 g of LB broth or 31 g of 2× YT medium broth powder to 1 L of dd water and sterilize by autoclaving at 121 °C for 15 min. Add ampicillin to a final concentration of 100 mg/L after the medium is cooled (<55 °C). Store at 4 °C.

  7. RNA purification Buffer A (10 mM NaH2PO4): Add 1.38 g of NaH2PO4·H2O to 900 mL of DEPC water, mix well. Adjust pH to 7.0 and volume to 1000 mL. Store at 4 °C.

  8. RNA purification Buffer B (10 mM NaH2PO4, 1 M NaCl): Add 1.38 g of NaH2PO4·H2O and 58.44 g NaCl to 900 mL of DEPC water, mix well. Adjust pH to 7.0 and volume to 1000 mL. Store at 4 °C.

3. Methods

3.1. 3D Culture of PDOs and Treatment with Bioengineered RNAs

3.1.1. Preparation of Culture Medium

  1. L Wnt-3A-conditioned medium:
    1. Thaw a vial of L Wnt-3A cells and resuspend them in 8 mL of culture medium.
    2. Centrifuge the cells at 120 × g and aspirate the medium.
    3. Resuspend the cells with 1 mL of selection medium and seed them in a 75-cm2 cell culture flask containing 20 mL of freshly made cell selection medium.
    4. Maintain the cells in a CO2 tissue culture incubator until 100% confluent (typically 2–4 days).
    5. Remove the medium, wash once with PBS, and then add 2 mL of 0.05% trypsin-EDTA to dissociate the cells.
    6. When the cells are detached from the adherent surface, neutralize the trypsin using 6 mL of culture medium and pipette several times to dissociate the cells to single cells.
    7. Centrifuge cells at 120 × g for 5 min, then remove the medium.
    8. Resuspend cells with 7 mL of culture medium and add 1 mL to a 75 cm2 cell culture flask consisting of 20 mL of culture medium (conditioning flasks, 6 in total). Transfer the other 1 mL of cell suspension to a 75 cm2 culture flask containing 20 mL of freshly made selection medium (selection flask).
    9. After 2–4 days of incubation, when the conditioning flasks become 100% confluent, dissociate the cells (repeat steps e to g).
    10. Combine the cells and add culture medium to a final total volume of 300 mL.
    11. Seed 20 mL of cell suspension onto a 15-cm culture dish. Make 15 dishes in total.
    12. After being incubated for 1 week in a CO2 tissue culture incubator, transfer the medium to 50 mL conical tubes.
    13. Centrifuge the medium at 500 × g for 5 min to pellet floating cells.
    14. Carefully transfer the supernatant into a 0.2 μm sterile Bottle Top Filtration Unit to filter the medium.
    15. Aliquot the filtered medium (50 mL/tube) and store at 4 °C or −20 °C (long-term storage).
    16. For confluent “selection flask”, repeat steps e to o to make more conditioned medium.
  2. HA-Rspo1-Fc 293T cell-conditioned medium (10× R-Spondin 1-conditioned medium):
    • (a)
      Thaw a vial of HA-Rspo1-Fc 293T cells and resuspend them in 8 mL of culture medium.
    • (b)
      Steps b to h, similar as the protocol described above in step 1, except that HA-Rspo1-Fc 293T cell specific medium (described in Subheading 2.1.2) was used.
    • (i)
      When the conditioning flasks become 100% confluent (typically 2–3 days), carefully aspirate the medium and wash the cells twice with 15 mL PBS.
    • (j)
      Add 20 mL of conditioning medium to each flask.
    • (k)
      Maintain the cells in a CO2 incubator for a week.
    • (l)
      Carefully transfer the medium to 50 mL conical tubes.
    • (m)
      Centrifuge the medium at 500 × g for 5 min to pellet floating cells.
    • (n)
      Carefully transfer the supernatant into a 0.2 μm sterile Bottle Top Filtration Unit to filter the medium.
    • (o)
      Aliquot filtered medium (50 mL/tube) and store at 4 °C or −20 °C (long-term storage).
    • (p)
      For confluent “selection flask”, repeat steps e to o (step 2) to make more conditioned medium.

