Abstract
The mechanisms triggering metastasis in pheochromocytoma/paraganglioma are unknown, hindering therapeutic options for patients with metastatic tumors (mPPGL). Herein we show by genomic profiling of a large cohort of mPPGLs that high mutational load, microsatellite instability and somatic copy-number alteration burden are associated with ATRX/TERT alterations and are suitable prognostic markers. Transcriptomic analysis defines the signaling networks involved in the acquisition of metastatic competence and establishes a gene signature related to mPPGLs, highlighting CDK1 as an additional mPPGL marker. Immunogenomics accompanied by immunohistochemistry identifies a heterogeneous ecosystem at the tumor microenvironment level, linked to the genomic subtype and tumor behavior. Specifically, we define a general immunosuppressive microenvironment in mPPGLs, the exception being PD-L1 expressing MAML3-related tumors. Our study reveals canonical markers for risk of metastasis, and suggests the usefulness of including immune parameters in clinical management for PPGL prognostication and identification of patients who might benefit from immunotherapy.
Subject terms: Cancer genomics, Neuroendocrine cancer, Prognostic markers, Adrenal gland diseases
The molecular mechanisms underlying metastasis in pheochromocytoma/paraganglioma (mPPGL) remain to be explored. Here, the authors perform genomic and immunogenomic profiling of mPPGL tumors and suggest potential biomarkers for risk of metastasis and immunotherapy response.
Introduction
Pheochromocytomas and paragangliomas (PPGLs) are rare and highly heterogeneous neuroendocrine tumors, associated with mutations in one of the at least 20 driver genes related to the disease1. Up to 20% of PPGLs are metastatic (mPPGLs), with a heterogeneous 5-year overall survival rate that ranges from 40 to 77%2. Although some genotype-phenotype correlations have been defined for patients with PPGLs, disease management remains challenging due to a variable clinical behavior, lack of accurate markers of metastasis risk and inefficient therapeutic standards for metastatic stage3,4. Moreover, a poor understanding of the underlying mechanisms driving metastasis hinders the development of an efficient therapeutic strategy for mPPGLs.
The genomic landscape of PPGLs has been poorly described and little is known about the role that secondary events play in the progression of the disease. So far, only two large-scale multi-omic studies reporting the genomic characteristics of PPGLs have been published5,6. These studies established the molecular classification of PPGLs in three genomic subtypes: pseudohypoxic, kinase signaling, and Wnt-altered. However, these previous studies included few metastatic cases. Moreover, the tumor microenvironment (TME) has been shown to play a major role in the prognosis and therapeutic stratification of other tumor types7. However, the TME remains largely unexplored in PPGLs and may be pivotal for therapy success.
In this large-scale study, we performed a comprehensive characterization of the genomic landscape of mPPGLs and interrogated the immune compartment of these tumors. We compared the results from our series, enriched in metastatic cases, with the TCGA PPGL cohort5, which is mainly composed of non-metastatic tumors. Using this strategy, we defined the mutational architecture of mPPGL, identified transcriptional alterations linked to metastasis-related processes, proposed prognostic markers, and outlined the immune infiltration profile in PPGL.
Results
We performed genomic profiling of 156 PPGLs from 128 unrelated patients: whole-exome sequencing (WES) in 87 paired germline–tumor samples and RNA sequencing (RNA-Seq) in 114 tumor samples (hereinafter, CNIO cohort; Fig. 1a; Supplementary Table 1). Seventy-five of these patients had metastatic disease, detected at initial diagnosis or during follow-up, and accounted for 99 metastatic samples included in the study (either primary tumors, relapses or metastases). We also included in the study data of 175 PPGLs from 174 unrelated patients from the PPGL TCGA project: WES data from 174 paired germline–tumor samples and RNA-Seq data from 150 tumors (from now on, TCGA cohort). By a comprehensive analysis of these data, we deciphered the mutational, copy number alteration (CNA), transcriptomic and immune landscapes of mPPGLs (Fig. 1b). Tumors were classified according to their genotype/ transcriptional profile into the previously defined PPGL genomic subtypes5.
Mutational landscape of metastatic pheochromocytoma and paraganglioma
We identified somatic single-nucleotide variations (SNVs) and small insertions/deletions (INDELs) in 87 paired germline-tumor samples with available WES data (mean depth of 105×; 12 tumors from 11 patients were discarded due to poor quality; see methods section). Data from 169 TCGA patients (174 samples) were added for the analyses (Supplementary Fig. 1). To note, for 20 patients (16 from CNIO cohort and 4 from TCGA cohort), we had available more than one tumor sequenced by WES (range, 2–7).
WES data analysis revealed 5618 somatic variants across 261 samples. From those, 3641 had a variant allele frequency (VAF) > 10% and 2227 were missense, 140 truncating, 127 affected start/stop codons, 52 in-frame deletions or insertions, 66 altered canonical splice sites, and 1029 were classified as ‘other’ (including synonymous variants); 3.2% of the variants were classified as high impact consequence variants and affected cancer genes (from COSMIC Cancer Gene Census or OncoKB).
WES data was used to calculate the tumor mutational burden (TMB) and microsatellite instability (MSI) scores of each tumor (Fig. 2a). The TMB (based on true-somatic coding events with VAF > 0.1; category 5 in Supplementary Fig. 2) varied between cases, with a median of 11 (range, 0–142), in agreement with previous PPGL studies5,6,8,9, and much lower than in other cancer types10. Two of the PPGL studies suggested an association between higher TMB and metastatic behavior5,9. In this study, we confirmed this observation and also detected that TMB increased from non-metastatic primary tumors (median number of variants: 8; range 2–25) to primaries of mPPGLs (17.5; 1–54) to metastases (24; 0–142) (Fig. 2b). We also observed a significantly different TMB among genomic subtypes, with the Wnt-altered subtype having the highest values, regardless of tumor behavior (Supplementary Fig. 3a, b). Although there is scarce information about MSI in PPGLs11–13, it is known that MSI contributes to the tumorigenic hypermutated phenotype in other cancer types14. In our study, we observed differences in the MSI score according to the clinical behavior (non-metastatic tumors median: 0.13, range 0.11–0.18; primary metastatic tumors: 0.16, range 0.10–0.22; and metastases median: 0.18, range 0.11–0.25) (Fig. 2c). Moreover, the MSI score and the TMB exhibited a moderately significant correlation (Fig. 2d), indicating that the higher TMB observed in metastatic tumors could be linked to a higher MSI status. Both features were associated with risk of metastasis development in univariate and multivariate analyses (including as covariates sex, mutations in Krebs cycle susceptibility genes15 and ATRX/TERT alterations), suggesting they are independent predictors of metastatic risk (Table 1).
Table 1.
Risk of metastasis development | Time to progression | |||
---|---|---|---|---|
Characteristics | Univariate OR (95% CI), P | Multivariate OR (95% CI), P | Univariate HR (95% CI), P | Multivariate HR (95% CI), P |
Female | 0.58 (0.30–1.08), 0.089 | 0.49 (0.15–1.54), 0.229 | 0.55 (0.31–0.97), 0.040 | 0.69 (0.36–1.34), 0.271 |
Krebs cycle gene mutation | 8.24 (3.55–20.13), 1.5e−6 | 14.05 (3.42–64.82), 3.6e−4 | 2.19 (1.14–4.20), 0.018 | 1.54 (0.76–3.14), 0.232 |
ATRX /TERT-alt | 9.10 (4.44–19.23), 3.1e−9 | 3.40 (0.78–15.41), 0.104 | 5.21 (2.90–9.36), 3.3e−8 | 1.83 (0.89–3.75), 0.102 |
High MSI score | 68.25 (25.36–222.21), 9.7e−15 | 88.35 (23.29–448.89), 1.7e−9 | 11.44 (6.06–21.58), 5.5e−14 | 6.05 (2.89–12.65), 1.7e−6 |
Mutational burden | 1.16 (1.11–1.23), 1.1e–9 | 1.14 (1.06–1.25), 0.001 | 1.08 (1.06–1.10), 1.5e−12 | 1.03 (1.00–1.05), 0.059 |
Multivariate analysis includes: sex, mutations in C1A cluster, alterations in ATRX and TERT, MSI score (as dichotomous variable established by MSI median value: 0 – MSI score < 0.15 and 1 – MSI score > 0.15) and TMB as covariates. Only data from primary tumors from non-metastatic and metastatic patients was included. To assess the degree of collinearity between our chosen explanatory variables, we ensured that the variance inflation factor (VIF) of each of them for the logistic regression was <2 (sex: 1.02; C1A cluster: 1.15; ATRX/TERT alterations: 1.5; MSI (>0.15): 1.14; TMB: 1.55).
To note, both higher TMB and MSI score were also associated with a shorter time to progression (TTP) (Table 1; Fig. 2e, f; Supplementary Fig. 3c). In agreement, we observed a significantly higher TMB in larger tumors, and in those with >5% Ki67 positive cells and high MKI67 expression levels (Fig. 2g–i); no association was detected between the MSI score and the tumor volume or the % of Ki67 positive cells (Supplementary Fig. 3d, e), probably due to the low number of tumors included in this analysis, but a significant association between the MSI score and the MKI67 expression levels was identified (Supplementary Fig. 3f).
TMB in PPGLs also correlated with the age of the patients at surgery (Fig. 2j), feature that has already been shown for many cancers16. In fact, it has been described that the age-dependent increase in somatic variants that occurs naturally in tissues, increases the probability of mutating driver genes, making cancer a disease of ageing17.
Without considering the 10 main somatic PPGL gene drivers represented in our cohort (HRAS, FGFR1, CSDE1, MAML3, IDH1, RET, VHL, NF1, MAX, and EPAS1), ATRX was found mutated in the tumors of 3.4% patients (Supplementary Table 2) and was established as the only gene significantly mutated in metastatic tumors (Fisher’s test, P = 2.9 × 10−4), as previously reported8. Since TERT has been linked to mPPGL18, we also explored TERT alterations (overexpression, amplification, promoter mutations and hypermethylation; see methods section) in a subset of cases, and confirmed that TERT alterations are events associated with mPPGLs (Supplementary Fig. 3g; Fisher’s test, P = 8.4 × 10−7). We validated that ATRX and TERT alterations accumulate mainly in SDHB/FH pseudohypoxic tumors19, but also found a high frequency of these events in Wnt-altered tumors (Fig. 2k). Moreover, ATRX/TERT-altered samples presented higher TMB and MSI score than non-altered ones (Fig. 2l, m), a significantly higher MIK67 expression (Supplementary Fig. 3h) and a tendency to higher Ki67 positive cells and bigger tumors (Supplementary Fig. 3i, j).
Somatic copy-number alteration profile in metastatic pheochromocytoma and paraganglioma
We analyzed the somatic CNA (SCNA) profiles of the CNIO and TCGA cohorts applying FACETS to the germline-tumor matched WES data (Fig. 3a). Higher SCNA burden, measured by the number of SCNA events, was observed in more aggressive tumors (Fig. 3b), with metastatic samples (primaries and metastases from metastatic patients) exhibiting the highest number of SCNA events (median: 15, range: 1–48 and median: 29, range: 5–65, respectively) in comparison to non-metastatic tumors (median: 8, range: 0–41). In addition, a tendency towards shorter time to progression was observed in patients with tumors with high SCNA burden (Supplementary Fig. 4a). Similarly to the TMB, SCNA burden was also higher in ATRX/TERT-altered tumors (Fig. 3c). However, in the case of SCNA burden, no major differences were observed between tumors of different genomic subtypes (Supplementary Fig. 4b).
