Skip to main content
NCBI home page
Osteoarthritis and Cartilage Open logoLink to Osteoarthritis and Cartilage Open
. 2022 Apr 18;4(2):100263. doi: 10.1016/j.ocarto.2022.100263

TRPV4 activation enhances compressive properties and glycosaminoglycan deposition of equine neocartilage sheets

Cristóbal López-Jiménez a, Loraine LY Chiu b,c, Stephen D Waldman b,c, Farshid Guilak d,e,f, Thomas G Koch a,∗
PMCID: PMC9718125  PMID: 36475280

Abstract

Objective

To evaluate the effect of Transient Receptor Potential Vanilloid 4 (TRPV4) cation channel modulation on mesenchymal stromal cell (MSC)-derived neocartilage.

Methods

RT-PCR was performed to evaluate mRNA levels of chondrogenic, hypertrophic and candidate mechanoresponsive genes in equine neocartilage sheets exposed to pulses of the TRPV4 agonist (GSK101) at different concentrations (N ​= ​10). Biochemical assays and mechanical tests (double indentation and unconfined compression) evaluated neocartilage properties (N ​= ​5).

Results

GSK101 treatment (1 ​nM) increased ACAN levels after treatment for 1-h per day for 3 days. No increase was detected for hypertrophic markers RUNX2, MMP13, MMP1, ALP or COL10A1 at this concentration. This treatment regimen also increased sGAG content and enhanced compressive properties compared to untreated controls. GSK101 showed no effect on candidate mechanoresponsive genes at the time-point of analysis.

Conclusions

Chemical activation of TRPV4 signalling can be used as a strategy to enhance matrix synthesis and maturation of MSC-derived engineered neocartilage and augment its load-bearing capacity.

Keywords: TRPV4, Mesenchymal stromal cell, Neocartilage, Mechanical properties

1. Introduction

In vitro generated cartilage has been proposed as a potential treatment option for articular cartilage defects. However, tissue-engineered cartilage often suffers from inadequate biochemical and mechanical properties [1]. Chemical stimulation of mechanotransductive signalling can target chondrogenic and mechano-responsive pathways to enhance cartilage quality and function. Ion channels in chondrocytes have been identified to be key components of mechanotransduction. The Transient Receptor Potential Vanilloid 4 (TRPV4) is an osmo-mechanosensitive, Ca+ permeable cation channel, highly expressed in chondrocytes and has been shown to be sensitive to mechanical [2,3] and osmotic [4] stimuli.

There is evidence that activation of TRPV4 during in vitro chondrogenesis or tenogenesis upregulates ECM anabolic genes while decreases catabolic related genes [5,6]. Recently, it has been shown by gene array analysis that TRPV4 activation by either mechanical loading or a specific agonist causes a strong anabolic response in primary chondrocytes, which is accompanied by a transient, rapidly resolving inflammatory response that is associated with tissue regeneration [7]. Similarities in patterns of expression of TRPV4, ACAN and COL2A1 have been observed in MSCs, adipose derived stem-cells and induced pluripotent stem-cells (iPSCs) undergoing chondrogenesis [[8], [9], [10]].

As compressive and osmotic loading are widely recognized to maintain chondrogenesis and drive chondrocyte turnover in vitro [[11], [12], [13], [14]], the identification of mechanoresponsive genes that are regulated by TRPV4 signalling is of particular interest. The PKA-CREB (cAMP Responsive Element Binding protein) and PP2A (Protein Phosphatase 2A) pathways, have both been reported to regulate Sox 9 during in vitro chondrogenesis [15,16]. In addition, it has been reported that vinculin contributes to the mechanotransduction complex of integrins [17], and it has been implicated to regulate stem cell behaviour in response to ECM stiffness [18]. Moreover, vinculin mediates integrin assembly trough Crk-associated substrate within focal adhesion kinases (FAK) and modifies mechano-sensing dynamics between cell cytoskeleton and the ECM [19]. Thus, these findings suggest that CREB1, PP2A, FAK (PTK2) and vinculin (VCL) are candidate mechanoresponsive targets during TRPV4 chemical modulation.

We hypothesized that TRPV4 stimulation in equine neocartilage sheets would result in differential expression of chondrogenic, hypertrophic and candidate mechanoresponsive genes, as well as enhance its ECM deposition and mechanical properties. For this purpose, we investigated the effect of the TRPV4 agonist (GSK101) on tissue engineered cartilage sheets derived from equine umbilical cord blood mesenchymal stromal cells (eCB-MSC), when treated at different concentrations and times of exposure, and compared its effects to controls. We report that GSK101 (1 ​nM) enhances chondrogenic markers but increases hypertrophic markers at high concentration (10 ​nM). Furthermore, intermittent treatment for 3 days can increase the sGAG content and compressive properties of equine neocartilage in vitro.

2. Materials and methods

2.1. Experimental design

The mRNA levels (experiment a) and ECM content (experiment b) of eCB-neocartilage was examined after treatment with GSK101 (TRPV4 agonist) (1 ​nM or 10 ​nM), RN-1734 (TRPV4 antagonist) (10 ​μM) or 0.1% DMSO (vehicle control), during chondrogenic induction (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Experimental design. a) Approach for experiment to evaluate mRNA expression at different GSK101 concentrations. Treatments consisted in: 1 ​nM, 10 ​nM or vehicle control; b) Approach for experiment to evaluate effect of Transient Receptor Potential Vanilloid 4 (TRPV4) modulators at the extracellular matrix (ECM) level in neocartilage sheets. Treatments consisted in: GSK101 (1 ​nM), GSK101 (1 ​nM)+RN-1734 (10 ​μM), RN-1734 (10 ​μM), or vehicle control. All treatments were administered in pulses as described in the methods section.

Experiment a) Engineered cartilage (N ​= ​10) was exposed to treatment groups, beginning at day 7 post induction (dpi) for 1 ​h everyday for 3 days (pulses). Terminated at 10 dpi for mRNA analysis.

Experiment b) Engineered cartilage (N ​= ​5) was exposed to treatment groups, beginning at 7 dpi for 1 ​h everyday for 3 days (pulses). Terminated at 28 dpi for ECM analysis.

2.2. Equine MSC source and expansion

MSCs were isolated from equine umbilical cord blood samples as described previously [20]. For further cell expansion, cryopreserved vials were randomly chosen from a pool of 14 different foal donors, of which 11 donors (6 female, 5 male; 7 thoroughbreds, 4 warmbloods) were thawed and seeded in T175 flasks at a seeding density of 5000 ​cells/cm2 and cultured in expansion medium at 38 ​°C (normal horse temperature) in 21% O2, with complete medium changes every two days. When cultures reached 70%–80% confluency, cells were enzymatically harvested using 0.25% trypsin-EDTA and counted using an automated cell counter (Nucleocounter® NC100, Canada).

The MSC expansion medium was prepared with low glucose (1.0 ​g/L) Dulbecco's Modified Eagle's Medium (Wisent Bioproducts; Canada), 10% fetal bovine serum (Sigma-Aldrich; Canada), 10,000 U/ml penicillin-streptomycin (Sigma-Aldrich; Canada), 5000 U/ml l-glutamine (Sigma-Aldrich; Canada) and human fibroblast growth factor (1 ​ng/ml) (Sigma-Aldrich; Canada).

2.3. Chondrogenic differentiation

Cell culture inserts of 12 ​mm of diameter (Millipore; Canada) were placed into a 24-well plate and prepared for membrane culture by coating them in 100 ​μl of a 10% fibronectin (Sigma-Aldrich; Canada) solution suspended in expansion medium. Each membrane insert was dried overnight, UV sterilized for 1 ​h and incubated for 6 ​h at 38 ​°C, 21% O2. CB-MSCs at passage 5 were seeded at 2x10 [6] cells in a 400 ​μl suspension onto each membrane insert. An additional 600 ​μl of expansion medium was added to each well, surrounding the outside of the insert and incubated for 24 ​h at 38 ​°C, 21% O2. The following day, expansion medium was then changed to 1.5 ​mL of chondrogenic induction medium per well. Chondrogenic induction medium consisted of DMEM high glucose (4.5 ​g/L) (Wisent Bioproducts; Canada), ITS ​+ ​Premix (Corning; USA), 10 ​mg proline (Sigma-Aldrich; Canada), 100 ​nm dexamethasone (Sigma-Aldrich; Canada), 100 ​mM sodium pyruvate (Invitrogen; Canada), 200 ​mM GlutaMAX (Invitrogen; Canada), 100 ​μg/ml ascorbic acid (Sigma-Aldrich; Canada), and 10 ​ng/ml recombinant hTGFβ3 (R&D Systems; USA). 10 ​μM of Y-27632 ROCK inhibitor (Sigma-Aldrich; Canada) was added for the first 48 ​h of chondrogenic induction to prevent cell contraction.

2.4. Treatment with TRPV4 modulators

Neocartilage sheets were incubated for a total of 10 days or 28 days (experiments [a] or [b] respectively) at 38 ​°C in 21% O2, chondrogenic medium was changed every 2 days. Both TRPV4 agonist (GSK101; Calbiochem, USA) and antagonist (RN-1734; Calbiochem, USA) were reconstituted in DMSO according to instructions from the manufacturer.

For experiment [a], samples were divided and cultured in groups with chondrogenic medium containing either two different concentrations of GSK101 (1 ​nM and 10 ​nM) or DMSO as vehicle control (0.1%) administered at 7 dpi for 1 ​h for three days. Each treatment day, all cultures were carefully washed three times with 1.0 ​ml of warm PBS (38 ​°C) after treatment to remove any residue, then 1.5 ​ml of fresh chondrogenic induction medium (without GSK101 or DMSO) was poured into all wells. Cultures were terminated at 10 dpi.

For experiment [b]), groups were exposed to one of the following treatments: GSK101 (1 ​nM), GSK101 (1 ​nM) ​+ ​RN-1734 (10 ​μM), RN-1734 (10 ​μM) or DMSO (0.1%) added to chondrogenic medium. Treatments started at 7 dpi for 1 ​h for three days. After treatment, samples were washed with PBS and replaced with fresh medium as described above. Cultures continued growing past day 10 post-induction and were terminated at 28 dpi. Optimization of TRPV4 agonist concentrations and doses were tested in pilot experiments (Supplementary data S1–S3).

2.5. Histology and immunohistochemistry

Tissue engineered cartilage sheets were processed for histological staining as described previously [21]. Hematoxylin and eosin (H&E) and toluidine blue staining was used for visualization of overall tissue structure, and presence of glycosaminoglycan (GAG). Immunohistochemical staining (IHC) was performed using antibodies reactive with type-I or type-II collagen using mouse anti-type I collagen (Calbiochem, USA, Cat#CA60801-158) or mouse anti-type II collagen (Developmental Studies Hybridoma Bank, USA, Cat#II-II6B3). Immunoreactivity was detected using HRP-conjugated goat anti-mouse and DAB chromogen (DAKO; Canada) for color development, then counterstaining with hematoxylin [21].

2.6. Biochemistry

Engineered neocartilage sheets were digested in 40 ​μg/ml papain (Sigma-Aldrich; Canada) for 48 ​h at 65 ​°C and then frozen at −20 ​°C. Quantification of sGAG, DNA and hydroxyproline content was performed as previously described [21]. Briefly, sGAG content was determined by dimethylmethylene blue (DMMB) dye binding assay (absorbance at wavelength 525 ​nm). Chondroitin sulfate (Sigma-Aldrich; Canada) was used to generate a standard curve. For collagen content, digested samples were hydrolyzed with 6 ​N HCl at 110 ​°C for 18 ​h, then neutralized with NaOH. Samples and standards were incubated with 0.05 ​N chloramine T for 20 ​min at room temperature, then with 3.15 ​N perchloric acid for 5 ​min at RT and Ehlrich reagent for 20 ​min at 60 ​°C (absorbance at wavelength of 560 ​nm). A DNA quantitation kit (Sigma-Aldrich; Canada) was used to estimate DNA content through fluorometry with the bisbenzimide H dye (excitation 358 ​nm, emission 458 ​nm). Results for sGAG and collagen were normalized to DNA content. All measurements and standard curves were performed in triplicates using a SpectraMax™ i3 spectrophotometer.

2.7. mRNA expression

Neocartilage sheets were removed from their culture inserts, washed twice with 1X PBS, snap frozen in liquid nitrogen and stored at −80 ​°C. Tissues were pulverized in a Mixer Mill MM400 (Retsch; Germany) for 3 ​min at 30 ​Hz, then total RNA was extracted with RNAeasy minikit (QIAGEN; Canada) according to instructions from the manufacturer. Quantification of eluted RNA was determined by a Nanodrop 2000c spectrophotometer and purity assessed by ratio of absorbance at 260 nm/280 ​nm and 260 nm/230 ​nm. Isolates were treated with DNAse I (Invitrogen; Canada) and reversed transcribed using qScript cDNA Supermix (Bio-Rad; USA). Amplification of products by RT-qPCR was done using the SsoAdvancedTM SYBR green Supermix (Bio-Rad; USA) in a CFX96 Real-Time PCR detection system (Bio-Rad; USA) with a reaction volume of 10 ​μl. Previously used equine chondrogenic and hypertrophic markers were analysed for mRNA expression levels (Table 1), relative to reference genes 18s, B2M and RPLP0 [22]. Primer optimization, standard curves and determination of annealing temperature were obtained as described previously [21,22]. For candidate mechanoresponsive genes, design of primers for the genes CREB1, PP2A, PTK2 and VCL (Equus caballus) was performed with Primer-BLAST (NCBI RefSeq mRNA; Primer 3 ver.4.1.0). Custom oligos were purchased from Sigma-Aldrich (Canada). Melting curves and primer efficiencies for these genes were performed as described in (Supplementary data S6). Expression levels of mRNA were calculated with the 2−ΔΔCT method and fold change was normalized to mRNA levels in MSCs. Because some chondrogenesis specific genes were not detected in MSCs (Ct values: 35–40), a threshold value of Ct ​= ​35 was set for non-detects as well as all measurements above 35. This criterion was applied to reduce bias during analysis between different treatments [23].

Table 1.

List of primers used for quantitative polymerase chain reaction (qPCR) of chondrogenic, hypertrophic and candidate mechanoresponsive genes.

Gene Forward (5′-3′) Reverse (3′-5′) Reference
SOX9 ATCTGAAGAAGGAGAGCGAG TCAGAAGTCTCCAGAGCTTG Co et al., 2014 [21]
RUNX2 CCAAGTGGCAAGGTTCAACG AACTCTTGCCTCGTCCACTC Baird et al., 2018 [24]
ACAN GCGTGGCTGCTGTCCCCTTA CCCAGGGGCCTTCTGTGCTC Lepage et al., 2019 [22]
COL1A2 GAAAACATCCCAGCCAAGAA TGATGTTTTGAGAGGCATGG Co et al., 2014 [21]
COL2A1 GACAACCTGGCTCCCAAA ACAGTCTTGCCCCACTTAC Co et al., 2014 [21]
COL10A1 CTTGGTTCATGGCGAGTTTT GTCCAGGGCTTCCATAACCT Co et al., 2014 [21]
MMP13 GTCCCTGATGTGGGTGAATAC ACATCAGACCAAACTTTGAAGG Wang et al., 2014 [25]
MMP1 ATAACTACGATTCGGGGAGAAG TCTATGGGAAACCTCATAAGCA Wang et al., 2014 [25]
MMP3 CTTTTGATGGACCTGGAAAAGT GAGTGATAGAGACCCAGGGAAT Wang et al., 2014 [25]
18s GTAACCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG Chen et al., 2012 [26]
B2M CGGGCTACTCTCCCTGACT GTGACGTGAGTAAACCTGAACCTT Mienaltowski et al.,
2008 [27]
RPLP0 CTGATTACACCTTCCCACTTGCT AGCCACAAATGCAGATGGATCA Mienaltowski et al.,
2008 [27]
CREB1 TTGCCACATTAGCCCAGGTAT GGCCGCCTGAATAACTCCAT This work
PP2A GAAACCACGAAAGCCGACAAA TGGATGGAGAGAGACCACCG This work
PTK2 TCAACCCCAGGAAATCAGCC GGGCCATCTCAATCTCTCGG This work
VCL CCGAGTGATGCTGGTGAACT TCAGTGTCCTTCTTGCTGGC This work
Open in a new tab

2.8. Thickness measurement and double indentation

A double indentation protocol was used to extract mechanical properties [28,29] using a Mach-1™ mechanical tester (Biomomentum; Canada). This procedure was used to estimate the compressive modulus (E), shear modulus (G) and Poisson's ratio (v) of neocartilage sheets. For calculations of mechanical properties, the thickness (h) was first measured using a needle probe of one inch in length attached to the shaft. After contact, the needle was moved through the vertical axis into the tissue at a speed of 0.005 ​mm/s until a peak was registered by the Mach-1 (1 ​kg load-cell) Motion software. Thickness (h) was obtained from the minimum and maximum points from the resistance curve. Measurements of samples were repeated twice and corroborated with an electronic digital Vernier caliper. Double indentation tests were then carried out using two indenters of different sizes (0.92 ​mm and 1.38 ​mm). The first indenter made contact at which point the load was zeroed, and then proceeded with displacement of 5% of the sample thickness (h) with a velocity of 0.05 ​mm/s. The acquisition rate was set at 100 ​Hz. The slope was defined as the linear region of the curve, determined by linear regression. After a 5 ​min rest period, this same procedure was repeated using the second indenter. Curve fitting to theoretical curves from finite element model was performed to calculate the compressive modulus (E) and shear modulus (G) by adjusting the Poisson's ratio (v) [29]. Samples were kept moist by application of PBS to the tissue surfaces between measurements.

2.9. Equilibrium stress-strain properties

The equilibrium stress-strain protocol through a series of unconfined compressions was adapted from previous work [30,31]. The stress-strain curves from engineered constructs were obtained by displacement-controlled tests using a flat indenter after compression in 5 steps at sequential increments of 2% of thickness (h) for a total displacement of 10% of cartilage thickness (h). Recording of data was set with an acquisition rate of 100 ​Hz. Equilibrium was defined as a change in force less than 2 ​mN/min27. Stress at equilibrium was calculated from the applied load normalized by the cross-sectional area of the sample. Stress-strain curves were then obtained from the stress at equilibrium on each sequential step. The equilibrium modulus (Eeq) was then estimated from the entire slope of the stress-strain curves determined by linear regression [32].

2.10. Statistical analysis

Matched groups were considered for experimental design. One-way ANOVA with Dunnett's multiple comparisons was performed to determine differences in biochemical content among groups. For differences in mRNA expression levels, the normality of dataset was assessed with Shapiro-Wilk test (Supplementary data S5), then either ANOVA with Dunnett's multiple comparisons or Friedman's test with Dunn's multiple comparisons were used. Two-tailed paired t-test was used to assess differences in stress-strain curves. Significance was assigned at p ​< ​0.05. GraphPad Prism 6.02 was used for all analysis.

3. Results

3.1. GSK101 treatment affects mRNA levels of chondrogenic markers

The mRNA levels of the COL2A1 gene were lower in the group treated intermittently with GSK101 at 10 ​nM compared to the vehicle control group. The gene ACAN showed relative increase in the 1 ​nM group compared to controls, but no differences were observed for the 10 ​nM group. No differences were observed for the COL1A2 and SOX9 genes at the time-point of analysis (N ​= ​10) (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

mRNA expression of chondrogenic markers relative to mesenchymal stromal cells (MSCs) in neocartilage sheets, treated with GSK101 at different concentrations (1 ​nM or 10 ​nM) compared to vehicle controls (10 dpi). Treatment duration of 1 ​h for 3 days. Presented as mean ​± ​95% CI. N ​= ​10, p ​< ​0.05∗.

3.2. Hypertrophic markers and candidate mechanoresponsive genes

No relative differences were observed in mRNA levels of the genes RUNX2, COLXA1 or MMP13 after intermittent GSK101 treatment compared to controls. The gene MMP3 however, showed increased expression in the 1 ​nM group, while MMP1 showed increased levels at the 10 ​nM concentration compared to the DMSO group. Interestingly the levels of the gene for alkaline phosphatase (ALP) were lower in the group treated with GSK101 at 10 ​nM ​(N ​= ​10) (Fig. 3a). GSK101 treatment did not result in differences for the candidate mechanoresponsive genes CREB1, PTK2, PP2A or VCL at either 1 ​nM or 10 ​nM compared to DMSO controls at the time-point of analysis with the concentrations tested (N ​= ​10) (Fig. 3b).

Fig. 3.

Fig. 3

Open in a new tab

mRNA expression relative to mesenchymal stromal cells (MSCs) in neocartilage sheets treated with GSK101 at different concentrations (1 ​nM or 10 ​nM) compared to vehicle controls (0.1% DMSO) (10 dpi). Treatment duration of 1 ​h for 3 days. a) Hypertrophic markers; b) Candidate mechanoresponsive genes. Presented as mean ​± ​95% CI. N ​= ​10, p ​< ​0.05∗.

4. GSK101 treatment improves glycosaminoglycan deposition and mechanical properties of equine neocartilage sheets

4.1. Biochemical content

After exposing equine neocartilage sheets to pulsing treatment of either the TRPV4 agonist GSK101 (1 ​nM), antagonist RN-1734 or a combination of both, we analysed the content of total collagen and sGAG and compared it to DMSO vehicle controls. At the time-point of culture termination (28 dpi), quantification of total sGAG showed higher levels in the GSK101-treated group compared to vehicle controls. Similarly, the sGAG content (sGAG normalized to DNA) group treated with GSK101 had higher levels compared to the DMSO group. GSK101 treatment however, did not increase total collagen or normalized collagen content when compared to the DMSO group at the conditions here evaluated. The groups treated with the TRPV4 antagonist (RN-1734) and a combination of both modulators (agonist ​+ ​antagonist) showed no differences compared to the DMSO group for both sGAG and collagen content (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Effect of Transient Receptor Potential Vanilloid 4 (TRPV4) modulators (1 ​nM GSK101 and 10 ​μM RN-1734) on biochemical content of equine mesenchymal stromal cell (MSC)-derived cartilage sheets. Top panels: total collagen, sulfated glycosaminoglycan (sGAG) and DNA. Bottom panels: sGAG and collagen normalized to DNA content. Presented as mean ​± ​95% CI. N ​= ​5, p ​< ​0.05∗.

4.2. Histology

Toluidine blue revealed glycosaminoglycan presence in all treatment groups, however samples treated with GSK101 showed better distribution of both glycosaminoglycan and collagen as suggested by their uniform staining compared to other groups (Fig. 5). Type-I collagen presence was minor in all tissues, while type-II collagen showed lower intensity in the groups exposed to the antagonist (RN1734). Variations in tissue thicknesses and staining intensity were observed between donors and regardless of treatment group (supplementary data S4).

Fig. 5.

Fig. 5

Open in a new tab

Representative images of neocartilage sheets treated with Transient Receptor Potential Vanilloid 4 (TRPV4) modulators compared to vehicle controls. Images correspond to different technical replicates from the same MSC donor. Bar ​= ​200 ​μm.

4.3. Mechanical properties of equine neocartilage

Higher compressive modulus (E) and shear modulus (G) compared to vehicle controls were determined from double indentation tests. However, there was no difference on tissue thickness (h) or Poisson's ratio (v) (Table 2). Values of (v) for both groups were within the reported ranges for healthy articular cartilage in both human and horses [33,34]. Mechanical properties at equilibrium of neocartilage sheets treated with GSK101, revealed higher stress at equilibrium when submitted to stress-relaxation (2%–10% of sample thickness) compared to the control group (Fig. 6). Equilibrium modulus (entire slope) did not show differences between groups (Table 2).

Table 2.

Mechanical properties extracted by needle probe (h), double indentation (v, E and G) and unconfined stress-relaxation (equilibrium modulus) tests in tissues treated with GSK101 or vehicle dimethylsulfoxide (DMSO) control. All measurements were performed twice. Data presented as mean 95% CI [LL – UL]. N ​= ​5. Tissue thickness (h) p ​= ​0.9715, Poisson's ratio (v) p ​= ​0.2190, compressive modulus (E) p ​= ​0.0055, shear modulus (G) p ​= ​0.0049, equilibrium modulus (Eeq) p ​= ​0.9800.

Thickness (mm) Poisson's ratio (v) Compressive modulus (E) (MPa) Shear modulus (G) (MPa) Eq. modulus (kPa)
DMSO 0.72 [0.26–1.18] 0.117 [-0.021 – 0.2552] 0.32 [0.23–0.42]∗∗ 0.15 [0.09–0.20]∗∗ 1.85 [0.29–3.41]
GSK101 0.72 [0.38–1.06] 0.088 [-0.001 – 0.1783] 0.51 [0.37–0.65]∗∗ 0.24 [0.15–0.32]∗∗ 1.86 [0.39–3.34]
Open in a new tab

Fig. 6.

Fig. 6

Open in a new tab

Mechanical properties of equine mesenchymal stromal cell (MSC)-derived cartilage sheets. a) Stress-strain response of neocartilage treated with GSK101 (1 ​nM) compared to vehicle controls after unconfined compression at 2%–10% of the sample thickness (h); b) Average stress-strain curves of samples treated with GSK101 compared to vehicle controls. Presented as mean ​± ​95 CI. Two-tailed paired t-test, p ​< ​0.001∗∗∗, N ​= ​5, two replicates per group.

5. Discussion

In order to determine an effect of chemical activation of TRPV4 on neocartilage derived from equine umbilical cord-blood MSC, we evaluated the dose-response of engineered cartilage sheets treated at different concentrations of a TRPV4 agonist (GSK101) administered through chondrogenic induction medium. Our findings show that intermittent activation of TRPV4 using a chemical agonist can significantly increase the expression of chondrogenic genes, cartilage matrix accumulation, and enhancement of mechanical properties.

Based on the observations from preliminary experiments (Supplementary data S1–S3), shorter 1-h pulses of GSK101 were tested as treatment. From these, our results showed higher ACAN mRNA levels relative to MSCs in the 1 ​nM group, but no increase was observed for COL2A1 when compared to vehicle control (Fig. 2). This is contrary to reports by O'Connor and colleagues [5], where an increase of COL2A1 mRNA levels was observed in chondrocyte-laden constructs from porcine primary chondrocytes treated with the TRPV4 agonist, while the ACAN gene did not show difference to controls. One important difference to previous administration in cell-laden constructs [5] besides cell source (primary chondrocytes vs MSCs) and lack of fibronectin coating, is that agarose constructs may possess different diffusion, intake, and removal of bioactive molecules from chondrocytes compared to cartilage sheets being directly exposed to the treatment medium. Although, hydrogels provide better permeability than cell aggregates [35], it has been reported that concentration of solutes in 2% agarose hydrogels can take up to 3 ​h to achieve a concentration rate of 80% for 3 ​kDa molecules in free swelling conditions [36] (GSK101 has a molecular mass of ∼3.95 ​kDa), thus preventing overexposure to the agonist compared to scaffold-free cartilage sheets used in this study.

Indeed, Gilchrist and colleagues [6] adopted intermittent treatments when exposing monolayers of hMSC to TRPV4 modulators. The specific mechanism of TRPV4 enhancement regulation of aggrecan is not completely understood, but recent evidence suggests TRPV4 activation drives expression of SOX9 via Ca2+/calmodulin signalling, which interacts with the TGF-β3 pathway through JUN and SP1 transcription factors [37], which in turn regulates ACAN expression. On the other hand, intracellular TRPV4-dependant Ca2+ overload has been associated with activation of β-catenin downstream signalling through AKT activation [38], inhibiting proteoglycans [39] and cartilage ECM production in neocartilage. It is likely that long exposure to the TRPV4 agonist caused [Ca+]i overload, especially at the higher levels of concentration. It is clear then, that pulsing should be a preferred approach when exposing scaffold-free cartilage with a TRPV4 agonist.

With the exception of MMP3, none of the hypertrophic markers showed an increase when treated with GSK101 at the 1 ​nM concentration. Unlike initial higher levels of RUNX2 observed during preliminary evaluations of 3-h pulses (supplementary data S3), 1-h pulses did not result in a statistically significant increase of this marker (Fig. 3 (a)). Similarly, no increase was observed for ALP, COL10A1, MMP1 and MMP13 at this concentration. These results are consistent with reports that expression of MMP13 is regulated by overexpression of RUNX2, via inhibition of the MEK/ERK signalling pathway which blocks the MMP-13 promoter in chondrocytes [40]. Subsequently it has been reported that inhibition of MMP13 leads to inhibition of COL10A1 and reduces hypertrophy during chondrogenesis [41] while alkaline phosphatase (ALP) expression is result of activation of the SMAD 1-5-8 pathway through RUNX2 activity in MSCs [42,43].

MMP-3 an enzyme associated with connective tissue remodelling, has also been reported to cleave agrin, a proteoglycan that helps maintaining chondrocytic phenotype; and to reduce SOX9 transcription during the early stages of osteoarthritis [44]. It is possible that the increased levels of MMP3 observed in our neocartilage may had a negative effect on SOX9 transcription. Interestingly, the SOX9 mRNA levels reported in the study by O'conor et al. (2014) did not show higher levels than controls, further supporting this possibility. However confirmatory studies should address a potential role of TRPV4 channel activation and the effect of MMP3 over SOX9 transcription.

Curiously, the genes COL2A1, ALP and MMP1 showed differences to controls exclusively when treated in pulses at the 10 ​nM concentration. The former two genes resulted with lower relative mRNA levels to controls, while the latter showed higher levels at this concentration. Lower type-II collagen and higher matrix metalloproteinases suggest a detrimental effect to hyaline cartilage and a process towards the hypertrophic phenotype. In fact, MSCs exposed to 10 ​nM of TRPV4 agonist have been shown to upregulate osteopontin [45] and promote osteogenesis and bone formation mimicking the effect of oscillatory shear fluid forces over MSCs primary cilium [46].

For the effect of GSK101 pulses over CREB1, PP2A, PTK2 and VCL genes, we did not observe statistical differences at either 1 ​nM or 10 ​nM concentrations at the time-point of analysis, consistent with a recent study on primary chondrocytes [7]. Overexpression of CREB1 gene has been reported as result of mechanical load and Wnt/β-catenin signalling [47], it is possible that neocartilage treated with a TRPV4 agonist in combination with WNT3A would show effect on CREB1 mRNA levels. Although it has been shown that FAK and vinculin are implicated in mechanotransduction of forces to regulate integrin assembly after mechanical stimulus, the results obtained in this study do not support that GSK101 has an effect on this mechanism in equine neocartilage at the conditions we tested (Fig. 3 (b)).

For ECM analysis, our results show higher sGAG content (total GAG and normalized to DNA) in the group treated with GSK101 pulses (1 ​nM) compared the DMSO group, which is consistent with reports on constructs from porcine primary chondrocytes [5]. This increase was inhibited by the addition of the TRPV4 antagonist (RN-1734), supporting the specific role of TRPV4 in this process. The group treated with the antagonist alone did not present differences compared to vehicle controls (Fig. 4). We did not observe however, differences in collagen content in either group at the time-point of analysis. It is possible that collagen content had been affected by MMPs activity at the point of biochemical analysis (28 dpi) as we observed higher mRNA levels of the MMP3 gene from expression analysis at 10 dpi in our experiment.

Previous engineered constructs from primary chondrocytes treated with a TRPV4 agonist show uniform distribution of both proteoglycans and type-II collagen after 4 weeks of culture when compared to untreated constructs [5]. The appearance of our neocartilage sheets also suggest better distribution of proteoglycans and type-II collagen in the GSK101 group compared to controls. Interestingly, donors producing samples with lower thicknesses seemed to have higher staining intensity and better distribution compared to thicker samples. These features show donor to donor variations and additional observations should be done before a definitive conclusion can be stated for the effects on tissue morphology of GSK101 treated neocartilage sheets (supplementary data S4).

The compressive modulus (E), shear modulus (G) and compressive properties at equilibrium (stress-strain at 10%) were enhanced in the group treated with pulses of 1 ​nM GSK101 (Fig. 6). In other studies, the instantaneous response (such as Young's modulus) of scaffold-free tissue engineered cartilage, has been successfully enhanced by a variety of strategies including dynamic compressive load, shear forces, oxygen tension and signalling by small molecules [[48], [49], [50]]. Properties at equilibrium however, are also necessary to address due to the anisotropic characteristic of cartilage and are essential descriptors of the load-bearing capacity of articular cartilage [51]. The increase in mechanical properties in our neocartilage sheets after GSK101 treatment was modest (1.6-fold), compared to results reported for primary chondrocytes (2.5-fold) [5]. Perhaps the lack of significant increase in collagen content may account for a lower increase in (E) in our study, compared to observations in the primary chondrocyte study. Indeed, several studies have shown that increased collagen deposition results in higher Young's modulus and tensile properties, while increased GAG content promotes higher compressive properties at equilibrium [52,53]. There was no difference in the Poisson's ratio (v) between groups treated with the TRPV4 agonist and the control group (Table 2), this could be explained by the lack of effect on collagen content within our neocartilage sheets.

In summary, the results here indicate that intermittent chemical activation of TRPV4 for 1 ​h for 3 days through administration of GSK101 (1 ​nM) into chondrogenic induction medium in culture, can improve biochemical and mechanical properties of equine neocartilage sheets; however, the treatment conditions evaluated in this study did not result in improvements in collagen deposition at this early time point. Although the increase in mechanical properties was modest, chemical enhancement can represent an adjuvant to other strategies such as mechanical stimulation for functional tissue engineering of hyaline-like neocartilage with abundant presence of GAG and type-II collagen and low presence of type-I collagen (fibrocartilage). Recently characterized double-layered MSC-derived osteochondral constructs [54] show comparable mechanical properties than those of non-weight bearing regions of the joint. The combinatory approach of enhancing such osteochondral construct with TRPV4 stimulation seems a promising strategy for achieving properties similar to native benchmarks. Promoting type-II collagen deposition and cartilage zonal distribution resembling native articular cartilage, followed by large animal preclinical studies are recommended before translating this approach into human trials.

Our study was limited by the lack of protein analysis in our treatment groups and the use of static culture to grow our neocartilage sheets. Future work should include next-generation sequencing of MSC-derived neocartilage treated with TRPV4 modulators and dynamic compressive load.

6. Conclusion

Our results indicate that chemical activation of the TRPV4 channel can be used to enhance chondrogenesis of eCB neocartilage sheets. Intermittent treatment with the agonist (GSK101) at 1 ​nM concentration for 1 ​h for 3 days was enough to increase ACAN gene mRNA levels, sGAG content and mechanical properties of neocartilage sheets compared to untreated controls. Treatment with this agonist can be used as a strategy to prime engineered constructs and augment their load bearing capacity for their use as replacement therapies of focal cartilage defects. However, longer exposure times to this TRPV4 agonist has a detrimental effect particularly at higher concentrations, on eCB neocartilage sheets as demonstrated by lower levels of COL2A1 and overexpression of hypertrophic markers in those conditions. Finally, there was no evidence that the candidate mechanoresponsive genes evaluated in this study responded to GSK101 treatment alone in equine neocartilage at the time of analysis.

Author's contributions

C. Lopez-Jimenez: Conception and design; collection, assembly, analysis, and interpretation of data; drafting of the article. L. Chiu: Collection and assembly of data; technical support. S. Waldman: Analysis and interpretation of data; provisions of materials. F. Guilak: Critical revision of the article. T. Koch: Conception and design; obtaining of funding; final approval of the article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Equine Guelph and Partners (Koch, EG-2014-13; Canada), NSERC Discovery Grant (Koch, RGPIN-2014-04587; Canada), CIHR Project Grant (Koch, 437182, Canada). Cristobal Lopez-Jimenez received support from CONACyT (Scholarship #440060; Mexico). Farshid Guilak received support from the National Institutes of Health (AG15768, AG46927, AR072999 and P30 Core Centers AR074992 and AR073752; USA).

Role of funding sources

The sponsors were not involved in the writing and publication of this article.

Ethical approval

Guidelines by the University of Guelph Animal Care Committee were closely followed with regard to the procurement of research materials:

Collection of equine umbilical cord blood do not require an approved animal care utilization protocol since it is done non-invasively from the placenta after foaling and hence falls under CCAC Category of Invasiveness A. Additional research conducted using specimens of this kind does not require review by the Animal Care Committee (falls under CCAC Category of Invasiveness A). Collection of cord blood were add-on procedures to the routine care of the horses. No animals were sacrificed during the study. Informed consent was obtained in writing from the horse owners/agents before sampling. The broodmares on the foaling farms are housed in large foaling boxes. The foaling facilities are staffed 24/7 and mares are under constant video surveillance and carrying foaling alarms to allow for observed foaling and assisted delivery if needed. Umbilical cord blood was collected by the farm staff after receiving instruction by Dr. Koch. Instruction included video-review of cord blood collection. Cord blood was collected from an isolated segment of the umbilical cord after the umbilical cord had been clamped and detached from the foal.

Declaration of competing interest

Thomas Koch is the founder, CEO and CSO of eQcell Inc, ON, Canada. Farshid Guilak is a shareholder and employee of Cytex Therapeutics, Inc. The remaining authors declare no potential conflict of interests with respect to the research, authorship, and/or publication of this article.

Acknowledgements

The authors would like to thank Cameron Young for his help with pilot experiments, Jing Zhang for her support with primer efficiencies, Gabrielle Monteith for guidance with statistical analysis and Jodi Morrison for supporting with histological staining.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.ocarto.2022.100263.

Contributor Information

Cristóbal López-Jiménez, Email: lopezjic@uoguelph.ca.

Thomas G. Koch, Email: tkoch@uoguelph.ca.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Multimedia component 1
mmc1.pdf (95.1KB, pdf)
Multimedia component 2
mmc2.pdf (104.9KB, pdf)
Multimedia component 3
mmc3.pdf (97.1KB, pdf)
Multimedia component 4
mmc4.pdf (185.9KB, pdf)
Multimedia component 5
mmc5.pdf (68.3KB, pdf)
Multimedia component 6
mmc6.pdf (304.8KB, pdf)

References

  • 1.Kock L., Van Donkelaar C.C., Ito K. Tissue engineering of functional articular cartilage: the current status. Cell Tissue Res. 2012;347(3):613–627. doi: 10.1007/s00441-011-1243-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Phan M.N., Leddy H.A., Votta B.J., et al. Functional characterization of TRPV4 as an osmotically sensitive ion channel in porcine articular chondrocytes. Arthritis Rheum. 2009;60(10):3028–3037. doi: 10.1002/art.24799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liedtke W., Choe Y., Martí-Renom M.A., et al. Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor. Cell. 2000;103(3):525–535. doi: 10.1016/S0092-8674(00)00143-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liedtke W., Tobin D.M., Bargmann C.I., Friedman J.M. Mammalian TRPV4 (VR-OAC) directs behavioral responses to osmotic and mechanical stimuli in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 2003;100(24):14531–14536. doi: 10.1073/pnas.2235619100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.O'Conor C.J., Leddy H.A., Benefield H.C., Liedtke W.B., Guilak F. TRPV4-mediated mechanotransduction regulates the metabolic response of chondrocytes to dynamic loading. Proc. Natl. Acad. Sci. Unit. States Am. 2014;111(4):1316–1321. doi: 10.1073/pnas.1319569111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gilchrist C.L., Leddy H.A., Kaye L., et al. TRPV4-mediated calcium signaling in mesenchymal stem cells regulates aligned collagen matrix formation and vinculin tension. Proc. Natl. Acad. Sci. U. S. A. 2019;116(6):1992–1997. doi: 10.1073/pnas.1811095116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Nims R.J., Pferdehirt L., Ho N.B., et al. A synthetic mechanogenetic gene circuit for autonomous drug delivery in engineered tissues. Sci. Adv. 2021;7(5) doi: 10.1126/sciadv.abd9858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Huynh N.P.T., Zhang B., Guilak F. High-depth transcriptomic profiling reveals the temporal gene signature of human mesenchymal stem cells during chondrogenesis. Faseb. J. 2019;33(1):358–372. doi: 10.1096/fj.201800534R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Katz D.B., Huynh N.P.T., Savadipour A., Palte I., Guilak F. An immortalized human adipose-derived stem cell line with highly enhanced chondrogenic properties. Biochem. Biophys. Res. Commun. 2020;530(1):252–258. doi: 10.1016/j.bbrc.2020.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Adkar S.S., Wu C., Willard V.P., et al. Step-wise chondrogenesis of human induced pluripotent stem cells and purification via a reporter allele generated by CRISPR-cas9 genome editing. Stem Cell. 2019;37(1):65–76. doi: 10.1002/stem.2931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Démarteau O., Wendt D., Braccini A., et al. Dynamic compression of cartilage constructs engineered from expanded human articular chondrocytes. Biochem. Biophys. Res. Commun. 2003;310(2):580–588. doi: 10.1016/j.bbrc.2003.09.099. [DOI] [PubMed] [Google Scholar]
  • 12.Elder S.H., Goldstein S.A., Kimura J.H., Soslowsky L.J., Spengler D.M. Chondrocyte differentiation is modulated by frequency and duration of cyclic compressive loading. Ann. Biomed. Eng. 2001;29(6):476–482. doi: 10.1114/1.1376696. [DOI] [PubMed] [Google Scholar]
  • 13.Mauck R.L., Soltz M.A., Wang C.C.B., et al. Functional tissue engineering of articular cartilage through dynamic loading of chondrocyte-seeded agarose gels. J. Biomech. Eng. 2000;122(3):252–260. doi: 10.1115/1.429656. [DOI] [PubMed] [Google Scholar]
  • 14.Negoro K., Kobayashi S., Takeno K., Uchida K., Baba H. Effect of osmolarity on glycosaminoglycan production and cell metabolism of articular chondrocyte under three-dimensional culture system. Clin. Exp. Rheumatol. 2008;26(4):534–541. [PubMed] [Google Scholar]
  • 15.Piera-Velazquez S., Hawkins D.F., Whitecavage M.K., Colter D.C., Stokes D.G., Jimenez S.A. Regulation of the human SOX9 promoter by Sp1 and CREB. Exp. Cell Res. 2007;313(6):1069–1079. doi: 10.1016/j.yexcr.2007.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zákány R., Szucs K., É Bakó, et al. Protein phosphatase 2A is involved in the regulation of protein kinase a signaling pathway during in vitro chondrogenesis. Exp. Cell Res. 2002;275(1):1–8. doi: 10.1006/excr.2002.5487. [DOI] [PubMed] [Google Scholar]
  • 17.Dufour S., Mège R.M., Thiery J.P. α-catenin, vinculin, and F-actin in strengthening E-cadherin cell-cell adhesions and mechanosensing. Cell Adhes. Migrat. 2013;7(4):345–350. doi: 10.4161/cam.25139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Holle A.W., Tang X., Vijayraghavan D., et al. In situ mechanotransduction via vinculin regulates stem cell differentiation. Stem Cell. 2013;31(11):2467–2477. doi: 10.1002/stem.1490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Janoštiak R., Brábek J., Auernheimer V., et al. CAS directly interacts with vinculin to control mechanosensing and focal adhesion dynamics. Cell. Mol. Life Sci. 2014;71(4):727–744. doi: 10.1007/s00018-013-1450-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lepage S.I.M., Lee O.J., Koch T.G. Equine cord blood mesenchymal stromal cells have greater differentiation and similar immunosuppressive potential to cord tissue mesenchymal stromal cells. Stem Cell. Dev. 2019;28(3):227–237. doi: 10.1089/scd.2018.0135. [DOI] [PubMed] [Google Scholar]
  • 21.Co C., Vickaryous M.K., Koch T.G. Membrane culture and reduced oxygen tension enhances cartilage matrix formation from equine cord blood mesenchymal stromal cells invitro. Osteoarthritis Cartilage. 2014;22(3):472–480. doi: 10.1016/j.joca.2013.12.021. [DOI] [PubMed] [Google Scholar]
  • 22.Lepage S.I.M., Sharma R., Dukoff D., Stalker L., LaMarre J., Koch T.G. Cartilage; 2019. Gene Expression Profile Is Different between Intact and Enzymatically Digested Equine Articular Cartilage; pp. 1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.McCall M.N., McMurray H.R., Land H., Almudevar A. On non-detects in qPCR data. Bioinformatics. 2014;30(16):2310–2316. doi: 10.1093/bioinformatics/btu239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Baird A., Lindsay T., Everett A., et al. Osteoblast differentiation of equine induced pluripotent stem cells. Biol Open. 2018;7(5):1–7. doi: 10.1242/bio.033514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang L., Pawlak E.A., Johnson P.J., Belknap J.K., Alfandari D., Black S.J. Expression and activity of collagenases in the digital laminae of horses with carbohydrate overload-induced acute laminitis. J. Vet. Intern. Med. 2014;28(1):215–222. doi: 10.1111/jvim.12252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen Y.S., Pelekanos R.A., Ellis R.L., Horne R., Wolvetang E.J., Fisk N.M. Small molecule mesengenic induction of human induced pluripotent stem cells to generate mesenchymal stem/stromal cells. Stem Cell. Transl. Med. 2012;1(2):83–95. doi: 10.5966/sctm.2011-0022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mienaltowski M.J., Huang L., Stromberg A.J., MacLeod J.N. Differential gene expression associated with postnatal equine articular cartilage maturation. BMC Muscoskel. Disord. 2008;9 doi: 10.1186/1471-2474-9-149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hayes W.C., Keer L.M., Herrmann G., Mockros L.F. A mathematical analysis for indentation tests of articular cartilage. J. Biomech. 1972;5(5):541–551. doi: 10.1016/0021-9290(72)90010-3. [DOI] [PubMed] [Google Scholar]
  • 29.Jin H., Lewis J.L. Determination of Poisson's ratio of articular cartilage by indentation using different-sized indenters. J. Biomech. Eng. 2004;126(2):138–145. doi: 10.1115/1.1688772. [DOI] [PubMed] [Google Scholar]
  • 30.Waldman S.D., Grynpas M.D., Pilliar R.M., Kandel R.A. Characterization of cartilagenous tissue formed on calcium polyphosphate substrates in vitro. J. Biomed. Mater. Res. 2002;62(3):323–330. doi: 10.1002/jbm.10235. [DOI] [PubMed] [Google Scholar]
  • 31.Waldman S.D., Spiteri C.G., Grynpas M.D., Pilliar R.M., Hong J., Kandel R.A. Effect of biomechanical conditioning on cartilaginous tissue formation in vitro. J Bone Jt Surg - Ser A. 2003;85(SUPPL. 1):101–105. doi: 10.2106/00004623-200300002-00013. [DOI] [PubMed] [Google Scholar]
  • 32.DiSilvestro M.R., Zhu Q., Suh J.F. Biphasic poroviscoelastic simulation of the unconfined compression of articular cartilage: II—effect of variable strain rates. J. Biomech. Eng. 2001;123(2):198–200. doi: 10.1115/1.1351887. [DOI] [PubMed] [Google Scholar]
  • 33.Athanasiou K.A., Rosenwasser M.P., Buckwalter J.A., Malinin T.I., Mow V.C. Interspecies comparisons of in situ intrinsic mechanical properties of distal femoral cartilage. J. Orthop. Res. 1991;9(3):330–340. doi: 10.1002/jor.1100090304. [DOI] [PubMed] [Google Scholar]
  • 34.Palmer J.L., Bertone A.L., Mansour J., Carter B.G., Malemud C.J. Biomechanical properties of third carpal articular cartilage in exercised and nonexercised horses. J. Orthop. Res. 1995;13(6):854–860. doi: 10.1002/jor.1100130608. [DOI] [PubMed] [Google Scholar]
  • 35.Ozbolat I.T. Scaffold-based or scaffold-free bioprinting: competing or complementing approaches? J. Nanotechnol. Eng. Med. 2015;6(2):1–6. doi: 10.1115/1.4030414. [DOI] [Google Scholar]
  • 36.Chahine N.O., Albro M.B., Lima E.G., et al. Effect of dynamic loading on the transport of solutes into agarose hydrogels. Biophys. J. 2009;97(4):968–975. doi: 10.1016/j.bpj.2009.05.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Woods S., Humphreys P.A., Bates N., et al. Regulation of tgfβ signalling by trpv4 in chondrocytes. Cells. 2021;10(4) doi: 10.3390/cells10040726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Xie R., Xu J., Xiao Y., et al. Calcium promotes human gastric cancer via a novel coupling of calcium-sensing receptor and TRPV4 channel. Cancer Res. 2017;77(23):6499–6512. doi: 10.1158/0008-5472.CAN-17-0360. [DOI] [PubMed] [Google Scholar]
  • 39.Praxenthaler H., Krämer E., Weisser M., et al. Extracellular matrix content and WNT/β-catenin levels of cartilage determine the chondrocyte response to compressive load. Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 2018;1864(3):851–859. doi: 10.1016/j.bbadis.2017.12.024. [DOI] [PubMed] [Google Scholar]
  • 40.Wang X., Manner P.A., Horner A., Shum L., Tuan R.S., Nuckolls G.H. Regulation of MMP-13 expression by RUNX2 and FGF2 in osteoarthritic cartilage. Osteoarthritis Cartilage. 2004;12(12):963–973. doi: 10.1016/j.joca.2004.08.008. [DOI] [PubMed] [Google Scholar]
  • 41.Jahangir S., Eglin D., Pötter N., et al. Inhibition of hypertrophy and improving chondrocyte differentiation by MMP-13 inhibitor small molecule encapsulated in alginate-chondroitin sulfate-platelet lysate hydrogel. Stem Cell Res. Ther. 2020;11(1):1–17. doi: 10.1186/s13287-020-01930-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu D., Ge K., Sun J., Chen S., Jia G., Zhang J. Lanthanum breaks the balance between osteogenesis and adipogenesis of mesenchymal stem cells through phosphorylation of Smad1/5/8. RSC Adv. 2015;5(53):42233–42241. doi: 10.1039/c5ra02311d. [DOI] [Google Scholar]
  • 43.Hellingman C.A., Davidson E.N.B., Koevoet W., et al. Smad signaling determines chondrogenic differentiation of bone-marrow-derived mesenchymal stem cells: inhibition of smad1/5/8P prevents terminal differentiation and calcification. Tissue Eng. 2011;17(7–8):1157–1167. doi: 10.1089/ten.tea.2010.0043. [DOI] [PubMed] [Google Scholar]
  • 44.Eldridge S., Nalesso G., Ismail H., et al. Agrin mediates chondrocyte homeostasis and requires both LRP4 and α-dystroglycan to enhance cartilage formation in vitro and in vivo. Ann. Rheum. Dis. 2016;75(6):1228–1235. doi: 10.1136/annrheumdis-2015-207316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Corrigan M.A., Johnson G.P., Stavenschi E., Riffault M., Labour M.N., Hoey D.A. TRPV4-mediates oscillatory fluid shear mechanotransduction in mesenchymal stem cells in part via the primary cilium. Sci. Rep. 2018;8(1):1–13. doi: 10.1038/s41598-018-22174-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Stavenschi E., Labour M.N., Hoey D.A. Oscillatory fluid flow induces the osteogenic lineage commitment of mesenchymal stem cells: the effect of shear stress magnitude, frequency, and duration. J. Biomech. 2017;55:99–106. doi: 10.1016/j.jbiomech.2017.02.002. [DOI] [PubMed] [Google Scholar]
  • 47.Xuan F., Yano F., Mori D., et al. Wnt/β-catenin signaling contributes to articular cartilage homeostasis through lubricin induction in the superficial zone. Arthritis Res. Ther. 2019;21(1):1–11. doi: 10.1186/s13075-019-2041-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nazempour A., Quisenberry C.R., Van Wie B.J., Abu-Lail N.I. Nanomechanics of engineered articular cartilage: synergistic influences of transforming growth factor-β3 and oscillating pressure. J. Nanosci. Nanotechnol. 2016;16(3):3136–3145. doi: 10.1166/jnn.2016.12564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Waldman S.D., Spiteri C.G., Grynpas M.D., Pilliar R.M., Kandel R.A. Long-term intermittent shear deformation improves the quality of cartilaginous tissue formed in vitro. J. Orthop. Res. 2003;21(4):590–596. doi: 10.1016/S0736-0266(03)00009-3. [DOI] [PubMed] [Google Scholar]
  • 50.Yodmuang S., Gadjanski I., Chao P.G., Vunjak-Novakovic G. Transient hypoxia improves matrix properties in tissue engineered cartilage. J. Orthop. Res. 2013;31(4):544–553. doi: 10.1002/jor.22275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Sophia Fox A.J., Bedi A., Rodeo S.A. The basic science of articular cartilage: structure, composition, and function. Sport Health. 2009;1(6):461–468. doi: 10.1177/1941738109350438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Haudenschild A.K., Sherlock B.E., Zhou X., et al. Nondestructive fluorescence lifetime imaging and time-resolved fluorescence spectroscopy detect cartilage matrix depletion and correlate with mechanical properties. Eur. Cell. Mater. 2018;36:30–43. doi: 10.22203/eCM.v036a03. [DOI] [PubMed] [Google Scholar]
  • 53.Han G., Boz U., Eriten M., Henak C.R. Glycosaminoglycan depletion increases energy dissipation in articular cartilage under high-frequency loading. J. Mech. Behav. Biomed. Mater. 2020;110:103876. doi: 10.1016/j.jmbbm.2020.103876. December 2019. [DOI] [PubMed] [Google Scholar]
  • 54.López-Jiménez C., Lepage S.I.M., et al. Generation of double-layered equine mesenchymal stromal cell-derived osteochondral constructs. J. Cartilage Joint Preserv. 2022;2(1) doi: 10.1016/j.jcjp.2021.100036. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.pdf (95.1KB, pdf)
Multimedia component 2
mmc2.pdf (104.9KB, pdf)
Multimedia component 3
mmc3.pdf (97.1KB, pdf)
Multimedia component 4
mmc4.pdf (185.9KB, pdf)
Multimedia component 5
mmc5.pdf (68.3KB, pdf)
Multimedia component 6
mmc6.pdf (304.8KB, pdf)

Articles from Osteoarthritis and Cartilage Open are provided here courtesy of Elsevier

RESOURCES