3.1.2. Thawing and Maintenance of Human Organoids

  1. About 1 h prior to starting, warm up the feeding medium at room temperature or in a 37 °C water bath, thaw a Matrigel aliquot on ice, and warm up a 24-well tissue culture plate in a 37 °C, CO2 incubator on the top of a prewarmed water bottle.

  2. Thaw a vial of frozen human organoids and resuspend them using 10 mL of ice-cold basic medium. Keep the basic medium-containing vial(s) on ice.

  3. Centrifuge the organoid suspension at 120 × g for 5 min at 4 °C (see Note 4).

  4. Carefully remove as much medium as possible and resuspend the cells with 50 μL of Matrigel. Keep the vial(s) on ice.

  5. Keep the tissue culture plate on the warm water bottle and transfer to a tissue culture hood.

  6. Carefully pipette a cell-Matrigel dome in the center of the well (50 μL/well for 24-well plate, 25 μL/well for 48-well plate), be careful to avoid any bubbles within the dome.

  7. Carefully bring the 24-well plate and the warm bottle to a CO2 incubator without disturbing the domes, incubate at 37 °C for 15 min to allow the Matrigel to solidify.

  8. Take out the 24-well plate with the warm water bottle and add 600 μL of warm feeding medium in a tissue culture hood.

  9. Return the tissue culture plate and the water bottle to the tissue culture incubator and incubate the organoids until passaging (4–10 days).

  10. Change the medium if the color changed (every 2–3 days). Once the organoids form and grow, use feeding medium without Rho kinase inhibitor. Figure 1a is a representative image of pancreatic cancer organoids established in our lab.

  11. Passage the organoids when the density and/or size of organoids are high (see Note 5).

Fig. 1.

Fig. 1

Open in a new tab

Development of novel biologic RNA therapeutics using patient-derived organoids (PDOs) and patient-derived xenograft (PDX) mouse models. (a) An illustrative image of pancreatic cancer PDOs cultured with Matrigel. (b) Morphology and colony formation of the PDOs treated with a bioengineered RNA versus control for 4 days, which were stained with a LIVE/DEAD™ Viability/Cytotoxicity Kit. Live cells are indicated by green fluorescence staining. The results demonstrated the inhibition of PDO colony formation and growth by the BioRNA. (c) Schematic illustration of the establishment of PDX mouse models. PDXs from F3 could be used for therapy study. (d) Timeline of bioengineered RNA therapy study and the representative tumor growth curves during a study

3.1.3. Passaging of Human Organoids

  1. Remove the medium from the wells consisting of well growing organoids.

  2. Add 500 μL of ice-cold basic medium to each well and pipette several times to disintegrate the Matrigel dome.

  3. Transfer the mixture to a 15 mL conical tube consisting of 8 mL ice-cold basic medium, rinse the well with basic medium to harvest the leftover organoids, and combine the suspension. Keep the tube on ice.

  4. Centrifuge the organoid suspension at 120 × g for 5 min at 4 °C.

  5. Remove the medium carefully until ~1.8 mL of medium left in the tube.

  6. Resuspend and break up the organoids using a 23-G needle-attached 3 mL syringe by suction and pushing out the liquid for 6–8 times.

  7. Add 10 mL of basic medium and centrifuge the organoid suspension at 120 × g for 5 min at 4 °C.

  8. Remove the medium until ~200 μL of medium left in the tube and add 800 μL of TrypLE Express and mix well.

  9. Incubate at 37 °C for 5–10 min to dissociate the small organoids to single cells (see Note 6).

  10. Add 10 mL of basic medium, pipet several times, and centrifuge the tube at 120 × g for 5 min at 4 °C.

  11. Carefully remove as much medium as possible and resuspend the cells with 1 mL of feeding medium.

  12. Count the cells with an automated cell counter.

  13. Dilute the cell suspension to proper concentration and seed the cells to 96-well plates (2000–20,000 cells/well, depending on the purpose of study, 190 μL/well).