Genome doubling was observed in 14.5% of primary metastatic tumors whereas only 5% of the non-metastatic tumors duplicated their whole genome (P = 0.023, two-tailed Fisher test). Contrary to that reported by Fishbein et al.5, this tendency was not linked to its genomic subtype (P = 0.38, two-tailed Freeman–Halton test).
The most frequent (>25% of all tumors) arm-level deletions affected 1p, 3p, 3q, 11p, 11q, 17p, 22p, and 22q chromosome arms. Arm-level chromosome gains were less common, mostly involving 1q and 7p, as previously reported for PPGLs6. Specifically, we observed 1p loss and 1q gain in SDHB tumors; 3p, 4q and the whole chromosome 11 loss in VHL-; 6q loss in HRAS-; chromosome 17 loss in NF1-related tumors. Whole chromosome gains were also detected, chromosome 4 in MAML3- and chromosome 10 in RET-cases. Although 11p deletion is a common event in PPGLs, this SCNA was not observed in tumors harboring oncogenic HRAS mutations (FDR < 0.05). As already shown5,6, SDHB-, VHL- and NF1-related tumors deleted genomic regions where their specific locus is placed (1p, 3p, and 17q, respectively). MAML3- and RET-related tumors also exhibited gains in chromosomes 4 and 10, comprising MAML3 and RET, respectively.
We identified four altered arm-level SCNA differing between metastatic and non-metastatic primary tumors (Fig. 3a). These included gains in 1q, 5p, and 5q, and deletion of 3q. Whole chromosome 5 gain was also associated with shorter TTP (Fig. 3d), finding which is in line with the fact that TERT is located at 5p15.33. This association remained statistically significant after multivariate Cox hazard regression analysis using sex, mutations in Krebs cycle susceptibility genes, TMB and MSI score as covariates (HR = 2.56, 95% CI = 1.15–5.70, P = 0.021), indicating its independent prognostic value.
Transcriptomic landscape of metastatic pheochromocytoma and paraganglioma
We selected a signature of 26 genes differentially expressed between primary tumors of patients with and without metastatic disease (n = 54 and n = 176, respectively) and independent of genomic subtypes (Fig. 4a). After expression dichotomization and multivariate analysis using genomic subtype as a covariate, 25 out of the 26 genes were also associated with risk of metastasis (P < 0.005; Fig. 4b) and time to progression (P < 0.05; Fig. 4c). To validate these findings, we re-analyzed an independent cohort of PPGLs20 and confirmed a significant differential expression between the two groups for 17 of the 25 selected genes (Supplementary Fig. 5a), including 14 that demonstrated a value for stratifying patients according to metastatic risk (C5orf49, DNASE1L3, HMGB3, RRM2, CDT1, TTC9, CCNB2, IQGAP3, FAM83H, CDK1, PBK, NETO2, CSMD2 and PMAIP1) (Supplementary Fig. 5b). Functional enrichment analysis of this gene signature using STRING v1121 indicated a significant overrepresentation (PPI enrichment P = 3.08 × 10−7) of genes related to mitotic cell cycle, G1/S-specific transcription, p53 signaling and DNA damage response (Supplementary Fig. 5c). CDK1, the only gene included in the 4 enriched gene sets, displayed the most significant association with metastatic risk in a combined analysis that included both cohorts (OR = 9.01, 95% CI = 5.17–15.71, P = 8.5 × 10−15; Supplementary Fig. 5d; Fig. 4d); furthermore, high expression of CDK1 showed a strong association with shorter TTP, regardless of the tumor genomic subtype (HR = 4.15, 95% CI = 2.32–7.24, P = 1.1 × 10−6; Fig. 4e). A multivariate Cox hazard regression analysis including the proposed prognostic molecular markers (chromosome 5 gain, higher TMB and MSI score) as covariates, pinpointed CDK1 high expression as an additional and independent indicator of prognosis (HR = 2.21, 95% CI = 1.11–4.79, P = 0.045). We also validated by immunohistochemistry (IHC) higher CDK1 protein levels in the nucleus of primary metastatic tumors (Fig. 4f), which were correlated with CDK1 gene expression (Supplementary Fig. 5e).
In order to identify altered processes in metastatic tumors, and not only specific genes, we performed a GSEA analysis comparing metastatic vs non-metastatic primary tumors (Fig. 4g; Supplementary Fig. 6). This analysis revealed a positive normalized enrichment score (NES > 1.85; FDR < 0.05) not only in gene sets involved in cell cycle, DNA repair and p53 pathway, but also in those related to extracellular matrix (ECM) organization, translation/ ribosomes, ubiquitin/ proteasomes, and motility; this indicates that genes belonging to these categories are mainly upregulated in metastatic primary tumors. In contrast, gene networks associated with cilium formation, ion transport, Rho-GTPases, adhesion, nervous system (NS) development/ neuron projection and immune response displayed negative NES (NES < −1.85; FDR < 0.05), illustrating a downregulation of genes in these categories in metastatic primary tumors. Cilia loss and Rho pathway deregulation have already been reported in PPGLs9,22,23, reinforcing the importance of these signaling networks in PPGL malignant transformation. Signaling cascades related to the immune system and deregulated in metastatic vs non-metastatic primary tumors (Fig. 4h; Supplementary Fig. 6o) included multiple sets involved in innate and adaptive immunity, cytokine secretion and inflammation that had not previously been associated with mPPGLs.
Metastasis risk classifier for pheochromocytoma and paraganglioma
We evaluated the classification power of the potential markers of mPPGL described in this study: high MSI score, high TMB, gain of chr 5 and high CDK1 expression. We also aimed to assess their power in combination with the already described markers of mPPGL (germline mutation in Krebs cycle genes, MAML3-fusion, TERT-alt, ATRX-mutation and high MKI67 expression5,8,15,19,24). The area under the receiver operating characteristic curves (AUC under ROC) of each event individually and all combinations possible (n = 511) were computed. The AUC, 95% confidence interval (CI) and sensitivity/specificity per each classifier are in Supplementary Data 1. The best classifier is the one that takes into account ATRX-mutations, high MSI score, high CDK1 expression and MAML3-fusions, showing a 100% sensitivity with the highest ability to predict mPPGL (AUC = 0.902, 95%CI = 0.855–0.948) (Supplementary Fig. 7).
Functional enrichment analysis of mutated and CN-altered genes in metastatic pheochromocytoma and paraganglioma
Panther tool25 was applied to detect significantly enriched gene sets among the list of genes with high impact consequence mutations in primary tumors from metastatic patients, and significantly differing focal SCNA between non-metastatic and metastatic primary tumors. The list of high impact mutated genes comprised 323 genes that grouped into 52 significantly enriched processes (fold-enrichment>1.8 and FDR < 0.05) classified into five different functional annotations: circulatory system development/morphogenesis, ECM organization, cell adhesion and motility, actin cytoskeleton, and NS development and neuron projection (Supplementary Fig. 8a). Focal SCNA significantly differing between non-metastatic and metastatic primary tumors and resulting in altered gene expression was present in 911 genes (see methods section). After applying a functional enrichment analysis using the 911 gene list, we recognized 120 significantly enriched gene sets (fold-enrichment>1.8 and FDR < 0.05) (Supplementary Fig. 9a).
Given the availability of RNA-Seq data, we executed GSEA with the 52 and 120 sets that resulted from the previous analysis in order to elucidate which categories were affected at the mRNA expression level. The analysis performed with the mutated gene sets (52) revealed differential expression (comparing metastatic vs non-metastatic primary tumors) of genes involved in five described functional annotations (Supplementary Fig. 8b), three of which were more relevant at the transcriptional level (>30% of sets of particular annotation with FDR < 0.05 in the GSEA analysis): ECM organization, cell adhesion and motility, and NS development and neuron projection (Fig. 5a). Notably, ECM and adhesion (Supplementary Fig. 6l, m) are terms classically linked to tumor progression and metastasis26,27. The weaker relative activity towards neuron differentiation (Supplementary Fig. 6k) may indicate a dedifferentiated neuronal-like phenotype in mPPGLs. This feature could be related to a neuroendocrine-to-mesenchymal transition associated with aggressive traits28–30.
SCNA analysis identified gene sets enriched in mPPGLs, 98 exhibiting statistically significant differences between non-metastatic and metastatic primary tumors (Supplementary Fig. 9b; Fig. 5b). These could be classified into 5 different functional annotations: translation and ribosomes, DNA repair and TP53 pathway, splicing, cell cycle and chromatin regulation and ubiquitin and proteasome. Ribosome biogenesis has been reported to be essential for tumorigenesis and sufficient to drive malignant transformation31. Ribosome biogenesis, by preventing p53 ubiquitination and degradation32,33, is also linked to the cell cycle34. Moreover, hyperactive rDNA transcription leads to DNA damage and genome instability, activating DNA damage responses31, that could also explain the higher TMB, MSI score and SCNA burden observed in mPPGLs (Figs. 2, 3).
Therefore, integration of transcriptomic and genomic data (mutations and SCNA), suggests causal mechanisms underlying 7 out of the 15 functional annotations deregulated at the transcriptional level (Fig. 4g).
Immune landscape of metastatic pheochromocytoma and paraganglioma
Using a combination of gene expression analyses and IHC scoring with a set of immune markers, we characterized the immune infiltration profile of each tumor. First, we used the data generated by Thorsson et al.35 for the TCGA cohort and applied the CRI-iAtlas/ImmuneSubtypeClassifier R package to classify the tumors from the CNIO series according to the available RNA-Seq data; from this, we established the distribution of the six immune subtypes described by Thorsson et al. (C1–C6) across our collection (with 0.38% tumors in C1, 48.66% in C3, 45.21% in C4, and 5.75% in C5). C3 (inflammatory) and C4 (lymphocyte depleted) were the predominant immune subtypes in PPGLs, but interestingly they were represented differently according to tumor type; C3 was more abundant in non-metastatic tumors (52.3%), whereas C4 showed more prevalence among primary metastatic tumors and metastases (50.9 and 71.4%, respectively) (Fig. 6a). In addition, different proportions were also observed among genomic subtypes: C3 was more abundant in the pseudohypoxic subtype (72.2%), while C4 was more frequent in the kinase signaling subtype (67.6%). Of note, regardless of genomic subtype, more metastatic primary tumors and metastases were classified as C4 (P < 1 × 10−4), and those patients with tumors categorized as C4 seemed to have a shorter TTP than those classified as C3 (Supplementary Fig. 10a).