3.1.4. Treatment of PDOs with Bioengineered RNAs

  1. A detailed protocol for the expression and purification of recombinant RNAs has been described recently [6]. The BioRNA/miR-1291 [13, 20], whose sequence is shown in Table 1, is used as an example herein to briefly introduce the protocol.
    1. Transform 200 ng of BioRNA/miR-1291-expressing plasmids into 30 μL Stellar™ Competent Cells (E. coli HST08 strain).
    2. Shake in 600 mL LB or 2× YT broth overnight at 37 °C, 225 rpm.
    3. Isolate total RNA using Tris–HCl-saturated phenol extraction method [6].
    4. Load 1–2 mL of total RNA solution (2–5 mg RNA) into the sample loop of an NGC Quest™ 10 Chromatography System equipped with a BioFrac™ Fraction Collector and an Enrich™ Q 10 × 100 column.
    5. Total RNA was separated at a constant flow rate of 2.5 mL/min under the following conditions: 100% Buffer A for 4.4 min, 64% Buffer B for 10 min, 64–78% Buffer B for 8 min, and then 100% Buffer B for 3 min.
    6. Combine the isolated target BioRNA/miR-1291 fractions and concentrate the BioRNA to make ready-to-use RNA agent.

  2. Determine the concentration of pure BioRNA and calculate the volume needed for each well (see Note 7).

  3. Dilute the BioRNA with 5 μL of Opti-MEM (for each well of 96-well plate), and then add 0.1 μL of the P3000 reagent. Mix well. Scale up the volumes if there are multiple wells.

  4. Dilute 0.2 μL (0.15–0.3 μL/well) of Lipofectamine™ 3000 with 5 μL of Opti-MEM in another vial.

  5. Mix the diluted BioRNAs and transfection reagents by pipetting several times. Incubate at room temperature for 10 min.

  6. Add the formulated RNA agents to freshly seeded cells at 10 μL/well. Seal the plate with parafilm.

  7. Centrifuge the plate at 300–600 × g for 1 h at room temperature.

  8. Transfer the plate to a CO2 cell culture incubator and incubate at 37 °C for 6–24 h.

  9. Add 50 μL of ice-cold feeding medium/Matrigel mixture (1: 1 v/v) and mix well with the cell suspensions (see Note 8).

  10. Incubate the cells for 3–5 days.

Table 1.

Full sequence of the BioRNA/miR-1291. Mature has-miR-1291-5p sequence is in bold. nt nucleotide, MW molecular weight

Sequence of BioRNA/miR-1291 (5′ to 3′) Length (nt) MW (Da)
GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACG
 UCGACGAGUUCUGUCCGUGAGCCUUGGGUAGAAUUCCAG
 UGGCCCUGACUGAAGACCAGCAGUUGUACUGUGGCUGUUGG
 UUUCAAGCAGAGGCCUAAAGGACUGUCUUCCUGUGGUCUG
 UUGGCUGUGACGUCGAUGGUUGCGGCCGCGGGUCACAGG
 UUCGAAUCCCGUCGUAGCCACCA		 227 73,400.6
Open in a new tab

3.1.5. Determination of PDO Viability

  1. Remove the gel-medium mixture carefully (see Note 9).

  2. Add 60 μL of the mixture of CellTiter-Glo® Assay reagent and PBS (1:1 v/v).

  3. Shake the plate for 2 min and incubate at room temperature for 10 min.

  4. Pipette the cell lysates and transfer to an opaque-white plate to record the luminescence signals (see Note 10).

  5. Calculate the cell viability by normalizing the signal of the treatment group to the control group.

3.1.6. Organoid Staining and Imaging

  1. Add 20 μL of 2 mM EthD-1 stock solution (LIVE/DEAD™ Viability/Cytotoxicity Kit, Component B) to 10 mL of sterile D-PBS.

  2. Add 5 μL of 4 mM Calcein AM stock solution (LIVE/DEAD™ Viability/Cytotoxicity Kit, Component A) to the diluted EthD-1 solution. Mix well by pipetting.