Next, we used the immune score, extracted by ESTIMATE36, to evaluate the presence of immune cells in the tumors using RNA-Seq data. Although we did not observe different infiltration levels between the different tumor types (Supplementary Fig. 10b), we discovered substantial variations in the proportion of immune cells extracted by deconvolution of the RNA-Seq data using CIBERSORTx37 (Fig. 6b). We observed a significantly higher number of resting and lower number of activated CD4+ T cells, lower proportion of CD8+ T cells, and a higher number of resting and lower quantity of activated NK cells in metastatic primaries compared to non-metastatic tumors. The lower levels of CD8+ T cells in metastatic tumors was validated by IHC (Fig. 6c). The suppression of activated T cells is supported by the GSEA analysis with 24 terms related to activation/differentiation/proliferation identified among the negative NES (Fig. 4h; Supplementary Fig. 6o, blue arrows). This notion was reinforced by the differences between non-metastatic and metastatic primary tumors found in the functional gene expression signatures (Fges) enrichment scores, calculated by GSVA as in Bagaev et al.38, related to effector cell traffic and NK cells (Fig. 6d, top panel). We also noted a higher representation of macrophages M2-like, known by their anti-inflammatory and pro-tumoral role39, in metastatic primary tumors. This is in agreement with the observation that a higher proportion of metastatic tumors were classified into C4 subtype, characterized by high M2-like macrophage response35.
Several gene sets (n = 9) related to interferon signaling also had negative NES in the GSEA analysis (Fig. 4h; Supplementary Fig. 6o, green arrows), and a significantly lower Th1 signature- and anti-tumor cytokines-, and higher pro-tumor cytokines-Fges scores were found in metastatic primary tumors (Fig. 6d, top panel), both supporting the immunosuppressive microenvironment encountered in the metastatic primary tumors. These differences increased when metastases were incorporated into the analysis (Supplementary Fig. 10c). Other cytokines with anti-tumor immunity properties, such as TNF, IL6, IL2, and IL140, were also identified by the GSEA analysis (Fig. 4h; Supplementary Fig. 6o, purple arrows).
Interestingly, lower NK cells-, effector cell traffic-, Th1 signature- and antitumor cytokines-Fges scores were associated with risk of metastasis development (multivariate analysis adjusting for genomic subtype; Fig. 6d, middle panel), suggesting that TME is independent of genotype.
The latter Fges scores were also associated with TTP (Fig. 6d, bottom panel). We also found that some infiltrating immune cell types estimated with CIBERSORTx were significantly associated with TTP; high levels of resting and low levels of activated NK cells were associated with shorter TTP (Fig. 6e; Supplementary Fig. 10d). Similarly, high levels of regulatory T cells (Tregs) were also associated with shorter TTP.
Immunogenomics as a theranostic tool in the immunotherapy contexture of metastatic pheochromocytoma and paraganglioma
Bagaev et al. recently proposed four Fges-based pan-cancer microenvironment subtypes that correlate with patient response to immunotherapy in multiple cancers38. To classify our tumors according to their TME, we applied k-means clustering using the 29 Fges scores. We defined four TME subtypes in our cohort (Fig. 7a); among these, the immune-enriched non-fibrotic was the least represented (14.3% of the cases), and the subtype with fewer metastatic tumors (Supplementary Fig. 11a) and with better prognosis (Fig. 7b). TME subtypes were strongly correlated with the ImmuneScore and StromalScore, obtained from ESTIMATE36, and predicted levels of infiltrating immune and stromal cells, respectively (P = 4 × 10−38 and 5.4 × 10−44, Krustal–Wallis test) (Fig. 7a). We also observed a trend towards TME subtypes being associated to neoantigen load and TMB (Supplementary Fig. 11b, c). TME subtype proportions also differed between immune subtypes (Supplementary Fig. 11d) and PPGL genomic subtypes (Supplementary Fig. 11e). The pseudohypoxic cluster was mainly enriched in the fibrotic subtype, characterized by high vascularity and an immunosuppressive phenotype38 as recently reported by Celada et al.41; in contrast, the kinase signaling cluster was highly represented in the immune-enriched non-fibrotic subtype, reflecting the influence of the genomic subtypes on TME. These differences were also evident when comparing Fges scores between genomic subtypes (Supplementary Fig. 11f). We observed higher representation of a Th1 signature and checkpoint molecules in the kinase signaling tumors, and the pseudohypoxic tumors were characterized by higher signature Fges scores related to angiogenesis and fibrosis (cancer-associated fibroblasts, matrix remodeling, endothelium), as already reported42,43.
In order to further explore the immunophenotyping of patients with mPPGL, we examined the expression of key immunomodulators (IMs) targeted in clinical oncology by several IM agonists and antagonists44. Gene expression of IMs (Fig. 7c; Supplementary Fig. 12a) varied between metastatic and non-metastatic tumors and across genomic subtypes, possibly suggestive of their role in delineating the immune infiltration of the tumors. Genes with the greatest differences (P < 0.01) between metastatic and non-metastatic tumors were CD274, CD276, TGFB1, VEGFA, CD40 and TLR4. CD274, which encodes for programmed death-ligand 1 (PD-L1), showed the lowest levels in pseudohypoxic tumors and the highest in Wnt-altered subtype, including several metastatic MAML3-tumors. PD-L1 IHC in an independent series of n = 44 PPGLs (Supplementary Table 3) confirmed that 34% (15/44) of PPGLs, 7 harboring a MAML3-fusion, exhibit PD-L1 staining in tumor cell membranes. These represented 100% of MAML3-tumors included in the series and, with the exception of one SDHB tumor, were the only tumors exhibiting highly positive PD-L1 staining (Fig. 7d); no association was observed according to clinical behavior (Supplementary Fig. 12b). A higher neoantigen load was also observed in MAML3-tumors compared to all other tumors (MWW test: P = 0.0067; Fig. 7e).
Given the differences observed in the aforementioned key immune players, further investigation is needed in order to elucidate the differences in terms of immune infiltrates between the tumors classified in the different genomic subtypes. We observed differences between molecular clusters according to Fge scores, immune and TME classifications (Supplementary Fig. 10c, d; Fig. 6a), and, as anticipated, we also noticed differences according to relative levels of some immune cell types among genomic subtypes (Supplementary Fig. 13, top). One difference was the greater infiltration of CD8+ T cells in MAML3-tumors (Fig. 7f). On the other hand, we show that metastatic tumors present a similar pattern in the proportion of major classes of immune cells across the different genomic subtypes (Supplementary Fig. 13, bottom), reinforcing the notion that some immune cell populations may be partially linked to the molecular genomic subtype, but others to the tumor behavior.
Discussion
The comprehensive genomic analysis of mPPGL described here highlights not only the heterogeneous landscape of secondary genomic alterations, but also the presence of shared TME features within genomic subtypes and/or according to tumor behavior.
In this study, we reveal that TMB, MSI status and SCNA burden of PPGLs increase with disease progression, suggesting their use as markers of metastatic risk at diagnosis of a primary tumor. We confirm differential TMB in PPGLs as previously reported5,9, and report the association between changes in MSI status and clinical behavior of PPGLs. Although we did not identify any PPGL tumor surpassing the cutoff value used for MSI-high classification in tumors with high TMB10,13, we propose that MSI thresholds may not be applied similarly to tumors with lower TMB, such as for PPGL or acute myeloid leukemia45,46. Frequent gain of chromosomal material had previously been observed in mPPGL47, but here we have linked an increased SCNA burden to mPPGL, mimicking observations in other tumors48. Importantly, TMB, MSI status and SCNA burden were associated with ATRX/TERT alterations, reinforcing the notion that alterations in immortalization-related genes contribute to genomic instability49. In fact, different copy number signatures could underlie this heterogeneous genomic instability, as reported for ovarian cancer50.
ATRX/TERT alterations are validated as the only recurrent secondary prognostic-associated events identified in PPGLs, accumulating not only in pseudohypoxic tumors8,19,51,52, but also in Wnt-altered tumors. These findings bolster the concept that alterations contributing to immortalization mechanisms are those that confer a poor prognosis for patients with PPGL. Except for ATRX mutations, TERT alterations and chromosome 5 gains, no other genetic alterations could be identified as metastasis priming events. Therefore, and even though PPGL tumor formation is clearly driven by germline or somatic mutations, our data suggest that the molecular switches involved in metastatic progression are likely variable and may involve non-genetic events. However, of course, future efforts should also be directed towards performing WGS to capture potential alterations in non-coding regions or large rearrangements53.
At the transcriptional level, we identified elevated CDK1 as a prognostic factor that, independently of genomic subtype, adds to the higher TMB, higher MSI score and chromosome 5 gains just described herein. Moreover, given that CDK1 is indispensable for driving the cell cycle54, and because the cell cycle is one of the major deregulated signaling networks in mPPGLs (described herein and recently by Zethoven et al.55), there may be potential for developing CDK1-specific inhibitors for treatment56.
Given what has been reported to date57, it will be difficult to identify a single molecular marker capable of accurately predicting the metastatic behavior of these tumors. Therefore, it is of particular interest that our study describes a classifier that takes into account only 4 events (ATRX-mutations, high MSI score, high CDK1 expression and MAML3-fusions) and achieves a sensitivity of 100%. Although further validation will be necessary, we have defined a classifier that could identify all patients at risk of metastasis at the time of diagnosis of the primary tumor.
The immune contexture is being evaluated as a prognostic tool in many tumor types58, but little has been reported in PPGLs41,55,59,60. Here, we identified a high number of downregulated gene sets related to the immune response. By interrogating the immune content, we also showed a complex and heterogeneous ecosystem at the TME level, characterized by the presence of CD8+ T cells, NK cells and a Th1 profile; this was associated with a good clinical outcome, as expected, due to their anti-tumor immune characteristics61. Additionally, we identified an association between high levels of macrophages M2 and Tregs, both cell types known by their anti-inflammatory and pro-tumoral role39,62, and metastatic behavior and poorer prognosis. The excessive catecholamine levels present in metastatic tumors could contribute to the establishment of the immunosuppressive TME63, by diminishing T and NK cell activation64 and by driving the M1- to M2-like macrophage polarization65. Our data demonstrate the potential usefulness of including immune parameters as prognostic classification tools for PPGL.
Cancer immunotherapy is in the spotlight for the treatment of numerous cancers and the TME is known to be important for tumor progression and anti-cancer therapeutic responses66. Therefore, it is possible that classification of PPGLs according to their TME subtype38 could help identify patients who might benefit from immunotherapeutic agents. We established that tumors with immune-enriched non-fibrotic subtype, showing an immune-active TME, exhibited the best prognosis and included mainly non-mPPGLs. In melanoma, bladder and gastric cancer, responders to immune checkpoint inhibitor have the highest proportion of immune-enriched non-fibrotic subtype38. However, what we observe in mPPGL is discouraging. Specifically, the fibrotic subtype, which in our cohort was enriched in mPPGLs, seems to be the least responsive to the aforementioned therapies38.
Strategies to individualize immunotherapy based on patient- and tumor-specific characteristics are a current focus of the scientific community67. With this in mind, we identified PD-L1 positivity, higher TMB and neoantigen load, and CD8+ T cell infiltration in MAML3-tumors compared to other PPGLs. This is noteworthy because all these traits are associated with improved responses to PD1 axis blockade in diverse tumors68,69; this suggests that PD-1/PD-L1 inhibitors may offer a potential treatment for patients with MAML3-tumors. Pembrolizumab, a PD-1 inhibitor displayed modest therapeutic efficacy in a clinical trial of mPPGLs70; although no association with genotype was observed, MAML3 status was not considered, so it remains possible that this could be used to stratify patients. This concept is supported by findings that gene fusions are a source of immunogenic neo-antigens that can mediate responses to immunotherapy, even with a low TMB and minimal immune infiltration71. Of relevance, it is known that WNT/β-catenin signaling, upregulated in MAML3-tumors5, correlates with immune exclusion72. The latter is caused by an increased PD-L1 transcription after MYC or β-catenin binding to its promoter73,74. Therefore, these observations suggest that WNT inhibitors may synergize with PD1 axis blockade in MAML3-tumors.
We could speculate that CD40 and TLR4 low expression identified in mPPGLs could pave the way to propose other approaches to expand the range of targetable immune checkpoints, as in situ vaccination with double CD40-TLR4 stimulation75 to turn “cold tumors” into “hot tumors” and restore PD-1 sensitivity. Notably, CD40 and/or various TLR agonists, currently in clinical trials, have recently been tested in a PPGL mouse model with promising results76.
The notion that the tumor immune portrait is orchestrated by the genomic subtype and that is modulated by the tumor behavior is supported by reported examples that show (i) a link between tumor genotype and immunological architecture, and (ii) the dynamic state of TME during tumor progression77.
In summary, this study serves as a valuable resource for future investigations in the field of PPGL genomics due to the large series of tumors with WES and RNA-Seq data associated with pathological, IHC and curated clinical information. Moreover, the present report contributes with significant data to advance the genomic and immune understanding of mPPGLs, and thereby potentially increase the therapeutic strategies needed for a bench-to-bedside clinical success.
Methods
Sample cohort and clinical data
All PPGL tumor tissues and patient’s germline samples were obtained from patients with informed written consent for this purpose, in accordance with institutional ethical-approved protocols. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the following Ethics Committees: Hospital Universitario 12 de Octubre (15/024), Madrid, Spain; Universitäts Spital Zurich (2017-00771), Zurich, Switzerland; Klinikum der Universität (379-10), Munich, Germany; University of Würzburg (88/11), Würzburg, Germany; Azienda Ospedaliera Universitaria Careggi (Prot. N. 2011/0020149), Florence, Italy; Berlin Chamber of Physicians (Eth-S-R/14), Berlin, Germany; Radboud University Medical Center (9803-0060), Nijmegen, The Netherlands; TU Dresden (EK210052017 and EK189062010), Dresden, Germany. Clinical characteristics are provided in Supplementary Tables 1 and 3. Demographic and clinical data included sex, age at initial pathologic diagnosis, age at tumor surgery, tumor type (PGL, PCC, multiple), number of follow-up days for non-metastatic patients/ event free days until metastasis for patients with metastases, and location of metastasis. Histological annotated data, when available, included tumor volume, presence of capsular/ adipose tissue/ vascular invasion, and Ki67 index. Metastatic disease was defined as the occurrence of distant metastases in anatomical locations where chromaffin tissue is normally absent, as per WHO definition78. Aggressive disease was established when there was capsular or adipose tissue invasion, and vascular infiltration or evidences of multiple recurrences, without certainty of metastatic disease. Tumors that appear at the same place as the original primary after a period of time were tagged as “relapses”.
Tumor tissues and germline samples were collected from 73 patients for WES analysis. After discarding samples that failed different quality control steps, a final cohort of 87 tumors from 61 patients, sequenced using ‘SureSelect All Exon + COSMIC v6’ exome probes from Agilent, were available for analysis (Supplementary Fig. 1a). From 165 patients initially available for the RNA-Seq study, a final series of 114 samples from 105 patients profiled either using Illumina TruSeq or QuantSeq 3’mRNA-Seq (Lexogen) and that passed our pre-analysis criteria, were included in the study (Supplementary Fig. 1b). To note, we profiled 45 tumor samples with both WES and RNA-Seq. Moreover, we included 20 patients with more than one tumor sequenced by WES (range, 2–7), and 9 patients with more than one tumor profiled by RNA-Seq (range 2–3). To increase the power of our analyses and overcome the lack of non-metastatic patients included in our WES series, we joined our WES and RNA-Seq data with those from the TCGA. After our in-house quality control of the latter series, we gathered a total of 261 paired germline-tumor analyzed by WES and 264 tumors profiled by RNA-Seq (Supplementary Fig. 1). Clinical data from patients included in the TCGA series was extracted from ref. 5.
The WES series was composed of 62 primary tumors and 5 relapses from metastatic patients, 25 metastases, 8 primary tumors from patients with aggressive disease and 158 primary tumors from non-metastatic patients (Supplementary Fig. 1a). The RNA-Seq series was composed of 55 primary tumors and 4 relapses from metastatic patients, 16 metastases, 15 tumors from patients with aggressive disease and 176 tumors from non-metastatic patients (Supplementary Fig. 1b).
The resulting series is representative of the main PPGL genotypes and equitable in number of samples from non-metastatic and metastatic patients. In the CNIO cohort, germline and somatic mutations in driver genes had previously been characterized using a NGS AmpliSeq Custom DNA Panel (Illumina, San Diego, CA, USA) as specified in79. MAML3 fusion positive tumors were detected either (1) on cDNA of suspected candidates using the following primers for the upstream UBTF portion of the fusion transcript: 5′-GGAGCAGCAAAAGCAGTACA-3′ and 5′-CCCAAACCCCAAATCCAG-3′; and 5′ TCTCCATTAAGTGGTGATCGAG 3′ for the downstream MAML3 portion, or (2) by fluorescence in situ hybridization (FISH) for MALM3 gene rearrangement analysis.
Nucleic acid extraction and quality control
Tumor specimens were collected either in formalin-fixed paraffin-embedded (FFPE) or fresh-frozen (FF), and tumor selection (>60% cancer cells) was performed by a pathologist (E. Caleiras) on hematoxylin and eosin-stained slides. DNA and RNA were isolated using commercially available kits according to manufacturer’s specifications. DNA from FFPE tissues was obtained with truXTRAC FFPE DNA (Covaris, 520136) and from FF tumors from DNeasy Blood and Tissue Kit (Qiagen, 69506). RNA from FFPE was extracted using Maxwell RSC RNA FFPE Kit (Promega, AS1440) and from FF with TRIzol Reagent (Invitrogen, 15596026). Germline DNA was extracted either from peripheral blood mononuclear cells using Maxwell RSC Whole Blood DNA Kit (Promega, AS1520) or from adjacent normal tissue using truXTRAC FFPE DNA (Covaris, 520136). DNA and RNA was quantified using Quantus Fluorometer (Promega) and integrity examined using a High Sensitivity DNA Kit (Agilent, 5067-4626) or a RNA 6000 Nano Kit (Agilent, 5067-1511) in a 2100 Bioanalyzer Instrument (Agilent). Samples with low quality DNA were dismissed.
WES
Library preparation and sequencing
Whole exome sequencing (WES) libraries were prepared with the SureSelectXT Human All Exon V6+ COSMIC target enrichment system (Agilent, 5190–9307) following the manufacturer’s instructions. 200 ng of genomic DNA from FFPE tumoral samples and 1 µg from FF or germline samples were used as starting material. SureSelectXT HS (Agilent, G9704A) and SureSelectXT2 (Agilent, G9621A) reagent kits were used for FFPE derived and good quality samples, respectively. DNAs were fragmented on a Covaris S2 sharing instrument based on initial DNA sample’s integrity. Fragmented DNA samples were processed through subsequent enzymatic treatments of end-repair, dA-tailing, and ligation to Illumina’s adapters. Adapter-ligated libraries were PCR amplified with Illumina PE primers and subsequently hybridized to SureSelect Oligo Capture Library Mix. Biotinylated hybrids were captured and the enriched fraction eluted. Libraries were completed by limited-cycle PCR with Illumina TruSeq primers and KAPA HiFi HotStart DNA pol (Roche KK2501). Sample-specific libraries were combined into equimolarly balanced pools and applied to Illumina flow cells for cluster generation. Sequencing was performed on either the Illumina HiSeq2500 or NovaSeq6000 in a paired-end 100 bp reads mode to a median target coverage of ~200× and ~100× for tumors and germline, respectively.
WES analysis
Exome sequencing data was processed and aligned to the human reference genome GRCh37 using Burrows-Wheeler Aligner (BWA)80. For single-nucleotide variant (SNV) and insertions/deletions (INDELs) identification, the Genome Analysis Toolkit GATK81 was used. Germline and somatic variants with higher allele frequency were detected with Haplotype Caller82 and additional somatic variants were detected with MuTect83 that was also incorporated to the pipeline to identify somatic variants with low allele fraction values. Variants were annotated using Ensembl Variant Effect Predictor tool (VEP)84 v90. For the analysis employing TCGA DNA sequencing data, whole exome mapped files (BAM files), aligned against GRCh38 version of human reference genome were downloaded from GDC Data Portal, NIH (https://portal.gdc.cancer.gov/).
Tumor purity was estimated using FACETS algorithm85, particularly the R package cnv-facets that allows the execution of all the necessary steps in a single command line call. GRCh37 and GRCh38 versions of human reference genome were used for our series and TCGA series, respectively. Only samples with tumor cellularity >12% (median, 70.5%; range 13–92.3%) were included for analysis.
Microsatellite instability (MSI) was calculated using the MANTIS algorithm86. Normal-tumor paired, aligned and processed BAM files, were used to calculate the differences of microsatellite distributions at somatic level.
SNVs and indels were manually curated following the workflow shown in Supplementary Fig 2a. Briefly, events that fell into any of these categories were removed:
Events annotated as: “intron_variant”, “downstream_gene_variant”, “3_prime_UTR_variant”, “upstream_gene_variant”, “NMD_transcript_variant”, “non_coding_transcript_variant”, “5_prime_UTR_variant”, “mature_miRNA_variant”.
Variants with minor allele frequency > 0.1 in gnomAD or/and 1000genomes (‘germline-like’).
Events visualized using IGV87 in other patient’s tumor WES and not appearing in their callings, or which appear in germlines of other patients were considered ‘artefacts’.
Events with variant allele fraction <0.1.
Variant impact consequence classification of the remaining events was applied as indicated in Supplementary Table 4.
For TCGA, WES data were extracted from 8 independent pipelines and the annotated files were obtained from UCSC Xena (accessed on Dec 3rd 2019). Data sets included SNPs and small INDELs detected after performing variant calling with MuSE, MuTect2, SomaticSniper and VarScan2 Variant Aggregation and Masking pipelines, as well as the calling generated by BCGSC (British Columbia Genome Sciences Centre, BCGSC pipeline), BCM (Baylor College of Medicine Human Genome Sequencing Center, Baylor pipeline), Broad (Broad Institute Genome Sequencing Center, MuTect pipeline) and UCSC (University of California Santa Cruz, RADIA pipeline). We generated a ‘consensus’ variant set including all those events called by at least two of the eight pipeline lists. The original TCGA coordinates in GRCh38 were converted to GRCh37 using the online tool LiftOver from UCSC (https://genome.ucsc.edu/cgi-bin/hgLiftOver). VEP84 v94 was used to predict the functional effects of the variants. SNVs and INDELs were manually curated following the same workflow used for CNIO WES data, shown in Supplementary Fig. 2b, except for the artefact filtering step.