  3. Carefully remove the Matrigel-medium mixture from the cells.

  4. Add 150 μL of the diluted staining reagents to each well.

  5. Incubate the cells for 30 min in a CO2 incubator.

  6. Image the cells using the ImageXpress® Pico Automated Cell Imaging System by following the manufacturer’s instructions (see Note 11). Figure 1b is an example of stained pancreatic cancer PDOs at 4 days posttreatment with a BioRNA versus control PDOs.

3.2. Bioengineered RNA Therapy in PDX Mouse Models

3.2.1. Establishment of PDX Mouse Models (See Note 12)

  1. Transfer the dissected fresh patient pancreatic tumor tissue via antibiotic medium in a 50 mL tube on ice.

  2. Place the tube with ice box in a sterile biosafety cabinet and wash the tissue twice with antibiotic medium.

  3. Transfer the tumor specimen to a sterile petri dish containing antibiotic medium. Keep the dish on ice.

  4. Mince the specimen with a sterile scalpel into ~2–3 mm3 pieces.

  5. Rinse the tumor fragments with ice-cold antibiotic PBS and transfer the fragments with 1 mL of washing buffer to a 1.5 mL vial.

  6. Weigh a NOD/SCID mouse and anesthetize the animal with the 80 mg/kg ketamine/8 mg/kg xylazine solution via intra-peritoneal injection.

  7. Swab the back of the mouse with a 75% alcohol pad and implant tumor fragments subcutaneously into the rear flank (one piece for each side, see Note 13) of the anesthetized mice using a trocar.

  8. Recover the mouse from anesthesia.

  9. Monitor the body weight and tumor growth every week (see Note 14).

  10. Once a palpable tumor shows up, shave off the hair covering the tumor using an electric shaver.

  11. Measure the tumor size using a caliper every week until tumor size reaches 1–1.5 cm in diameter (F1 PDX model, usually takes 1–6 months).

  12. Anesthetize the mouse with ketamine/xylazine as described in step 6 and spray the mouse with 75% ethanol.

  13. Place the animal in a sterile biosafety cabinet and make an incision using sterile scissors to take the tumor.

  14. Transfer the tumor immediately to an antibiotic medium-containing petri dish and cut the tumor to small pieces as described in steps 3–5.

  15. Anesthetize 2–4 NOD/SCID mice and inoculate the tumor fragments as described in steps 6–9 to establish F2 PDX mouse models.

  16. Repeat steps 10–15 to establish F3 PDX mice for therapy study. The number of the animals depends on the therapy study design (see Note 15). The schematic illustration of PDX model establishment and development was shown in Fig. 1c.

3.2.2. Bioengineered RNA Therapy in PDX Models

  1. Monitor the body weight and tumor growth of the PDX mouse models 1–2 times per week (Fig. 1d).

  2. Measure the tumor size as described in steps 10 and 11 of Subheading 3.2.1. Calculate the tumor size using the following formula: Volume = 0.5 × length × width2.

  3. Once tumor size reaches a desired size (e.g., 70–150 mm3 to which it may take over 3 weeks), randomize animals to various groups according to study design, for example, vehicle control group, control RNA group, and therapeutic BioRNA treatment group (6–12 animals/group).

  4. RNA preparation and formulation:
    1. Calculate the volume of the BioRNA used for each animal. Here we use a dose of 30 μg/animal as an example (see Note 16).
    2. Dilute the 10% glucose solution supplied within the In vivo-jetPEI kit to 5% using DEPC-treated sterile water.
    3. Dilute 30 μg BioRNA with 75 μL of 5% glucose.
    4. Dilute 4.8 μL of in In vivo-jetPEI with 75 μL of 5% glucose, mix well by pipetting.
    5. Mix the diluted RNA and PEI; pipette several times to mix thoroughly.
    6. Incubate at room temperature for 15 min.

  5. For animal treatment inject 150 μL of formulated RNA through tail vein using a syringe with a 29-G, 1/2-in. needle.

  6. Treat the animals 2–3 times/week with freshly formulated RNA agents for 3–4 weeks (see Note 17).

  7. Monitor tumor size and body weight twice per week. A representative timeline of the therapy study and growth curve of the tumors are shown in Fig. 1d.

  8. At the end of the treatment, measure the tumor size and sacrifice the animals:
    1. Anesthetize the animals with ketamine–xylazine as described in step 6 of Subheading 3.2.1.
    2. Draw the blood through the orbit or heart of the animals and proceed (steps i and j) for further analyses.
    3. Excise the tumors and transfer them to ice-cold PBS.
    4. Weigh the tumors and assemble all the tumors to image.
    5. Transfer the tumors to ice-cold PBS-containing dishes/plates, and immediately cut each tumor to several pieces for desired biochemical and histopathological studies.
    6. Freeze two pieces at −80 °C immediately for future protein/RNA isolation and protein/gene analysis.
    7. Transfer one piece to 10% formalin to fix the tissue (18–24 h).
    8. Rinse the fixed tumors with 70% ethanol and leave them in 70% ethanol for pathology analyses (see Note 18).
    9. Centrifuge the blood sample at 1000 × g for 10 min to separate serum.
    10. Transfer the supernatant to a new vial and store at −80 °C for future serum biochemistry analyses (see Note 19).

4. Notes

  1. The protocol reported by Tuveson Lab [19, 21] was followed for the establishment and maintenance of pancreatic cancer PDO models, with minor modifications. The detailed reagent recipes were also described in the protocol [19]. Organoids could be established directly from fresh patient tumor tissues or PDX tumors (Fig. 1).

  2. Rho kinase inhibitor (Y-27632) is only required when organoids are isolated for the first time, the organoids are thawed, or the organoids are dissociated to single cells. The feeding medium without Y-27362 is used in the regular maintenance of organoids.

  3. It usually takes about 8 h to thaw a 10 mL vial of Matrigel at 4 °C or on ice, thus it is suggested to make 500–1000 μL aliquots once received and store at −20 °C. Thaw one vial at 4 °C 1–2 h prior to using. Always keep the Matrigel vial on ice when working on it; otherwise, it will solidify.

  4. Centrifugation for organoid processing (e.g., thawing, passaging, and treatment) should be conducted in a flat fillet centrifuge.

  5. Organoids should be passaged when the density is higher than 80% on each layer or the diameter is >20% of the Matrigel. If the organoids are incubated for too long without splitting, black, died cells may show up and the organoids or even the Matrigel dome may not be firm or stable anymore.

  6. Some of the organoids will easily dissociate to single cells, thus this step is unnecessary. Organoids could also be treated as small organoids (clusters) and, in this case, TrypLE Express is not needed. Alternatively, TrypLE Express could be added and incubated first and then further dissociate the organoids by syringe-pipetting (remove step 5, perform steps 8 and 9 first, add 1 mL of basic medium, and then perform steps 6 and 7).

  7. For viability assay, the organoids are usually treated with 1–20 nM of a BioRNA. Figure 1b is a representative image of pancreatic cancer PDO treated with 15 nM of BioRNA or blank control for four days. Treatment of tumor suppressive BioRNA led to smaller and fewer colony formation. Always calculate 10% more of all the reagents when formulating therapeutic RNAs to account for pipetting error, for both in vivo and in vitro treatment.

  8. The final concentration of Matrigel is 10%. Thus, the volume could be adjusted according to the total volume. Matrigel begins hardening at > 4 °C and the medium in each well is warm; therefore, dilution of Matrigel using ice-cold medium helps the Matrigel and cell containing medium mix completely. It is not recommended to replace the medium (no Matrigel) in the wells with transfected cells, as the cells could not attach to the bottom tightly or are suspending in the medium without Matrigel at 6–24 h posttransfection.

  9. As the Matrigel-containing medium is a semicolloidal or sticky system, it may take several times to remove the mixture completely. Organoids could attach to the bottom of well relatively tightly after 3- to 5-day incubation with Matrigel. Therefore, cells will not be lost if the medium and gel are removed carefully. A little bit of leftover Matrigel may not affect the cell viability data.