Somatic copy number (CN) detection was performed with FACETS algorithm85, following the same analysis previously mentioned for purity estimation. Good fit of CN detection was evaluated with the diagnostic plot generated by the pipeline, and samples with poor fit were discarded from the analysis. For specific samples, regions with total CN value higher than 8, and regions with log-ratio values between −0.1 and 0.1 were discarded, except for regions annotated as neutral LOH. Total number of CN segments (defined as SCNA events) was calculated for each sample, and genes in each region were annotated using an in house R script based on biomaRt package88.
Identification of TERT alterations
TERT overexpression, TERT amplification, TERT promoter (TERTp) mutation and hypermethylation were taken into account in our analysis. When RNA-Seq data was not available, TERT overexpression was detected by four TERT gene expression probes included in a TruSeq Targeted custom panel (Illumina) that contained other 227 probes for 187 genes; only samples with an average value ≥4 counts were considered as positive for TERT expression. TERTp recurrent mutations (chr5:1295228C >T and chr5:1295250C >T) were studied using the 16S Metagenomic Sequencing Library Preparation (Illumina) protocol; only the C228T mutation was detected in our series. Amplicons of 151 bp for NGS were obtained from 50 ng of DNA tumor samples after two PCRs; Multiplex QIAGEN 2× Master Mix was used for the first PCR and EasyTaq DNA polymerase for the second. Mutations detected by NGS were validated using Sanger sequencing using forward and Reverse primers (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAGCGCTGCCTGAAACTCG-3′ and 5´- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTCCTGCCCCTTCACCTTC-3′).
TERTp hypermethylation was studied using 100 ng of bisulfite modified DNA (EZ-96 DNA methylation kit, Zymo research). Primers were chosen according to Castelo-Branco et al.89, obtaining four amplicons covering the TERTp region CpG islands, as known as TERT hypermethylated oncological region (THOR). A total number of 39 probes from the THOR region were studied, sharing 29 probes with the ones included by Castelo-Branco et al. Methylation status was determined by focusing mainly in the UTSS region (CpG probes: chr5_1295586_C; chr5_1295590_C; chr5_1295593_C; chr5_1295605_C; chr5_1295618_C). Only samples with a mean UTSS value ≥14.1 were considered as hypermethylated.
High-level amplifications of TERT, identified by using GISTIC 2.0 tool90 with a score = 2, were considered after data processing as described in Monteagudo, et al.79.
TERT overexpression and TERTp hypermethylation in TCGA samples were established as described by Barthel et al.91.
Impact of sequencing depth coverage—downsampling
To evaluate the impact of the sequencing depth on variant calling sensitivity between CNIO (median, 91.9×) and TCGA (median, 53.5x) WES series, we selected 10 random samples from the CNIO series, and BAM files were downsampled ≈50× average coverage (similar to the mean depth of the TCGA cohort). We then reran the same somatic variant calling pipeline to compare it to the variant calling performed with the original depth (Supplementary Fig. 14a). Decreasing coverage resulted in a median diminution in sensitivity of only 11.8% in the number of variants detected (Supplementary Fig. 14b), and a good agreement in tumor purity estimation (Supplementary Fig. 14c).
RNA-Seq
RNA-Seq Library preparation and sequencing
RNA library preparation of samples with RNA Integrity Number (RIN) > 5.5 (median 7.1; range 5.6–8.9) was performed as described in the TruSeq Stranded mRNA Library Prep Kit (Illumina, RS-122-2101). Briefly, 0.7–1 µg total RNA PolyA+ fraction was purified and randomly fragmented, converted to double stranded cDNA and processed through subsequent enzymatic treatments of end-repair, dA-tailing, and ligation to adapters. Adapter-ligated library was completed by PCR with Illumina PE primers. The resulting purified cDNA library was applied to an Illumina flow cell for cluster generation and sequenced on an Illumina HiSeq2500 on a 51 bp single-read format following manufacturer’s protocols.
cDNA libraries from FFPE tumors and low integrity RNA’s (RIN < 5.5) from FF tumors (median 2.4; range 1–5.5) but % of fragments > 200 nucleotides higher than 20% (median 57.5; range 20–96) were prepared using QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen, 015) with a UMI Second Strand Synthesis Module for QuantSeq FWD (Lexogen, 081), following the vendor’s protocol for low input/ low quality/ FFPE RNA. 200–500 ng of total RNA, according to availability, were used as starting material. PCR Add-on Kit for Illumina (Lexogen, 020) was used to adjust the library amplification number of cycles. Libraries were applied to an Illumina flow cell for cluster generation and sequenced on NovaSeq6000.
Image analysis, per-cycle basecalling and quality score assignment was performed with Illumina Real Time Analysis software. Demultiplexing of BCL files to FASTQ format was performed with the bcl2fastq Software (Illumina).
RNA-Seq analyses
HTSeq-Counts from CNIO series were generated with Nextpresso92 and BlueBee® Genomics Platform (Lexogen, 090-094), from FASTQ files obtained from TruSeq and QuantSeq platforms, respectively. QuantSeq FWD-UMI Data Analysis Pipeline was used specifically for libraries constructed using UMIs. TopHat v2.1.193 and STAR v2.5.2a94 algorithms were used to map the reads respectively to the reference genome GRCh37. RNA-Seq HTSeq-Counts for TCGA cohort were downloaded from UCSC Xena Browser (https://xenabrowser.net/).
HTSeq-counts from different platforms were integrated by common gene symbol collapsing by maximum expression value per gene within each platform. Normalized counts were used to infer tumor purity for each sample using the estimate score provided by ESTIMATE algorithm v1.0.1336. Samples failing quality control (e.g., low number of reads) or with ESTIMATE score greater than 5900 were excluded. Batch effects due to the type of analysis (UMI and no UMI), platform (QuantSeq and TruSeq), and cohorts (CNIO and TCGA) were corrected using ComBat95 from R/Bioconductor package sva96 v3.26.0 on log-transformed values. Samples considered outliers according to PCA, and from the consensus and hierarchical clustering were removed from further analysis.
Genomic subtype classifier
The list of subtype-specific differentially expressed genes established by Burnichon et al.20 was used to perform an unsupervised analysis of CNIO samples, and classify wild-type (WT) tumors into one of 3 genomic subtypes (pseudohypoxic, kinase signaling or Wnt-altered). Samples with known genotype were classified in one of 3 genomic subtypes as already defined5.
mPPGL signature discovery and validation
Differential expression analysis was executed between non-metastatic and primary metastatic tumors within each genomic subtype with DESeq297 v1.18.1 using ESTIMATE score as a covariate. Best candidates were ranked, and only those with |log2 fold-change| > 0.75 in all analyses and FDR < 0.01 in differential expression analysis including all cases were selected. A cohort of previously published PPGLs20 was used for validation; only those cases with clinical behavior status available (extracted from6) were included, and updated genotype and genomic subtype classification were obtained from98. Data was analyzed as detailed elsewhere29. String v11 (https://string-db.org/) was used to perform a functional enrichment analysis of this gene signature.
Gene set enrichment analysis
GSEA pre-ranked analysis was executed with GSEA software99 v2.2.2 (RRID:SCR_003199), using either the selected gene sets obtained from the mutational/ SCNA functional enrichment analysis or the ‘H: hallmark gene sets’, ‘C2: curated gene sets’ and ‘C5: ontology gene sets’ collections from the Molecular Signature Database (MSigDB; https://www.gsea-msigdb.org/gsea/msigdb/). Default settings were used except for collapse set to false, scoring_scheme set to classic, plot_top_x set to 100, set_max set to 1000, and set_min set to 10. Input files were obtained from the differential expression analysis (non-metastatic vs primary metastatic tumors) and ranked according to the log2FoldChange.
Classifier of metastasis prediction
The individual variables to be evaluated were dichotomized as done for the previous analyses and described in each figure legend. The total number of possible classifiers was dichotomized by computing all possible combinations with the 9 events to be evaluated (n = 511). We set as 1 - when any of the evaluated events included in the classifier was present; 0 - when none of the events was present. This analysis was executed using the dichotomized matrix with the samples for which we had all the data available (n = 156). We calculated the area under the receiver operating characteristic curves (AUC under ROC) of each event individually and all combinations possible (n = 511).
Integrated analysis of focal SCNA and gene expression
A Fisher exact test was applied to establish differing focal SCNA, either gains or deletions, between non-metastatic and metastatic primary tumors at the gene level. Gains were based on DUP and DUP-LOH FACETS annotations, and deletions on HEMYZIG and DEL ones. 2619 genes appeared with a P < 0.05. Correlation between CN at gene level and expression data per gene was assessed using an anova test, selecting those with FDR < 0.05. After recoding FACETS output into four different values to facilitate analysis (DUP and DUP-LOH coded as 1, no event as 0, HEMYZIG as −1 and DEL as −2), Pearson’s correlation coefficient between the CN scores and the expression levels was calculated. We identified significant genes by an Anova test and selected only those that exhibited a positive correlation (6785 genes). Only genes overlapping between both lists (911 genes) were considered further, assuming that these were genes with differing focal SCNA between studied groups and with a functional consequence at the mRNA level. Analyses were carried out in R (v.4.0.3).
Mutational and SCNA functional enrichment analyses
Panther tool25 was used to detect the significantly enriched gene sets among the consensus list of genes altered with SNV/INDELs or SCNAs. The SNV/INDEL gene list included all those genes with high impact variants (category 7: truncating, splice site, affecting start/stop codon variants, and missense variants classified as deleterious in three in silico predictors or in COSMIC, https://cancer.sanger.ac.uk/cosmic) in metastatic primary tumors. The SCNA gene list included those obtained through the integrated analysis of focal SCNA and gene expression.
Enriched annotations were retrieved from ‘GO biological process’, ‘GO molecular function’, ‘GO cellular component’ and ‘Reactome pathways’ using the Fisher’s Exact test executed by Panther. For the consensus gene set enrichment analysis, a fold-enrichment (FC) (FDR < 0.05) threshold at 1.8 was established.
Estimation of immune cell types
DESeq2 normalized expression matrix was used to calculate the abundance of 22 types of immune cell subsets in each sample of the CNIO cohort using CIBERSORTx37, and the gene signature matrix LM22, 1000 permutations, B-mode batch correction, and disabled quantile normalization. Cell abundances from TCGA cohort were retrieved from Thorsson et al.35. Both matrices were transformed to z-scores (centered at the relative abundance mean of the primary metastatic samples of each cohort) and merged in a single matrix for further analysis.
Immune subtype identification
We utilized the sample assignments established by Thorsson et al.35 for the TCGA cohort. For CNIO cohort, we used the ImmuneSubtypeClassifier of the Cri-iAtlas100 through the R package available in v0.1.0.
Single-sample gene set enrichment analysis for TME subtype identification
Gene set variation analysis (GSVA) enrichment scores for the 29 curated gene signatures (Fges) from Bagaev et al.38 were calculated using the GSVA R package101 on the RNA-Seq expression matrix normalized with the VST function of DESeq2. Thereafter, we classified all tumors with RNA-Seq available into the 4 separate TME subtypes described by Bagaev et al. (Immune-enriched fibrotic, immune-enriched non-fibrotic, fibrotic, depleted) applying unsupervised k-means clustering (Eucledian distance, 1000 iterations) based on the 29 calculated Fges enrichment scores using Morpheus (https://software.broadinstitute.org/morpheus).
Identification of neoantigens
Manually curated somatic SNVs and indels from the CNIO and TCGA cohort were annotated with VEP v106 using the required and useful VEP options specified in the pVACtools102 documentation. Coverage information for variant sites was retrieved from tumor and normal bam files using bam-readcount (Larson. genome/bam-readcount. GitHub https://github.com/genome/bam-readcount). For this purpose, the Docker 1.1.1 image of mgibio/bam_readcount_helper-cwl was used and the collected data were added to the annotated VFC files with the vcf-readcount-annotator from the VAtools package (http://vatools.org). HLA class I typing was performed on each sample with POLYSOLVER103v4. pVACseq from the pVACtools package version 3.0.2 was then used for epitope prediction. The epitope length was set to 8–11 and the prediction algorithms were all those available for MHC Class I (NetMHCpan, NetMHC, NetMHCcons, PickPocket, SMM, SMMPMBEC, MHCflurry and MHCnuggetsI). The epitopes provided by pVACseq in the filtered files, which are those passing binding affinity and sequence-based thresholds were the ones used to establish the neoantigen load per sample.
Immunohistochemistry
Antigen retrieval was first performed on 3 μm FFPE sections with the appropriate pH buffer and endogenous peroxidase was blocked (peroxide hydrogen at 3%). Slides were incubated with the appropriate primary antibody as detailed: mouse anti-CDK1 Ab (dil 1:250; BD Biosciences Cat# 610038, RRID:AB_397454), rabbit anti-PDL1 [E1L3N] XP mAb (dil 1:150 20’ER2; Cell Signaling Technology Cat# 13684, RRID:AB_2687655) and rat anti-CD8A [NOR132H] (dil 1:20; CNIO in-house Ab validated by EuroMAbNet; https://www.euromabnet.com/monoclonal-antibodies/cd8a/38.html). Afterwards, the corresponding visualization systems was used when needed (Bond Polymer Refine Detection, Bond, Leica; EnVision FLEX+, Dako) conjugated with horseradish peroxidase. Immunohistochemical reaction was developed using 3,30-diaminobenzidine tetrahydrochloride (DAB) (Dako). Nuclei were counterstained with Harrys’s hematoxylin. Finally, the slides were dehydrated, cleared and mounted with a permanent mounting medium for microscopic evaluation. Whole slides images were scanned with AxioScan Z1 (Zeiss), and captured either with a Zen Blue software (ZEN Digital Imaging for Light Microscopy, Zeiss, RRID:SCR_013672) or AxioVision software (AxioVision Imaging System, RRID:SCR_002677).
For CDK1 staining quantification, a script was created using Zen Blue software (additional module for analysis, Zeiss); positivity was stablished as stained area in tumor area after manual tumor selection on hematoxylin and eosin-stained slides. After training and script optimization, the quantification program was run and results exported as excel files with scoring data for each image file.
PD-L1 staining was assessed by two independent observers (G. Roncador and B. Calsina) on complete sections. Each case was scored semi-quantitatively depending on the tumor proportion score (TPS), as tier 1 (0–15% positive tumor cells), tier 2 (15–30%), and tier 3 (30–100%).
For CD8+ T cells quantification, a digital image analysis workflow was developed in QuPath104. Briefly, batch analysis was applied across all whole slides to automatically perform cell detection and count the number of positive cells. The cell detection parameters were optimized by applying the following parameters: optical density sum detection image, pixel size: 0.5 μm, background radius: 18 μm, median radius: 2 μm, minimum/maximum area: 12–1000 μm, intensity threshold: 0.07, sigma: 1.3 μm, threshold compartment: Cell:DAB OD mean 0.26. A random tree (RTees) classifier was trained for each tumor slide in order to distinguish between tumor cells and normal adrenal, sustentacular and endothelial cells, and erythrocytes. Manual pathologist (E. Caleiras) assessment was used to validate the classifier in a subset of cases.
Quantification and statistical analysis
Statistical analyses were performed either using R version 3.2.2 (RRID:SCR_000432) or IBM SPSS Statistics v19 (RRID:SCR_019096). The statistical details of experiments including the exact value of n in terms of number of samples for a given cohort, the experimental method, controlling/covariates used and specific statistical tests employed are reported in the relevant section (Results, Figures and Figure Legends, Supplementary Tables). For a given test, significance was defined, unless expressly indicated, if a p value was less than 0.05. Disease-specific progression-free was established as the time interval from the PPGL primary diagnosis to the first appearance of a metastatic lesion (time to progression, TTP), as a reliable prognostic measure.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Supplementary information
Acknowledgements
This work was supported by Project PI17/01796 and PI20/01169 to M.R. [Instituto de Salud Carlos III (ISCIII), Acción Estratégica en Salud, cofinanciado a través del Fondo Europeo de Desarrollo Regional (FEDER)], Paradifference Foundation [no grant number applicable to M.R.], Pheipas Association [no grant number applicable to M.R.], the Clinical Research Priority Program of the University of Zurich for the CRPP HYRENE to F.B., the Deutsche Forschungsgemeinschaft (DFG) within the CRC/Transregio 205/1 (Project No. 314061271-TRR205 to to F.B., M.F., N.B., and G.E.) and the Instituto de Salud Carlos III (ISCIII), Spanish Ministry of Science and Innovation (Project No. PID2019-111356RA-I00 to G.M.). B.C. was supported by the Rafael del Pino Foundation (Becas de Excelencia Rafael del Pino 2017). A.M.M.-M. was supported by CAM (S2017/BMD-3724; TIRONET2-CM). A.F.-S. and J.L. received the support of a fellowship from La Caixa Foundation (ID 100010434; LCF/BQ/DR21/11880009 and LCF/BQ/DR19/11740015, respectively). M.M., S.M., and M.S. were supported by the Spanish Ministry of Science, Innovation and Universities “Formación del Profesorado Universitario— FPU” fellowship with ID number FPU18/00064, FPU19/04940 and FPU16/05527. A.D.-T. is supported by the Centro de Investigacion Biomédica en Red de Enfermedades Raras (CIBERER). L.J.L.-G. was supported both by the Banco Santander Foundation and La Caixa Postdoctoral Junior Leader Fellowship (LCF/BQ/PI20/11760011). C.M.-C. was supported by a grant from the AECC Foundation (AIO15152858 MONT). We thank the Spanish National Tumor Bank Network (RD09/0076/00047) for the support in obtaining tumorsamples and all patients, physicians and tumor biobanks involved in the study.
Source data
Author contributions
Conceptualization, B.C., E.P.Y., A.M.M.M., F.A., and M.R.; Methodology, B.C., E.PY., A.M.M.M., E.C., E.G., O.D., G.R., J.F.G.G., F.A., and M.R.; Software, E.P.Y., A.M.M.M., R.T.P., and C.F.T.; Formal analysis, B.C. and S.G.M.; Investigation, B.C., E.C., A.F.S., M.M., M.P.A., R.L., S.J., M.C.M., J.M.R.R., J.L., M.S., A.D.T., A.R., P.G., S.R.P., and C.M.C.; Resources, N.B., M.D., M.C., S.G., C. A.E., R.M.R., J.A., M.I.O.G., A.L.F., S.M.J.F., E.R., M.F., F.B., M.Q., M.M., H.J.T., G.E., and K.P.; Data curation, B.C., M.C.F., and A.C.; Writing – original draft, B.C., E.P.Y., and A.M.M.M.; Writing – review & editing, B.C., E.P.Y., A.M.M.M., A.F.S., M.M., J.L., S.M., B.H., M.F., F.B., R.A.T., G.E., O.D., G.M., C.R.A., C.M.C., A.C., L.J.L.G., K.P., F.A., and M.R.; Visualization, B.C.; Supervision, B.C., F.A., and M.R.; Funding acquisition, M.R.
Peer review
Peer review information
Nature Communications thanks Michele Ceccarelli and Carl Christofer Juhlin for their contribution to the peer review of this work. Peer reviewer reports are available.
Data availability
The WES and RNA-Seq fastq files generated during this study, as well as level 3 files (expression count matrix, and the VCF files with the variant calling results for both SNV/INDELs and CN) have been deposited in the European Genome-Phenome Archive (EGA) under the accession EGAS00001006043 and EGAS00001006044. The data are available under restricted access due to the possibility of revealing patient-sensitive information. Request for data access will be referred directly to the Data Access Committee (DAC) of the CNIO (mrobledo@cnio.es). The access will be granted for health/medical/biomedical purposes and according to good practice recommendations. The DAC will attempt to provide a response to all applications within two weeks of submission and render a final decision within no more than four weeks. Once access has been granted, data will be available for one month. The remaining data are available within the article and supplementary information. The publicly available microarray dataset used in this study is available from ArrayExpress (E-MTAB-733)20 and the TCGA WES and RNA-Seq data from GDC Data Portal, NIH (https://portal.gdc.cancer.gov/), TCGA-PCPG5. Source data are provided with this paper.
Competing interests
G.M., is a founder, director and shareholder of Tailor Bio Ltd, a genomics company using copy number signatures for precision medicine. The rest of the authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Elena Piñeiro-Yáñez, Ángel M Martínez-Montes.
Contributor Information
Bruna Calsina, Email: bcalsina@cnio.es.
Mercedes Robledo, Email: mrobledo@cnio.es.
Supplementary information
The online version contains supplementary material available at 10.1038/s41467-023-36769-6.
References
- 1.Dahia PLM. Pheochromocytomas and paragangliomas, genetically diverse and minimalist, all at once! Cancer Cell. 2017;31:159–161. doi: 10.1016/j.ccell.2017.01.009. [DOI] [PubMed] [Google Scholar]
- 2.Hescot, S. et al. Prognosis of malignant pheochromocytoma and paraganglioma (MAPP-PronO study): a European network for the study of adrenal tumors retrospective study. J. Clin. Endocrinol. Metab. 104, 2367–2374 (2019). [DOI] [PubMed]
- 3.Nölting S, et al. Personalized management of pheochromocytoma and paraganglioma. Endocr. Rev. 2021 doi: 10.1210/endrev/bnab019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Fassnacht, M. et al. Adrenocortical carcinomas and malignant phaeochromocytomas: ESMO–EURACAN Clinical Practice Guidelines for diagnosis, treatment and follow-up††Approved by the ESMO Guidelines Committee: June 2020. This publication supersedes the previously published versio. Ann. Oncol. 31, 1476–1490 (2020). [DOI] [PubMed]
- 5.Fishbein L, et al. Comprehensive molecular characterization of pheochromocytoma and paraganglioma. Cancer Cell. 2017;31:181–193. doi: 10.1016/j.ccell.2017.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Castro-Vega LJ, et al. Multi-omics analysis defines core genomic alterations in pheochromocytomas and paragangliomas. Nat. Commun. 2015;6:6044. doi: 10.1038/ncomms7044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bruni D, Angell HK, Galon J. The immune contexture and Immunoscore in cancer prognosis and therapeutic efficacy. Nat. Rev. Cancer. 2020;20:662–680. doi: 10.1038/s41568-020-0285-7. [DOI] [PubMed] [Google Scholar]
- 8.Fishbein L, et al. Whole-exome sequencing identifies somatic ATRX mutations in pheochromocytomas and paragangliomas. Nat. Commun. 2015;6:6140. doi: 10.1038/ncomms7140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wilzén A, et al. Malignant pheochromocytomas/paragangliomas harbor mutations in transport and cell adhesion genes. Int. J. Cancer. 2016;138:2201–2211. doi: 10.1002/ijc.29957. [DOI] [PubMed] [Google Scholar]
- 10.Lawrence MS, et al. Mutational heterogeneity in cancer and the search for new cancer-associated genes. Nature. 2013;499:214–218. doi: 10.1038/nature12213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cortes-Ciriano I, Lee S, Park W-Y, Kim T-M, Park PJ. A molecular portrait of microsatellite instability across multiple cancers. Nat. Commun. 2017;8:15180. doi: 10.1038/ncomms15180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lehtonen HJ, et al. Increased HIF1α in SDH and FH deficient tumors does not cause microsatellite instability. Int. J. Cancer. 2007;121:1386–1389. doi: 10.1002/ijc.22819. [DOI] [PubMed] [Google Scholar]
- 13.Bonneville, R. et al. Landscape of microsatellite instability across 39 cancer types. JCO Precis. Oncol. 10.1200/PO.17.00073 (2017). [DOI] [PMC free article] [PubMed]
- 14.Roberts SA, Gordenin DA. Hypermutation in human cancer genomes: footprints and mechanisms. Nat. Rev. Cancer. 2014;14:786–800. doi: 10.1038/nrc3816. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Cascón A, Remacha L, Calsina B, Robledo M. Pheochromocytomas and paragangliomas: bypassing cellular respiration. Cancers (Basel) 2019;11:681. doi: 10.3390/cancers11050683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Tomasetti C, Vogelstein B, Parmigiani G. Half or more of the somatic mutations in cancers of self-renewing tissues originate prior to tumor initiation. Proc. Natl. Acad. Sci. USA. 2013;110:1999 LP–1992004. doi: 10.1073/pnas.1221068110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.de Magalhães JP. How ageing processes influence cancer. Nat. Rev. Cancer. 2013;13:357–365. doi: 10.1038/nrc3497. [DOI] [PubMed] [Google Scholar]
- 18.Dahia PLM, Clifton-Bligh R, Gimenez-Roqueplo A-P, Robledo M, Jimenez C. HEREDITARY ENDOCRINE TUMOURS: CURRENT STATE-OF-THE-ART AND RESEARCH OPPORTUNITIES: Metastatic pheochromocytomas and paragangliomas: proceedings of the MEN2019 workshop. Endocr. Relat. Cancer. 2020;27:T41–T52. doi: 10.1530/ERC-19-0435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Job, S. et al. Telomerase activation and ATRX mutations are independent risk factors for metastatic pheochromocytoma and paraganglioma. Clin. Cancer Res. 10.1158/1078-0432.CCR-18-0139 (2018). [DOI] [PubMed]
- 20.Burnichon N, et al. Integrative genomic analysis reveals somatic mutations in pheochromocytoma and paraganglioma. Hum. Mol. Genet. 2011;20:3974–3985. doi: 10.1093/hmg/ddr324. [DOI] [PubMed] [Google Scholar]
- 21.Szklarczyk D, et al. STRING v11: protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019;47:D607–D613. doi: 10.1093/nar/gky1131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.O’Toole SM, et al. Oncometabolite induced primary cilia loss in pheochromocytoma. Endocr. Relat. Cancer. 2019;26:165–180. doi: 10.1530/ERC-18-0134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Croisé P, et al. Cdc42 and Rac1 activity is reduced in human pheochromocytoma and correlates with FARP1 and ARHGEF1 expression. Endocr. Relat. Cancer. 2016;23:281–293. doi: 10.1530/ERC-15-0502. [DOI] [PubMed] [Google Scholar]
- 24.Kimura N, et al. Pathological grading for predicting metastasis in phaeochromocytoma and paraganglioma. Endocr. Relat. Cancer. 2014;21:405–414. doi: 10.1530/ERC-13-0494. [DOI] [PubMed] [Google Scholar]
- 25.Mi H, Muruganujan A, Thomas PD. PANTHER in 2013: modeling the evolution of gene function, and other gene attributes, in the context of phylogenetic trees. Nucleic Acids Res. 2013;41:D377–D386. doi: 10.1093/nar/gks1118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Walker C, Mojares E, Del Río Hernández A. Role of extracellular matrix in development and cancer progression. Int. J. Mol. Sci. 2018;19:3028. doi: 10.3390/ijms19103028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Paolillo M, Schinelli S. Extracellular matrix alterations in metastatic processes. Int. J. Mol. Sci. 2019;20:4947. doi: 10.3390/ijms20194947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Loriot C, et al. Deciphering the molecular basis of invasiveness in Sdhb-deficient cells. Oncotarget. 2015 doi: 10.18632/oncotarget.5106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Calsina B, et al. Integrative multi-omics analysis identifies a prognostic miRNA signature and a targetable miR-21-3p/TSC2/ mTOR axis in metastatic pheochromocytoma/ paraganglioma. Theranostics. 2019;9:4946–4958. doi: 10.7150/thno.35458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.De Cubas AA, et al. Integrative analysis of miRNA and mRNA expression profiles in pheochromocytoma and paraganglioma identifies genotype-specific markers and potentially regulated pathways. Endocr. Relat. Cancer. 2013;20:477–493. doi: 10.1530/ERC-12-0183. [DOI] [PubMed] [Google Scholar]
- 31.Pelletier J, Thomas G, Volarević S. Ribosome biogenesis in cancer: new players and therapeutic avenues. Nat. Rev. Cancer. 2018;18:51–63. doi: 10.1038/nrc.2017.104. [DOI] [PubMed] [Google Scholar]
- 32.Bursać S, et al. Mutual protection of ribosomal proteins L5 and L11 from degradation is essential for p53 activation upon ribosomal biogenesis stress. Proc. Natl. Acad. Sci. USA. 2012;109:20467 LP–20420472. doi: 10.1073/pnas.1218535109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Donati G, Peddigari S, Mercer CA, Thomas G. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint. Cell Rep. 2013;4:87–98. doi: 10.1016/j.celrep.2013.05.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pestov DG, Strezoska Z, Lau LF. Evidence of p53-dependent cross-talk between ribosome biogenesis and the cell cycle: effects of nucleolar protein Bop1 on G(1)/S transition. Mol. Cell. Biol. 2001;21:4246–4255. doi: 10.1128/MCB.21.13.4246-4255.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Thorsson V, et al. The immune landscape of cancer. Immunity. 2018;48:812–830.e14. doi: 10.1016/j.immuni.2018.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Yoshihara K, et al. Inferring tumour purity and stromal and immune cell admixture from expression data. Nat. Commun. 2013;4:2612. doi: 10.1038/ncomms3612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Newman AM, et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat. Biotechnol. 2019;37:773–782. doi: 10.1038/s41587-019-0114-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bagaev A, et al. Conserved pan-cancer microenvironment subtypes predict response to immunotherapy. Cancer Cell. 2021;39:845–865.e7. doi: 10.1016/j.ccell.2021.04.014. [DOI] [PubMed] [Google Scholar]
- 39.Cassetta L, Pollard JW. Targeting macrophages: therapeutic approaches in cancer. Nat. Rev. Drug Discov. 2018;17:887–904. doi: 10.1038/nrd.2018.169. [DOI] [PubMed] [Google Scholar]
- 40.Burkholder B, et al. Tumor-induced perturbations of cytokines and immune cell networks. Biochim. Biophys. Acta - Rev. Cancer. 2014;1845:182–201. doi: 10.1016/j.bbcan.2014.01.004. [DOI] [PubMed] [Google Scholar]
- 41.Celada, L. et al. Pseudohypoxia in paraganglioma and pheochromocytoma is associated with an immunosuppressive phenotype. J. Pathol.259, 103–114 (2022). [DOI] [PMC free article] [PubMed]
- 42.Favier J, et al. Rationale for anti-angiogenic therapy in pheochromocytoma and paraganglioma. Endocr. Pathol. 2012 doi: 10.1007/s12022-011-9189-0. [DOI] [PubMed] [Google Scholar]
- 43.Crona J, Taïeb D, Pacak K. New perspectives on pheochromocytoma and paraganglioma: toward a molecular classification. Endocr. Rev. 2017;38:489–515. doi: 10.1210/er.2017-00062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Tang J, Shalabi A, Hubbard-Lucey VM. Comprehensive analysis of the clinical immuno-oncology landscape. Ann. Oncol. 2018;29:84–91. doi: 10.1093/annonc/mdx755. [DOI] [PubMed] [Google Scholar]
- 45.Das-Gupta EP, Seedhouse CH, Russell NH. Microsatellite instability occurs in defined subsets of patients with acute myeloblastic leukaemia. Br. J. Haematol. 2001;114:307–312. doi: 10.1046/j.1365-2141.2001.02920.x. [DOI] [PubMed] [Google Scholar]
- 46.Maletzki C, Stier S, Linnebacher M. Microsatellite instability in hematological malignancies. Oncoimmunology. 2013;2:e25419. doi: 10.4161/onci.25419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Sandgren J, et al. Recurrent genomic alterations in benign and malignant pheochromocytomas and paragangliomas revealed by whole-genome array comparative genomic hybridization analysis. Endocr. Relat. Cancer. 2010;17:561–579. doi: 10.1677/ERC-09-0310. [DOI] [PubMed] [Google Scholar]
- 48.Hieronymus H, et al. Tumor copy number alteration burden is a pan-cancer prognostic factor associated with recurrence and death. Elife. 2018;7:e37294. doi: 10.7554/eLife.37294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kunitoshi C, et al. Mutations in the promoter of the telomerase gene TERT contribute to tumorigenesis by a two-step mechanism. Science. 2017;357:1416–1420. doi: 10.1126/science.aao0535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Macintyre G, et al. Copy number signatures and mutational processes in ovarian carcinoma. Nat. Genet. 2018;50:1262–1270. doi: 10.1038/s41588-018-0179-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Liu T, et al. The activating TERT promoter mutation C228T is recurrent in subsets of adrenal tumors. Endocr. Relat. Cancer. 2014;21:427–434. doi: 10.1530/ERC-14-0016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Papathomas TG, et al. Telomerase reverse transcriptase promoter mutations in tumors originating from the adrenal gland and extra-adrenal paraganglia. Endocr. Relat. Cancer. 2014;21:653–661. doi: 10.1530/ERC-13-0429. [DOI] [PubMed] [Google Scholar]
- 53.Meienberg J, Bruggmann R, Oexle K, Matyas G. Clinical sequencing: is WGS the better WES? Hum. Genet. 2016;135:359–362. doi: 10.1007/s00439-015-1631-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Santamaría D, et al. Cdk1 is sufficient to drive the mammalian cell cycle. Nature. 2007;448:811–815. doi: 10.1038/nature06046. [DOI] [PubMed] [Google Scholar]
- 55.Zethoven M, et al. Single-nuclei and bulk-tissue gene-expression analysis of pheochromocytoma and paraganglioma links disease subtypes with tumor microenvironment. Nat. Commun. 2022;13:6262. doi: 10.1038/s41467-022-34011-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Otto T, Sicinski P. Cell cycle proteins as promising targets in cancer therapy. Nat. Rev. Cancer. 2017;17:93–115. doi: 10.1038/nrc.2016.138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Goncalves J, Lussey-Lepoutre C, Favier J, Gimenez-Roqueplo A-P, Castro-Vega LJ. Emerging molecular markers of metastatic pheochromocytomas and paragangliomas. Ann. Endocrinol. 2019;80:159–162. doi: 10.1016/j.ando.2019.04.003. [DOI] [PubMed] [Google Scholar]
- 58.Fridman WH, Zitvogel L, Sautès–Fridman C, Kroemer G. The immune contexture in cancer prognosis and treatment. Nat. Rev. Clin. Oncol. 2017;14:717–734. doi: 10.1038/nrclinonc.2017.101. [DOI] [PubMed] [Google Scholar]
- 59.Farhat NA, et al. A previously unrecognized monocytic component of pheochromocytoma and paraganglioma. Endocr. Pathol. 2019;30:90–95. doi: 10.1007/s12022-019-9575-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Gao X, et al. Histopathological analysis of tumor microenvironment and angiogenesis in pheochromocytoma. Front. Endocrinol. 2020;11:851. doi: 10.3389/fendo.2020.587779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Giraldo NA, et al. The clinical role of the TME in solid cancer. Br. J. Cancer. 2019;120:45–53. doi: 10.1038/s41416-018-0327-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Zou W. Regulatory T cells, tumour immunity and immunotherapy. Nat. Rev. Immunol. 2006;6:295–307. doi: 10.1038/nri1806. [DOI] [PubMed] [Google Scholar]
- 63.Sarkar C, Chakroborty D, Basu S. Neurotransmitters as regulators of tumor angiogenesis and immunity: the role of catecholamines. J. Neuroimmune Pharmacol. 2013;8:7–14. doi: 10.1007/s11481-012-9395-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Brand A, et al. LDHA-associated lactic acid production blunts tumor immunosurveillance by T and NK cells. Cell Metab. 2016;24:657–671. doi: 10.1016/j.cmet.2016.08.011. [DOI] [PubMed] [Google Scholar]
- 65.Vitale I, Manic G, Coussens LM, Kroemer G, Galluzzi L. Macrophages and metabolism in the tumor microenvironment. Cell Metab. 2019;30:36–50. doi: 10.1016/j.cmet.2019.06.001. [DOI] [PubMed] [Google Scholar]
- 66.Fridman WH, Pagès F, Sautès-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome. Nat. Rev. Cancer. 2012;12:298–306. doi: 10.1038/nrc3245. [DOI] [PubMed] [Google Scholar]
- 67.Kraehenbuehl L, Weng C-H, Eghbali S, Wolchok JD, Merghoub T. Enhancing immunotherapy in cancer by targeting emerging immunomodulatory pathways. Nat. Rev. Clin. Oncol. 2021 doi: 10.1038/s41571-021-00552-7. [DOI] [PubMed] [Google Scholar]
- 68.Waldman AD, Fritz JM, Lenardo MJ. A guide to cancer immunotherapy: from T cell basic science to clinical practice. Nat. Rev. Immunol. 2020;20:651–668. doi: 10.1038/s41577-020-0306-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Tumeh PC, et al. PD-1 blockade induces responses by inhibiting adaptive immune resistance. Nature. 2014;515:568–571. doi: 10.1038/nature13954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Jimenez C, et al. Phase II clinical trial of pembrolizumab in patients with progressive metastatic pheochromocytomas and paragangliomas. Cancers. 2020;12:1–15. doi: 10.3390/cancers12082307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Yang W, et al. Immunogenic neoantigens derived from gene fusions stimulate T cell responses. Nat. Med. 2019;25:767–775. doi: 10.1038/s41591-019-0434-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Luke JJ, Bao R, Sweis RF, Spranger S, Gajewski TF. WNT/β-catenin pathway activation correlates with immune exclusion across human cancers. Clin. Cancer Res. 2019;25:3074–3083. doi: 10.1158/1078-0432.CCR-18-1942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.C CS, et al. MYC regulates the antitumor immune response through CD47 and PD-L1. Science. 2016;352:227–231. doi: 10.1126/science.aac9935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Du L, et al. β-Catenin induces transcriptional expression of PD-L1 to promote glioblastoma immune evasion. J. Exp. Med. 2020;217:e20191115. doi: 10.1084/jem.20191115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Khalil DN, et al. In situ vaccination with defined factors overcomes T cell exhaustion in distant tumors. J. Clin. Invest. 2019;129:3435–3447. doi: 10.1172/JCI128562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Caisova V, et al. The significant reduction or complete eradication of subcutaneous and metastatic lesions in a pheochromocytoma mouse model after immunotherapy using Mannan-BAM, TLR ligands, and anti-CD40. Cancers. 2019;11:654. doi: 10.3390/cancers11050654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Binnewies M, et al. Understanding the tumor immune microenvironment (TIME) for effective therapy. Nat. Med. 2018;24:541–550. doi: 10.1038/s41591-018-0014-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Mete O, et al. Overview of the 2022 WHO Classification of paragangliomas and pheochromocytomas. Endocr. Pathol. 2022;33:90–114. doi: 10.1007/s12022-022-09704-6. [DOI] [PubMed] [Google Scholar]
- 79.Monteagudo M, et al. Analysis of telomere maintenance related genes reveals NOP10 as a new metastatic-risk marker in pheochromocytoma/paraganglioma. Cancers. 2021;13:4758. doi: 10.3390/cancers13194758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Van der Auwera, G. A. & O’Connor, B. D. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra (O’Reilly Media, Inc., 2020).
- 82.Poplin, R. et al. Scaling accurate genetic variant discovery to tens of thousands of samples. Preprint at bioRxiv10.1101/201178 (2018).
- 83.Cibulskis K, et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 2013;31:213–219. doi: 10.1038/nbt.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.McLaren W, et al. The ensembl variant effect predictor. Genome Biol. 2016;17:122. doi: 10.1186/s13059-016-0974-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Shen R, Seshan VE. FACETS: allele-specific copy number and clonal heterogeneity analysis tool for high-throughput DNA sequencing. Nucleic Acids Res. 2016;44:e131–e131. doi: 10.1093/nar/gkw520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Kautto EA, et al. Performance evaluation for rapid detection of pan-cancer microsatellite instability with MANTIS. Oncotarget. 2017;8:7452–7463. doi: 10.18632/oncotarget.13918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Robinson JT, et al. Integrative genomics viewer. Nat. Biotechnol. 2011;29:24–26. doi: 10.1038/nbt.1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Durinck S, et al. BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis. Bioinformatics. 2005;21:3439–3440. doi: 10.1093/bioinformatics/bti525. [DOI] [PubMed] [Google Scholar]
- 89.Castelo-Branco P, et al. Methylation of the TERT promoter and risk stratification of childhood brain tumours: an integrative genomic and molecular study. Lancet Oncol. 2013;14:534–542. doi: 10.1016/S1470-2045(13)70110-4. [DOI] [PubMed] [Google Scholar]
- 90.Mermel CH, et al. GISTIC2.0 facilitates sensitive and confident localization of the targets of focal somatic copy-number alteration in human cancers. Genome Biol. 2011;12:R41. doi: 10.1186/gb-2011-12-4-r41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Barthel FP, et al. Systematic analysis of telomere length and somatic alterations in 31 cancer types. Nat. Genet. 2017;49:349–357. doi: 10.1038/ng.3781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Graña O, Rubio-Camarillo M, Fdez-Riverola F, Pisano DG, Glez-Peña D. Nextpresso: next generation sequencing expression analysis pipeline. Curr. Bioinform. 2017;13:583–591. doi: 10.2174/1574893612666170810153850. [DOI] [Google Scholar]
- 93.Kim D, et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14:R36. doi: 10.1186/gb-2013-14-4-r36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Dobin A, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8:118–127. doi: 10.1093/biostatistics/kxj037. [DOI] [PubMed] [Google Scholar]
- 96.Leek JT, Johnson WE, Parker HS, Jaffe AE, Storey JD. The sva package for removing batch effects and other unwanted variation in high-throughput experiments. Bioinformatics. 2012;28:882–883. doi: 10.1093/bioinformatics/bts034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Ben Aim L, et al. Targeted next-generation sequencing detects rare genetic events in pheochromocytoma and paraganglioma. J. Med. Genet. 2019;56:513 LP–513520. doi: 10.1136/jmedgenet-2018-105714. [DOI] [PubMed] [Google Scholar]
- 99.Subramanian A, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA. 2005;102:15545 LP–15515550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Eddy JA, et al. CRI iAtlas: an interactive portal for immuno-oncology research. F1000Research. 2020;9:1–16. doi: 10.12688/f1000research.25141.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Hänzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis for microarray and RNA-Seq data. BMC Bioinform. 2013;14:7. doi: 10.1186/1471-2105-14-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Hundal J, et al. pVACtools: a computational toolkit to identify and visualize cancer neoantigens. Cancer Immunol. Res. 2020;8:409–420. doi: 10.1158/2326-6066.CIR-19-0401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Shukla SA, et al. Comprehensive analysis of cancer-associated somatic mutations in class I HLA genes. Nat. Biotechnol. 2015;33:1152–1158. doi: 10.1038/nbt.3344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Bankhead P, et al. QuPath: open source software for digital pathology image analysis. Sci. Rep. 2017;7:16878. doi: 10.1038/s41598-017-17204-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The WES and RNA-Seq fastq files generated during this study, as well as level 3 files (expression count matrix, and the VCF files with the variant calling results for both SNV/INDELs and CN) have been deposited in the European Genome-Phenome Archive (EGA) under the accession EGAS00001006043 and EGAS00001006044. The data are available under restricted access due to the possibility of revealing patient-sensitive information. Request for data access will be referred directly to the Data Access Committee (DAC) of the CNIO (mrobledo@cnio.es). The access will be granted for health/medical/biomedical purposes and according to good practice recommendations. The DAC will attempt to provide a response to all applications within two weeks of submission and render a final decision within no more than four weeks. Once access has been granted, data will be available for one month. The remaining data are available within the article and supplementary information. The publicly available microarray dataset used in this study is available from ArrayExpress (E-MTAB-733)20 and the TCGA WES and RNA-Seq data from GDC Data Portal, NIH (https://portal.gdc.cancer.gov/), TCGA-PCPG5. Source data are provided with this paper.