  10. Bubbles might be introduced due to pipetting. To remove the bubbles, the cell lysate-containing white plate could be centrifuged at 1000 × g for 3–5 min.

  11. Green-fluorescent Calcein-AM staining is an indicator of live cells, while red-fluorescent ethidium homodimer-1 staining indicates dead cells. We observed more and bigger green staining organoids in the control group as compared to the BioRNA/miR-1291 treatment, indicating the antiproliferative activity of BioRNA/miR-1291(Fig. 1b).

  12. The model was established based on previous reports [13, 22]. A schematic illustration of the development of PDX mouse models is shown in Fig. 1c.

  13. For the first and second generations of PDX tumor, we implanted tumor fragments to both left and right flanks for expansion. Once sufficient PDX tumors are obtained, one piece is implanted into each animal (typically on the right flank) for therapy study.

  14. Growth of the surgically dissected pancreatic cancer patient tumor in the mouse models (F1 or even F2) to a serviceable size usually takes several months and the total successful rate of PDX model establishment is lower than 40%. Therefore, the tumor growth could be monitored every 2 weeks before a palpable tumor shows up. Once the model is established, the F3 and subsequent generations of tumors may grow faster; therefore, the tumors should be monitored more often.

  15. The PDX tumors could be either cryopreserved (freeze more at the earlier stages) or passed and expanded to more generations. From F3, the PDXs can be used for therapy study (Fig. 1d). Design the study in advance, and implant tumor fragments to ~30% more animals required as some of tumors may grow either too fast or too slow due to the viability of the tumor fragments as well as the variations among individual animals.

  16. The dose of the bioengineered RNAs depends on the efficacy and safety of individual agents. We usually use 10–30 μg/animal (0.5–1.5 mg/kg), intravenous injection in our studies.

  17. The dose regimens should be optimized for each reagent and cancer type. Once tumor size reaches a maximal size or animal body weight shows a sharp reduction of 15–20%, the animal should be euthanized immediately by following IACUC recommendations.

  18. Hematoxylin–eosin (H&E) and immunohistochemistry (IHC) staining for proliferation (e.g., Ki-67) and apoptosis (e.g., cleaved caspase 3) markers are commonly conducted. Further, IHC analyses for specific targets of the BioRNA may prove the on-target effects.

  19. Serum biochemistry analyses are usually conducted, including liver and kidney function biomarkers, such as alanine transaminase (ALT), aspartate transaminase (AST), total protein, albumin, total bilirubin, alkaline phosphatase (ALP), blood urea nitrogen (BUN), and creatinine, which shows the safety profile of therapeutic RNAs.

Acknowledgments

This study was supported by the National Cancer Institute (NCI) (grant no. R01CA253230) and National Institute of General Medical Sciences (NIGMS) (R35GM140835), National Institutes of Health (NIH). Gavin M. Traber was supported by a NIGMS-funded Pharmacology Training Program Grant (T32GM099608). The authors also appreciate the access to the Mouse Biology and Molecular Pharmacology Shared Resources funded by the UC Davis Comprehensive Cancer Center Support Grant awarded by the NCI (No. P30CA093373, USA), NIH.

References

  • 1.Yu A-M, Choi YH, Tu M-J (2020) RNA drugs and RNA targets for small molecules: principles, progress, and challenges. Pharmacol Rev 72:862–898 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bramsen JB, Kjems J (2012) Development of therapeutic-grade small interfering RNAs by chemical engineering. Front Genet 3:154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Khvorova A, Watts JK (2017) The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotechnol 35:238–248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yu A-M, Batra N, Tu M-J, Sweeney C (2020) Novel approaches for efficient in vivo fermentation production of noncoding RNAs. Appl Microbiol Biotechnol 104:1927–1937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yu A-M, Jian C, Allan HY, Tu M-J (2019) RNA therapy: are we using the right molecules? Pharmacol Ther 196:91–104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tu M-J, Wright HK, Batra N, Yu A-M (2021) Expression and purification of tRNA/pre-miRNA-based recombinant noncoding RNAs. Methods Mol Biol 2323:249–265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ho PY, Yu AM (2016) Bioengineering of noncoding RNAs for research agents and therapeutics. Wiley Interdiscip Rev RNA 7:186–197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen QX, Wang WP, Zeng S, Urayama S, Yu AM (2015) A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications. Nucleic Acids Res 43:3857–3869 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ho PY, Duan Z, Batra N, Jilek JL, Tu MJ, Qiu JX et al. (2018) Bioengineered noncoding RNAs selectively change cellular mirnome profiles for cancer therapy. J Pharmacol Exp Ther 365:494–506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li P-C, Tu M-J, Ho PY, Batra N, Tran MM, Qiu J-X et al. (2021) In vivo fermentation production of humanized noncoding RNAs carrying payload miRNAs for targeted anticancer therapy. Theranostics 11:4858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Petrek H, Batra N, Ho PY, Tu MJ, Yu AM (2019) Bioengineering of a single long noncoding RNA molecule that carries multiple small RNAs. Appl Microbiol Biotechnol 103:6107–6117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Petrek H, Ho PY, Batra N, Tu M-J, Zhang Q, Qiu J-X et al. (2021) Single bioengineered ncRNA molecule for dual-targeting toward the control of non-small cell lung cancer patient-derived xenograft tumor growth. Biochem Pharmacol 189:114392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tu M-J, Ho PY, Zhang Q-Y, Jian C, Qiu J-X, Kim EJ et al. (2019) Bioengineered miRNA-1291 prodrug therapy in pancreatic cancer cells and patient-derived xenograft mouse models. Cancer Lett 442:82–90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang WP, Ho PY, Chen QX, Addepalli B, Limbach PA, Li MM et al. (2015) Bioengineering novel chimeric microRNA-34a for prodrug cancer therapy: high-yield expression and purification, and structural and functional characterization. J Pharmacol Exp Ther 354:131–141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jilek JL, Zhang QY, Tu MJ, Ho PY, Duan Z, Qiu JX et al. (2019) Bioengineered Let-7c inhibits orthotopic hepatocellular carcinoma and improves overall survival with minimal immunogenicity. Mol Ther Nucleic Acids 14:498–508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Seppälä TT, Zimmerman JW, Sereni E, Plenker D, Suri R, Rozich N et al. (2020) Patient-derived organoid pharmacotyping is a clinically tractable strategy for precision medicine in pancreatic cancer. Ann Surg 272:427–435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tentler JJ, Tan AC, Weekes CD, Jimeno A, Leong S, Pitts TM et al. (2012) Patient-derived tumour xenografts as models for oncology drug development. Nat Rev Clin Oncol 9:338–350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Duan Z, Chinn D, Tu MJ, Zhang QY, Huynh J, Chen J et al. (2019) Novel synergistic combination of mitotic arrest and promotion of apoptosis for treatment of pancreatic adenocarcinoma. Transl Oncol 12:683–692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Baker LA, Tiriac H, Tuveson DA (2019) Generation and culture of human pancreatic ductal adenocarcinoma organoids from resected tumor specimens. Methods Mol Biol 1882:97–115 [DOI] [PubMed] [Google Scholar]
  • 20.Li MM, Addepalli B, Tu MJ, Chen QX, Wang WP, Limbach PA et al. (2015) Chimeric MicroRNA-1291 biosynthesized efficiently in Escherichia coli is effective to reduce target gene expression in human carcinoma cells and improve chemosensitivity. Drug Metab Dispos 43:1129–1136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Boj Sylvia F, Hwang C-I, Baker Lindsey A, Chio Iok In C, Engle Dannielle D, Corbo V et al. (2015) Organoid models of human and mouse ductal pancreatic cancer. Cell 160:324–338 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kim MP, Evans DB, Wang H, Abbruzzese JL, Fleming JB, Gallick GEJN (2009) Generation of orthotopic and heterotopic human pancreatic cancer xenografts in immunodeficient mice. Nat Protoc 4:1670–1680 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES