Skip to main content
eLife logoLink to eLife
. 2023 Apr 12;12:e74913. doi: 10.7554/eLife.74913

Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis

Sanne Hiddingh 1,2,†, Aridaman Pandit 2,3,†, Fleurieke Verhagen 1,2,3,†, Rianne Rijken 2,4, Nila Hendrika Servaas 2,4, Rina CGK Wichers 2,4, Ninette H ten Dam-van Loon 3, Saskia M Imhof 1,3, Timothy RDJ Radstake 5, Joke H de Boer 1,3, Jonas JW Kuiper 1,2,3,✉
Editors: Lynn M Hassman6, Betty Diamond7
PMCID: PMC10185339  PMID: 37042831

Abstract

Background:

Type I interferons (IFNs) promote the expansion of subsets of CD1c+ conventional dendritic cells (CD1c+ DCs), but the molecular basis of CD1c+ DCs involvement in conditions not associated without elevated type I IFNs remains unclear.

Methods:

We analyzed CD1c+ DCs from two cohorts of non-infectious uveitis patients and healthy donors using RNA-sequencing followed by high-dimensional flow cytometry to characterize the CD1c+ DC populations.

Results:

We report that the CD1c+ DCs pool from patients with non-infectious uveitis is skewed toward a gene module with the chemokine receptor CX3CR1 as the key hub gene. We confirmed these results in an independent case–control cohort and show that the disease-associated gene module is not mediated by type I IFNs. An analysis of peripheral blood using flow cytometry revealed that CX3CR1+ DC3s were diminished, whereas CX3CR1− DC3s were not. Stimulated CX3CR1+ DC3s secrete high levels of inflammatory cytokines, including TNF-alpha, and CX3CR1+ DC3 like cells can be detected in inflamed eyes of patients.

Conclusions:

These results show that CX3CR1+ DC3s are implicated in non-infectious uveitis and can secrete proinflammatory mediators implicated in its pathophysiology.

Funding:

The presented work is supported by UitZicht (project number #2014-4, #2019-10, and #2021-4). The funders had no role in the design, execution, interpretation, or writing of the study.

Research organism: Human

Introduction

Non-infectious uveitis refers to a group of chronic inflammatory eye diseases that are among the leading causes of preventable vision loss in western countries (Thorne et al., 2016; Suttorp-Schulten and Rothova, 1996). Currently, little is known about the disease mechanism of non-infectious uveitis. A large body of mechanistic studies using experimental autoimmune uveitis (EAU) in rodents suggest that T cells play a role in non-infectious uveitis (Lee et al., 2014; Caspi, 2010). Human non-infectious uveitis is characterized by inflammation and T cells infiltrating the eyes through unknown mechanisms. The genetic association between non-infectious uveitis and MHC, and ERAP1, ERAP2 genes indicates that antigen presentation is central to the etiology (Kuiper and Venema, 2020; Huang et al., 2020; Kuiper et al., 2018; Márquez et al., 2017). A key antigen presenting cell type are dendritic cells. Despite their important role in EAU, dendritic cells have yet to be fully investigated in human non-infectious uveitis (Chen et al., 2015b; Fu et al., 2019; Wang et al., 2021). CD1c-positive conventional dendritic cells (CD1c+ DCs) have been found to be associated with disease activity (Chen et al., 2016; Chen et al., 2015a; Chen et al., 2014), and are abundant in eye fluid of patients (O’Rourke et al., 2018). In order to understand the role of CD1c+ DCs in non-infectious uveitis, it is necessary to understand their functions.

Several single-cell studies have revealed that the CD1c+ DCs (and its murine equivalent, termed ‘cDC2s’) consists of multiple subsets derived from distinct progenitors (Villani et al., 2017; Dutertre et al., 2019; Cytlak et al., 2020). The type I IFN family of cytokines promotes the expansion of a subset of CD1c+ DCs called ‘DC3’ (Dutertre et al., 2019; Girard et al., 2020; Bourdely et al., 2020). DC3s are increased in blood of type I IFN-driven systemic lupus erythematosus (SLE) patients (Dutertre et al., 2019). A significant difference between non-infectious uveitis and SLE is that active uveitis is accompanied by lower levels of type I IFN (Wang et al., 2019; Kuiper et al., 2022). It should be noted that although type I IFNs can induce lupus-like disease, they can also suppress non-infectious uveitis (Wang et al., 2019; Rönnblom et al., 1991; Rönnblom et al., 1990), pointing to an alternative disease mechanism implicating CD1c+ DCs in non-infectious uveitis. Hence, we do not fully understand the characteristics of CD1c+ DC during autoimmunity, especially in conditions not driven by type I IFNs.

For the purpose of characterizing the core transcriptional features and subset composition of CD1c+ DCs in autoimmunity of the eye, we used whole transcriptome profiling by bulk RNA-sequencing of peripheral blood CD1c+ DCs and multiparameter flow cytometry of two cohorts of non-infectious uveitis patients and healthy donors. We constructed co-expression networks that identified a robust gene module associated with non-infectious uveitis in patients that helped identify a CX3CR1-positive CD1c+ DC subset.

Materials and methods

Patients and patient material

This study was conducted in compliance with the Helsinki principles. Ethical approval was requested and obtained from the Medical Ethical Research Committee in Utrecht (METC protocol number #14-065/M). All patients signed written informed consent before participation. We collected blood from a discovery cohort of 23 and a replication cohort of 28 adult patients (Table 1) with HLA-B27-associated acute anterior uveitis (AU), idiopathic intermediate uveitis (IU), or HLA-A29-associated birdshot uveitis (BU). Patients were recruited at the outbound patient clinic of the Department of Ophthalmology of the University Medical Center Utrecht between July 2014 and January 2017. We recruited 27 age- and sex-matched anonymous blood donors of European Ancestry with no history of ocular inflammatory disease at the same institute to serve as unaffected controls (Table 1). Uveitis was classified and graded in accordance with the SUN classification (Jabs et al., 2005). Each patient underwent a full ophthalmological examination by an ophthalmologist experienced in uveitis, routine laboratory screening, and an X-ray of the lungs. Laboratory screening included erythrocyte sedimentation rate, renal and liver function tests, angiotensin-converting enzyme, and screening for infectious agents in the serum and an Interferon-Gamma Release Assay (IGRA) was obtained for all patients. All patients with AU and BU were HLA-B27 or HLA-A29-positive, respectively (confirmed by HLA typing). All patients had active uveitis (new onset or relapse) and there was no clinical evidence for uveitis-associated systemic inflammatory disease (e.g., rheumatic condition) till the time of sampling. None of the patients received systemic immunomodulatory treatment in the last 3 months, other than low dose (≤10 mg) oral prednisolone in one BU patient of cohort II and one AU patient of cohort I.

Table 1. Characteristics of the patients and controls from cohorts I and II.

Abbreviations: BU: birdshot uveitis, AU: HLA-B27-associated anterior uveitis, HC: healthy control, IU: idiopathic intermediate uveitis, n.a.: not applicable, *Fisher’s exact test, **ANOVA, ***Kruskal–Wallis.

Cohort I AU IU BU HC p value
N 10 5 8 13 Total = 36
Male/female 2/8 3/2 5/3 5/8 0.26*
Age in years; mean ± SD 45 ± 16 30 ± 9 42 ± 10 42 ± 13 0.24***
Disease duration in years; median (range) 8.1 (0.2–22.3) 3.4 (0.4–14.1) 0.9 (0.2–19.9) n.a. 0.36**
Cohort II AU IU BU HC p value
N 9 9 10 14 Total = 42
Male/female 3/6 2/7 4/6 6/8 0.8790*
Age in years; mean ± SD 47 ± 17 39 ± 14 52 ± 13 39 ± 10 0.06***
Disease duration in years; median (range) 5.8 (0.1–39.3) 3.7 (0.2–20.0) 1.3 (0.2–15.1) n.a. 0.14**

CD1c+ DC purification

Peripheral blood mononuclear cells (PBMCs) were isolated by standard ficoll density gradient centrifugation from 70 ml heparinized blood immediately after blood withdrawal (GE Healthcare, Uppsala, Sweden). For the first cohort, 10 batches (individual days) of 4–5 randomly selected patient and control samples of nitrogen stored PBMCs (mean storage time of 11 [range 0–31] months) were carefully thawed and subjected to sorting by the BD FACSAria III sorter after incubation with a panel of surface antibodies (Supplementary file 1A) and fluorescent-activated cell sorting (FACS) buffer (1% bovine serum albumin and 0.1% sodium azide in phosphate-buffered saline [PBS]). CD3−CD19−CD56−CD14−HLA-DR+CD11c+CD1c cells were sorted. The average number of collected cells by sorting was 56,881 (range 6669–243,385). For the second cohort, fresh PBMCs were immediately subjected to magnetic-activated cell sorting (MACS) for the removal (positive selection) of CD304+ cells (pDC), followed by the removal of CD19+ cells (B cell), and subsequently isolation of CD1c+ cells by using the CD1c+ (BDCA1) isolation kit (Miltenyi Biotec, Germany) according to the manufacturer’s instructions. The isolated CD1c+ fraction contained on average 147,114 cells (range 46,000–773,000) and purity was determined by flow cytometry (Supplementary file 1B) measured on the BD LSRFortessa Cell analyzer (Figure 1—figure supplement 1). Data were analyzed using FlowJo software (TreeStar Inc). MACS or FACS purified CD1c+ cells were immediately taken up in a lysis buffer (RLT plus, QIAGEN) containing 1% β-mercaptoethanol, snap frozen on dry ice, and stored at −80°C until RNA extraction was performed. Isolation of CD1c+ DC for functional experiments was done by MACS as described above. Purification of CD1c+DC subsets based on CD36 and CX3CR1 or CD14 expression from freshly isolated PBMCs was conducted by flow cytometry using the panel in Supplementary file 1C and shown in Figure 3—figure supplement 2B.

CD1c+ DC cultures and secretome analysis

Purified CD1c+ DCs were cultured in RPMI Glutamax (Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (Biowest Riverside) and 1% penicillin/streptomycin (Thermo Fisher Scientific). CD1c+ DCs were cultured at a concentration of 0.5 × 106 cells/ml in a 96-well round-bottom plate (100 μl/well). Cells were stimulated overnight (18 hr) with multiple stimuli listed in Supplementary file 1D. After stimulation, cells were lysed in an RLT plus lysis buffer (QIAGEN) and stored at −80°C until RNA extraction was performed. Cell lysates were stored at −80°C until RNA extraction was performed for qPCR. In separate cultures, CD1c+ DC subsets (sorted based on CD36 and CX3CR1 expression) were cultured in the presence of 1 µg/ml lipoteichoic acid (LTA). After 18 hr of stimulation, supernatants were harvested and IL-23 cytokine production was analyzed by ELISA (R&D Systems). The levels of IL-2, IL-5, IL-6, IL-10, IL-12p70, IL-13, IL-17, IL-22, IL-27, TNF-alpha, IFN-alpha, IFN-beta, CCL1, CXCL10, CXCL13, VEGF, CD40L, FAS, TNFR1, TNFR2, Elastase, and Granzyme B were simultaneously measured in supernatant of CD1c+ DC cultures using the in-house multiplex immunoassay based on Luminex technology, as described previously (Bakker et al., 2022). Protein concentrations that were out of range were replaced with the LLOQ (lower limit of quantification) and ULOQ (upper limit of quantification) for each analyte and divided by 2 for the proteins detected below the range of detection or multiplied by 2 for values above the detection range (Supplementary file 1E).

Real-time quantitative PCR

First-strand cDNA was synthesized from total RNA using Superscript IV kit (Thermo Fisher Scientific), and quantitative real-time PCR (RT-qPCR) was performed on the QuantStudio 12k flex System (LifeTechnologies), following the manufacturer’s instructions. Sequences of the primers used are listed in Supplementary file 1F and the Key Resource Table. RT-qPCR data were normalized to the expression of the selected housekeeping gene GUSB (ENSG00000169919). CT values were normalized to GUSB by subtracting the CT mean of GUSB (measured in duplo) from the CT mean of the target mRNA (e.g., RUNX3) = ΔCT. The fold change (FC) of each sample was calculated compared to ΔCt of the medium control using the formula FC = 2−ΔΔCt, where ΔΔCt = ΔCt sample − ΔCt reference.

Flow cytometry of CD1c+ DC populations

PBMC samples from the two cohorts (HC = 11 samples; AU = 9 samples; IU = 6 samples; BU = 11 samples) were randomly selected and measured by flow cytometry in batches of 9–10 mixed samples per run, divided over 4 days. Per batch, 10 million PBMCs per sample were quickly thawed, washed with ice cold PBS and stained with the antibody panel depicted in Supplementary file 1C. PBMCs were incubated with Fixable Viability Dye eF780 (eBioscience) at room temperature for 10 min. Cells were then plated in V-bottomed plates (Greiner Bioone), washed with PBS and incubated for 30 min at 4°C in the dark with Brilliant Stain Buffer (BD) and the fluorescently conjugated antibodies. Next, the cells were washed and taken up in the FACS buffer. Flow cytometric analyses were performed on the BD FACSAria III sorter. Manual gating of data was done using FlowJo software (TreeStar inc San Carlos, CA, USA). FlowSOM v1.18.0 analysis was done as described previously (Laban et al., 2020). Lineage- (negative for CD3/CD56/CD19) HLA-DR+ data were transformed using the logicleTransform function of the flowCore v1.52.1 R package, using default parameters (Ellis et al., 2020). The SOM was trained for a 7 × 7 grid (49 clusters) with 2000 iterations. Consensus hierarchical clustering was used to annotate clusters, based on the ConsensusClusterPlus v1.50.0 R package (Wilkerson and Hayes, 2010). Principal component analysis (PCA) analysis was done on normalized expression data from flowSOM using the factoextra v 1.0.7.999 R package.

RNA isolation and RNA-sequencing

Total RNA from CD1c+ DC cell lysates from patients and controls was isolated using the AllPrep Universal Kit (QIAGEN) on the QIAcube (QIAGEN) according to the manufacturer’s instructions. For cohort I, RNA-seq libraries were generated by GenomeScan (Leiden, The Netherlands) with the TruSeq RNAseq RNA Library Prep Kit (Illumina Inc, Ipswich, MA, USA), and were sequenced using Illumina HiSeq 4000 generating ~20 million 150 bp paired end reads for each sample. Library preparation and Illumina sequencing was performed on samples of cohort II at BGI (Hong Kong). RNA-seq libraries were generated with the TruSeq RNAseq RNA Library Prep Kit (Illumina Inc, Ipswich, MA, USA) and were sequenced using Illumina NextSeq 500 generating approximately 20 million 100 bp paired end reads for each sample.

Power analysis

We conducted power analysis using the PROPER R package v 1.22.0 (Wu et al., 2015) with 100 simulations of the build-in RNA-seq count data from antigen presenting (B) cells from a cohort of 41 individuals (i.e., large biological variation as expected in our study) (Cheung et al., 2010). Simulation parameters used the default of 20,000 genes and an estimated 10% of genes being differentially expressed. We detected 0.8 power to detect differentially expressed genes (p < 0.05) at a log2(fold change) >1 for the smallest patient group (9 cases) and we considered the sample size reasonable for analysis.

Differential gene expression and statistical analysis

Quality check of the raw sequences was performed using the FastQC tool. Reads were aligned to the human genome (GRCh38 build 79) using STAR aligner (Dobin et al., 2013) and the Python package HTSeq v0.6.1 was used to count the number of reads overlapping each annotated gene (Anders et al., 2015). We aligned the reads of the RNA-sequencing datasets to 65,217 annotated Ensemble Gene IDs. Raw count data were fed into DESeq2 v1.30.1 (Love et al., 2014) to identify differentially expressed genes between the four disease groups (AU, IU, BU, and HC). Using DESeq2, we modeled the biological variability and overdispersion in expression data following a negative binomial distribution. We used Wald’s test in each disease group versus control pairwise comparison and p values were corrected by the DESeq2 package using the Benjamini–Hochberg Procedure. We constructed co-expression gene networks with the WGCNA v 1.70-3 R package (Langfelder and Horvath, 2008) using the cumulative uveitis-associated genes from all pairwise comparisons and a soft power of 5. Module membership (MM) represents the intramodular connectivity of genes in a gene module. Gene Significance (GS >0.25) indicates a strong correlation between genes and non-infectious uveitis, whereas MM (MM >0.8) indicates a strong correlation with the EigenGene value of the modules. We calculated the intersection between the modules constructed from the two cohorts and used Fisher’s exact test to identify modules that exhibited significant overlap in genes. Gene expression data from runx3-knockout (KO) cDC2s, notch2-KO cDC2s, and ‘inflammatory’ cDC2s were obtained from the NCBI Gene Expression Omnibus (accession numbers GSE48590 [2 wild-type [WT] CD11b+ESAM+ splenic cDC2s vs. 2 CD11b+ESAM+ cDC2s from CD11c-DC-Runx3Δ mice], GSE119242 [2 untreated cDC2 vs. untreated cDC2 from CD11c-Cre notch2f/f mice], GSE149619 [5 CD172+MAR1− cDC2s in mock condition vs 3 CD172+MAR1+ cDC2 in virus condition]) using GEO2R in the GEO database, which builds on the GEOquery v2.58.0 and limma R v 3.46 packages (Davis and Meltzer, 2007; Ritchie et al., 2015). RNA-seq data from the mouse bone marrow stromal cell line OP9 expressing NOTCH ligand DLL1 (OP9-DLL1)-driven cDC2 cultures (GSE110577 [2 sorted CD11c+MHCII+B220−CD11b+ cDC2 from bone marrow cultures with FLT3L for 7 days vs. 2 sorted CD11c+MHCII+B220−CD11b +cDC2 from bone marrow cultures with FLT3L+OP9-DLL1 cells for 7 days]) were analyzed using DESeq2 and normalized count data plotted using the plotCounts function. RNA-seq count data from CD14+/− DC3 subsets from patients with SLE and systemic sclerosis were obtained via GEO (accession number: GSE136731) (Dutertre et al., 2019) and differential expression analysis was conducted using DESeq2 v1.30.1. Gene set enrichment analysis was done using the fgsea R package v1.16.0 and data plotted using the GSEA.barplot function from the PPInfer v 1.16.0 R package (Jung and Ge, 2020). Gene sets for runx3-KO, notch2-KO, inflammatory cDC2s, and cDC2s from OP9-DLL1 bone marrow cultures were generated by taking the top or bottom percentiles of ranked [−log10(p) × sign(log2(fold change))] genes from each dataset as indicated. Genes in the modules of interest that encode cell-surface proteins were identified according to surfaceome predictor SURFY (Bausch-Fluck et al., 2018).

Single-cell RNA-seq analysis of aqueous humor

Single-cell RNA-seq (scRNA-seq) data from a previous study of as reported by Kasper et al., 2021 of aqueous humor of four HLA-B27-positive anterior uveitis (identical to the AU group in this study) patients were obtained and downloaded via Gene Expression Omnibus (GEO) repository with the accession code GSE178833. Data were processed using the R package Seurat v4.1.0 (Stuart et al., 2019) using R v4.0.3. We removed low-quality cells (<200 or >2500 genes and mitochondrial percentages <5%) and normalized the data using the SCTransform() function accounting for mitochondrial percentage and cell cycle score (Hafemeister and Satija, 2019). Dimensionality reduction for all cells was achieved by adapting the original UMAP coordinates for each barcode as reported by Kasper et al., 2021 (see GSE178833). Data were subjected to scGate v1.0.0 (Andreatta et al., 2022) using CLEC10A+ and C5AR1 (CD88)− cells in our gating model to purify CD1c+ DCs in the scRNAseq dataset. Dimensionality reduction for CD1c+ DCs was conducted using the R package Seurat, and cells clustered using the FindNeighbors and FindClusters functions from Seurat. After clustering and visualization with UMAP, we used the DotPlot function from the Seurat package to visualize the average expression of genes in each cluster.

Results

A CX3CR1 gene module is associated with non-infectious uveitis

We characterized the transcriptome of primary CD1c+ DCs from patients with non-infectious uveitis (Figure 1A). RNA-seq analysis (RNA-seq) was performed on lineage (CD3−CD19−CD56−CD14−)-negative, and HLA-DR-positive, CD11c and CD1c-positive DCs purified from frozen PBMCs by flow cytometry from 36 patients with anterior (AU), intermediate (IU), or posterior non-infectious uveitis (BU) and healthy controls. A co-expression network was constructed using uveitis-associated genes identified by differential expression analyses (n = 2,016 genes at P<0.05, Figure 1B), which identified six modules, of which 3 were associated with non-infectious uveitis (GS >0.25, Figure 1C). The blue module was most associated with non-infectious uveitis (Figure 1C). Based on Module Membership, CX3CR1 was the top hub gene of the blue module (Figure 1D, Supplementary file 1G). Since CX3CR1 was previously associated with a distinct subset cDC2s that may also express CD14 (Brown et al., 2019; Fujita et al., 2019), we attempted to validate and expand the gene set associated with non-infectious uveitis by MACS-isolating CD1c+ DC cells from fresh blood of 28 patients and 14 healthy controls, followed by RNA-seq analysis of the highly purified CD1c+ DCs (median [interquartile range]% = 96 [3]% pure, Figure 1—figure supplement 1). We also constructed a co-expression network for uveitis-associated genes (n = 6794, p < 0.05) in the second cohort (Figure 1E), which revealed 24 gene modules (Supplementary file 1H). Note that patient samples did not cluster according to clinical parameters of disease activity (e.g., cell grade in eye fluid, macular thickness) (Figure 1—figure supplement 2). The three uveitis-associated modules in cohort I shared a significant number of co-expressed genes with one module in cohort II, the black module (Figure 1F). The black module was associated with non-infectious uveitis in cohort II (GS for uveitis >0.25) and CX3CR1 was also the hub gene for this module (Black Module Membership, p = 5.9 × 10−22; Supplementary file 1H, Figure 1G). According to these findings, the overlapping disease-associated gene modules appear to represent a single gene module. In cohort I, the separation of genes into three modules was possibly due to low sensitivity to detect disease-associated genes with low expression, as replicated genes of the black module were typically higher expressed (Figure 1—figure supplement 3). In total, we replicated 147 co-expressed genes between the two cohorts (which we will refer to as the ‘black module’), of which 94% also showed consistent direction of effect (e.g., upregulated in both cohorts) (Figure 1H, Supplementary file 1I). The black module was enriched for the GO term ‘positive regulation of cytokine production’ (GO:0001819, padj = 6.9 × 10−5). In addition to CX3CR1, the black module comprised CD36, CCR2, TLR-6,-7,-8, CD180, and transcription factors RUNX3, IRF8, and NFKB1 (Figure 1I), but not CD14. In summary, these results show that a gene module characterized by CX3CR1 in blood CD1c+ DCs is associated with non-infectious uveitis.

Figure 1. A CX3CR1 gene module in CD1c+ dendritic cells (CD1c+ DC) is associated with non-infectious uveitis.

(A) Study design. CD1c+ DCs were purified from blood and subjected to RNA-sequencing. Co-expression network analysis was used to identify gene modules associated with uveitis. (B) Principal component analysis (PCA) of the 2016 uveitis-associated genes (p < 0.05) in 36 patients and control samples of cohort I. (C) Gene significance for uveitis for the gene modules identified by WGCNA. (D) Module membership and Gene Significance for uveitis for the blue module of cohort I. (E) PCA of the 6794 uveitis-associated genes (p < 0.05) in 42 samples of cohort II. (F) Cross-tabulation of the preservation of co-expressed genes between gene modules from cohort I and the black module from cohort II. p value is from Fisher’s exact test. (G) Same as in D, but for the black module of cohort II. (H) Heatmaps of the 147 replicated co-expressed genes (rows) for samples (columns) from cohorts I and II. The venn diagram shows the up- and downregulated genes (clusters shown in H). (I) The (log2) fold change in gene expression compared to healthy controls (x-axis) for all 147 replicated genes in patients with AU, IU, and BU. Genes encoding surface proteins are indicated in black/gray. Key transcription factors are indicated in blue. AU: anterior uveitis, IU: intermediate uveitis, BU: birdshot uveitis.

Figure 1.

Figure 1—figure supplement 1. Purity check of cell fractions for RNA-sequencing in cohort II.

Figure 1—figure supplement 1.

Representative sample of flow-cytometry gating of CD14+, CD19+, CD3+, and CD1c+ cell fractions in CD304-depleted, CD19-depleted and CD1c+ enriched magnetic-activated cell sorting (MACS) fractions from fresh peripheral blood mononuclear cells. Manual gating data for each individual sample are available via: https://doi.org/10.34894/9Q0FVO. The percentage of cells positive for each marker on the group levels between the disease groups is indicated in the bottom.
Figure 1—figure supplement 2. Clinical parameters of disease activity in non-infectious uveitis in cohort II.

Figure 1—figure supplement 2.

A principal component analysis (PCA) plot based on the 678 differentially expressed genes (padj < 0.05) (A), the anterior chamber cell grade (B), vitreous fluid cell grade (C), macular thickness in the left (OS) eye as determined by optical coherence tomography (OCT) (D), and macular thickness in the right eye (OD) as determined by OCT (E) are shown.
Figure 1—figure supplement 3. Correlation plot of the mean normalized count (baseMean from DESeq2) of the black module genes from cohort II and the 147 overlapping genes in the blue, yellow, and green module in cohort I.

Figure 1—figure supplement 3.

CX3CR1+ DC3 are diminished in peripheral blood of non-infectious uveitis patients

Type I IFN cytokines promote differentiation of CD1c+ DCs (Dutertre et al., 2019; Girard et al., 2020), but patients with active non-infectious uveitis have reduced blood levels of type I IFN cytokines (Wang et al., 2019; Kuiper et al., 2022). Assessment of the transcriptome of CD1c+ DCs from patients, found no enrichment for genes associated with murine type I IFN-dependent cDC2s (Bosteels et al., 2020; Figure 2A,B). Furthermore, while RUNX3 was downregulated in RNA-seq data from CD1c+ DCs from non-infectious uveitis patients (Figure 1I), stimulation of CD1c+ DCs with from healthy human donors with IFN-alpha resulted in upregulation of RUNX3 (Figure 2—figure supplement 1A). In contrast, the transcriptome of CD1c+ DCs from patients overlapped significantly with murine cDC2s knocked out for Runx3, or its upstream regulator Notch2 (Figure 2, Figure 2—figure supplement 1B ,C; Lewis et al., 2011; Fasnacht et al., 2014; Briseño et al., 2018). Given that cDC2 subsets differ by their dependence on NOTCH signaling (Lewis et al., 2011; Fasnacht et al., 2014; Briseño et al., 2018; Kirkling et al., 2018), we hypothesized that the transcriptomic signatures of the CD1c+ DC pool in patients might reflect changes in their proportions.

Figure 2. The CX3CR1 gene module of CD1c+ DCs is enriched for NOTCH2-RUNX3 signaling.

(A) Volcano plot for the expression of genes of the black module in cDC2s of runx3-KO mice (GSE48590), notch2-KO mice (GSE119242), and type I IFN-dependent inflammatory [inf-]cDC2s (GSE149619). Up- and downregulated genes for each condition are indicated for each condition; gray dots denote the genes with no significant change in expression. (B) Results from gene set enrichment analysis for ranked transcriptomes (using 20,668 genes with baseMean >4) for AU, IU, and BU patients. The top or bottom percentiles of the ranked [−log10(p) × sign(log2(FC))] genes from runx3-KO cDC2s, notch2-KO cDC2s, and inf-cDC2s (see a) were used as gene sets. Normalized enrichment scores (NES) and p values for each gene set are indicated. The dotted lines indicate padj = 0.05. AU: anterior uveitis, IU: intermediate uveitis, BU: birdshot uveitis.

Figure 2.

Figure 2—figure supplement 1. In vitro stimulation of CD1c+ DCs and gene enrichment analysis.

Figure 2—figure supplement 1.

(A) Gene expression (mean [standard error of the mean, SEM]) for RUNX3 and CD36 in primary human CD1c+ DCs from healthy donors stimulated overnight. Each dot represents a single donor used in the experiment. (B) Transcriptomic data (GSE110577, described by Kirkling et al., 2018) of murine bone marrow progenitors cultured for 7 days with OP9 stromal cells that express the NOTCH2 ligand DLL1 or OP-9 cells without DLL1. This analysis revealed that notch2-controlled genes were enriched in the transcriptome of CD1c+ DCs of patients and that notch2-signaling associates with the expression of cd36, ccr2, and cx3cr1 in cDC2s. Normalized counts (and adjusted p values from DESeq2) for cx3cr1, ccr2, cd36, and runx3 from cDC2s generated from murine bone marrow cells and OP-9 with (in blue) or without (in ochre) Notch ligand Delta-like 1 (DLL1). (C) Gene set enrichment analysis using the top 1% (n = 201) genes associated with the NOTCH-negative condition in b as the gene set. R848: Resiquimod, LTA: lipoteichoic acid, LPS: lipopolysaccharides, Pam3CSK4: Pam3CysSerLys4, OxLDL: oxidized low-density lipoprotein, IFNα: interferon alpha, TGFβ: transforming growth factor beta, FLT3L: FMS-like tyrosine kinase 3 ligand, TNFα: tumor necrosis factor alpha, S100A12: S100 calcium-binding protein A12, IL-4: interleukin 4, GM-CSF: granulocyte-macrophage colony-stimulating factor.

Therefore, we used flow-cytometry analysis to identify CD1c+ DC clusters in PBMCs samples from 26 cases and 11 controls. We designed a panel based on the black module (CX3CR1, CD36, CCR2, and CD180), other CD1c+ DC markers that were not in the black module (CD1c, CD11c, CD14, CD5, and CD163) (Dutertre et al., 2019; Korenfeld et al., 2017). FlowSOM (Van Gassen et al., 2015) was used on HLA-DR+ and lineage (CD3/CD19/CD56)− PBMCs to cluster cells into a predetermined number of 49 clusters (7 × 7 grid) to facilitate detection of CD1c+ DC phenotypes in blood. The analysis with flowSOM clearly distinguished four CD1c+ DC clusters (cluster number 22, 37, 44, and 45) (Figure 3A and Figure 3—figure supplement 1A and B). We extracted the data for these four CD1c+ DC clusters and conducted principal component analysis (PCA). The PCA biplot identified CD5 and CD163 as top loadings (Figure 3—figure supplement 1C), which defines the DC2s (cluster 45), CD5−CD163− DC3s (cluster 37), and CD5−CD163+ DC3s (clusters 22 and 44) (Dutertre et al., 2019; Figure 3B, C). Among the identified clusters, we detected a significant reduction in the frequency of cluster 44 in patients compared to controls (Welch t-test, p = 0.03, Figure 3D and Figure 3—figure supplement 1D). Clusters 44 as well as cluster 22 were CD36 and CD14 positive, which indicates these clusters may represent CD14+ DC3s in human blood (Dutertre et al., 2019). However, cluster 44 had relatively higher levels of CX3CR1 than cluster 22 (Figure 3E, F). This suggests that DC3s may be phenotypically bifurcated by CX3CR1 independently of CD14. This is supported by weak correlation between CD14 and CX3CR1 in our RNA-seq data from bulk CD1c+ DCs (Pearson correlation coefficient = 0.35, Figure 3—figure supplement 2A). In addition, we sorted CD14-positive and -negative fractions from CD1c+ DCs of six healthy donors (Figure 3—figure supplement 2B) which showed no significant difference in expression levels for CX3CR1 (Figure 3—figure supplement 2C). CX3CR1 levels were also not significantly different in sorted CD5−CD163+CD14-positive and CD14-negative DC3s from patients with autoimmune diseases, further indicating that CX3CR1 expression in CD1c+ DCs may be independent from CD14 expression in CD1c+ DCs (Figure 3—figure supplement 2D).

Figure 3. CX3CR1+ DC3s are decreased in the blood of patients with non-infectious uveitis.

(A) Heatmap of the surface protein expression for 49 flowSOM clusters of flow-cytometry analysis of PBMC samples from 26 patients and 11 controls. The four CD1c+ (CD3−CD19−CD56−HLA-DR+CD11c+) DC clusters identified (clusters 22, 37, 44, and 45) are shown (detailed heatmap in Figure 3—figure supplement 1A). (B) Biplot of the normalized surface expression of CD5 and CD163 for the four CD1c+ DC clusters. (C) Correlation plot between manually gated CD5−CD163− DC3s and CD5−CD163+ DC3s and DC3 flowSOM clusters 22, 37, and 44. (D) The frequency of the 4 CD1c+ DC flowSOM clusters as percentage of PBMCs. p values from Welch’s t-test. (E) Principal component analysis (PCA) biplot of the DC3 clusters 22, 37, and 44. Loadings for PC1 and PC2 are shown on the right. (F) Biplots of the normalized surface expression of CD36, CD14, and CX3CR1 in the DC3 clusters 22, 37, and 44. (G) Manual gating strategy of CD1c+ DC subsets based on CD36 and CX3CR1 in PBMCs in uveitis cases and controls. p value from Welch’s t-test. Details on manual gating strategy: see Figure 3—figure supplement 3. Manual gating revealed that the CD14+CD1c+ DCs (DC3s) can be further subdivided in a CX3CR1− and a CX3CR1+ population.

Figure 3.

Figure 3—figure supplement 1. Flow cytometry analysis of peripheral blood CD1c+ DC subsets in non-infectious uveitis.

Figure 3—figure supplement 1.

(A) Heatmap of the surface protein expression for 49 flowSOM clusters of flow-cytometry analysis of PBMC samples from 26 patients and 11 controls. The four CD1c+ (CD3−CD19−CD56−HLA-DR+CD11c+) DC clusters identified (clusters 22, 37, 44, and 45) are highlighted. (B) Biplot of the cell surface expression of CD1c and CD11c for the 49 flowSOM clusters in a. (C) Principal component analysis (PCA) biplot of the surface protein expression for clusters 22, 37, 44, and 45 identified in a. (D) The proportion of the four CD1c+ DC clusters in the HLA-DR+Lin−(CD3−CD19−CD56) population in controls and patients. (E) Manual gating strategy of CD1c+ DC subsets based on CD36 and CX3CR1 and the correlation between CD36+CX3CR1+CD1c+ DCs and the flowSOM cluster 44. R = Spearman correlation. Gray area represents the 95% confidence interval of the linear regression line. (F) The relative proportion of CD1c+ DC subsets based on CD36 and CX3CR1 in the HLA-DR+ Lin− gate.
Figure 3—figure supplement 2. Gene expression profiling of CD14+ and CD14- populations of CD1c+ DCs.

Figure 3—figure supplement 2.

(A) Correlation plot of the gene expression levels of CD14, CD36, CCR2, CX3CR1, and the EigenGene value of the black module. (B) Gating strategy to sort CD14+ and CD14−CD1c+ DCs from healthy donors. (C) Real-time PCR (RT-qPCR) results for a panel of genes of the black module in the sorted CD14+ and CD14−CD1c+ DC fractions in a. padj = adjusted p values from t-test (Bonferroni) corrected for seven genes. (D) Volcano plot showing differential expression analysis for black module genes in CD14+ versus CD14− DC3s purified from systemic lupus erythematosus (SLE) and SSc patients (GSE136731).
Figure 3—figure supplement 3. Representative sample of flow-cytometry gating of CD14+ and CD14− fractions of CD1c+ DCs in peripheral blood for the panel used in Figure 3.

Figure 3—figure supplement 3.

We validated by manual gating that cluster 44 represents the CD36+CX3CR1+ fraction of CD1c+ DCs in peripheral blood (~25% of total CD1c+ DCs) (Figure 3—figure supplement 1E). Comparison between patients and controls corroborated that the frequency of manual gated CD36+CX3CR1+ DC3s were decreased in the blood of non-infectious uveitis patients (Welch t-test, p = 0.029, Figure 3G). In detail, we show that CD14+CD1c+ DCs double positive for CD36+ and CX3CR1 were significantly decreased (p = 0.026), while CD14+CD1c+ DCs not positive for CX3CR1 were not (p = 0.43) (Figure 3G). This supports that CX3CR1 discerns a phenotypic subpopulation of CD14+ DC3s (Figure 3—figure supplement 3), that was diminished in the blood of patients with non-infectious uveitis.

CX3CR1+ DC3s can secrete pro-inflammatory cytokines upon stimulation

We compared the cytokine-producing abilities of CX3CR1+ DC3s to their negative counterparts since the gene module associated with CX3CR1 was enriched for genes involved in cytokine regulation. To this end, we freshly sorted primary human CD1c+ DC subsets based on the surface expression of CX3CR1 and CD36, of which double-positive and -negative subsets could be sorted from the selected healthy subjects in sufficient numbers for analysis (Figure 4—figure supplement 1). Since CD36 is involved in LTA-induced cytokine production (Jimenez-Dalmaroni et al., 2009), we overnight stimulated the CD1c+ subsets with LTA. Both subsets of CD1c+ DCs secreted IL-23 equally strongly (Figure 4A). To assess the secretome of the CD1c+ DC subsets in more detail, we profiled the supernatants of LTA-stimulated CD1c+ DC subsets for additional soluble immune mediators (Supplementary file 1E): The CD1c+ DC subsets could be distinguished based on the secreted protein profile (Figure 4B), of which the levels of TNF-alpha, IL-6, VEGF-A, and TNFR1 showed significant differences between the subsets (Figure 4C). These results show that CD1c+ DC subsets defined on the basis of surface co-expression of CD36 and CX3CR1 have the capacity to secrete pro-inflammatory mediators that participate in the pathophysiology of human non-infectious uveitis.

Figure 4. CX3CR1+ DC3s secrete high levels of cytokines implicated in non-infectious uveitis.

(A) The CD1c+ DC cells were fluorescent-activated cell sorting (FACS) sorted into CD36+CX3CR1+ and CD36−CX3CR1−CD1c+ DCs (Figure 4—figure supplement 1). The concentration of IL-23 (ELISA) in supernatants of 18 hr cultured primary human CD1c+ DC subsets cells stimulated with lipoteichoic acid (LTA). (B) Heatmap of the levels (Z-score) of 16 detected proteins in supernatants of 18 hr cultured LTA-stimulated primary human CD1c+ DC subsets cells using an in-house multiplex Luminex assay (Supplementary file 1E). (C) Scatter plots with overlay boxplot with mean and interquartile range of the levels of secreted TNF-alpha, interleukin (IL)-6, VEGF-A, and TNFR1 from the multiplex protein data in d (padj = p values from likelihood ratio test Bonferroni corrected for 16 detected proteins).

Figure 4.

Figure 4—figure supplement 1. Representative examples of fluorescent-activated cell sorting (FACS) of CD36+CX3CR1+ DC3s and CD36−CX3CR1−CD1c+ DCs used for the analysis in Figure 4.

Figure 4—figure supplement 1.

CX3CR1+ DC3s are detectable in the inflamed eye during non-infectious uveitis

We speculated that CX3CR1+ DC3s are important in the disease mechanisms of uveitis and may be found at increased abundance in the eye during active uveitis. We used single-cell RNA-sequencing data (scRNA-seq) of eye fluid biopsies of four noninfectious patients from Kasper et al., 2021. Cells positive for the CD1c+ DC-specific tissue-marker CLEC10A and negative for the monocyte marker C5AR1 (CD88) (Dutertre et al., 2019; Bourdely et al., 2020; Heger et al., 2018) were used to identify CD1c+ DCs among other immune cells in the scRNA-seq data (Figure 5A). Unsupervised clustering identified three clusters (1, 2, and 3) of different cells within the CD1c+ DC population (Figure 5B). We identified that cluster 1 expressed the gene profile associated with CX3CR1+ DC3s, including relatively higher levels of CX3CR1, CD36, CCR2, and lower levels of RUNX3 compared to the other two CD1c+ DC clusters (Figure 5C), which is in line with the gene profile identified by our bulk RNA-seq analysis. In summary, we conclude that CD1c+ DCs with a gene expression profile similar to CX3CR1+ DC3s can be detected in the eyes of patients during active non-infectious uveitis.

Figure 5. Cells with a gene profile similar to CX3CR1+ DC3s can be found in the inflamed eye during non-infectious uveitis.

Figure 5.

(A) Single-cell RNA-sequencing (scRNAseq) analysis of eye fluid biopsies from non-infectious uveitis patients (GSE178833, reported by Kasper et al., 2021). UMAP projections of transcriptomic data from 492 cells (in red) identified by scGate analysis using CLEC10A+ and C5AR1− cells as tissue markers to identify CD1c+ DCs. (B) Unsupervised clustering of CLEC10A+C5AR1− DCs identified in a. (C) Dot plot showing average expression (color-scaled) of key marker genes of the black module and CD14 in each cluster determined in b.

Discussion

In this study of non-infectious uveitis patients and controls, we identified and replicated a CX3CR1-associated gene module in CD1c+ DCs. We were able to track back the gene module to a CX3CR1+ DC3 subset that was diminished in peripheral blood of patients with non-infectious uveitis.

Preceding studies into human CD1c+ DCs revealed functionally distinct subsets termed ‘DC2’ and ‘DC3’, with the DC3 showing both transcriptomic features reminiscent of cDC2s and monocytes – such as elevated CD36 (Villani et al., 2017; Dutertre et al., 2019). DC3s also have distinct developmental pathways and transcriptional regulators compared to DC2 (Villani et al., 2017; Dutertre et al., 2019; Cytlak et al., 2020; Bourdely et al., 2020). Recently, Cytlak et al. revealed that lower expression of IRF8 is linked to DC3 (Cytlak et al., 2020), a transcription factor that was also decreased in non-infectious uveitis. According to Brown et al., 2019, CD1c+ DCs exhibit two subsets: cDC2A and cDC2B, whereas cDC2B exhibits higher expression of CX3CR1 and produces more TNF-alpha and IL-6 than cDC2A upon stimulation. Accordingly, uveitis-associated CX3CR1+ DC3s described in this study exhibit similar phenotypical and functional features.

Dutertre et al., 2019 showed that the phenotype of peripheral blood CD1c+ DCs can be further segregated according to the expression of CD163 and CD5, with ‘DC3’ cells being characterized as CD5−CD163− or CD5−CD163+ cells and ‘DC2’ as CD5+CD163 cells. Our flow-cytometry results confirm these findings, but we also show that CD5−CD163+ DC3s that express CD14 are composed of CX3CR1-positive and CX3CR1-negative cells, of which the CX3CR1+ population is implicated in non-infectious uveitis.

Single-cell analysis supported that CD1c+ DCs in eye fluid of patients with non-infectious uveitis contain also a population that has a gene profile reminiscent of CX3CR1+ DC3s, with relatively higher levels of CX3CR1, CD36, CCR2, and lower levels of RUNX3. Patients with SLE display accumulation of CD14+ DC3s in blood (Dutertre et al., 2019), while the population of CD14+ DC3 cells was decreased in non-infectious uveitis patients. The differences between non-infectious uveitis and SLE may be related to distinct (i.e., opposite) immunopathological mechanisms; Type I IFNs drive the maturation of cDC2s into ‘inflammatory cDC2s’ (infcDC2s) (Bosteels et al., 2020) and can induce CD1c+ DCs to express a distinct set of surface receptors (Girard et al., 2020). The type I IFN-α drives immunopathology of SLE and administration of type I IFN therapy can induce lupus-like disease (Rönnblom et al., 1991; Rönnblom et al., 1990). In favor of attributing the seemingly contrasting observations in blood CD1c+ subsets between SLE and non-infectious uveitis to distinct biology is the fact that, in contrast to elevated IFN-α in patients with SLE, in non-infectious uveitis patient’s disease exacerbations correlate with reduced blood type I IFN concentrations (Wang et al., 2019; Kuiper et al., 2022; Obermoser and Pascual, 2010). Despite the importance of type I IFN signaling on DC3s, our results suggest that DC3s are also dysregulated in conditions associated with decreased type I IFNs (Wang et al., 2019; Kuiper et al., 2022), supporting additional pathways involved in DC3 regulation during chronic inflammation.

We showed that the gene module of CD1c+ DCs showed overlap with the gene signature of disrupted NOTCH2 signaling in cDC2s. Notch2 signaling is mediated via the NF-κB family member Relb in murine cDC2s (Diener et al., 2021). NF-κB signaling via RelB suppresses type I IFN signaling in cDC2s (Saha et al., 2020) while selective deletion of RelB in dendritic cells protects against autoimmunity (Diener et al., 2021; Andreas et al., 2019). It is tempting to speculate that the enrichment for NOTCH gene signatures implies altered NF-κB-Relb signaling in CD1c+ DCs, with a mechanism that varies between diseases mediated by type I IFNs (e.g., SLE) and type I IFN-negative diseases (e.g., uveitis). Although this warrants further investigation, some circumstantial evidence for this is the presence of NF-κB family members in the black module, such as NFKB1 and NFKBIA, the former associated previously with a CX3CR1+ cDC2s, while the latter can regulate Relb function in dendritic cells (Shih et al., 2012; Sun, 2011). NF-κB-Relb signaling has been shown to suppress type I IFN via a histone demethylase encoded by KDM4A which was also in the black module (Jin et al., 2014). Regardless, the NF-κB pathways are regulated by the TNFR1, the main receptor for TNF-alpha (Hayden and Ghosh, 2014; Maney et al., 2014). TNFR1 is expressed at the cell surface of cDC2s and its ectodomain cleaved by the NOTCH2-pathway regulator ADAM10 (Maney et al., 2014; Yang et al., 2016; Iberg et al., 2022). We showed that both TNF-alpha and sTNFR1 were higher in the secretome of activated CX3CR1+ DC3s. This is in agreement with previous studies on CD36+ DC3s (Villani et al., 2017) or CX3CR1+ cDC2B (T-bet−) that also produced higher levels of TNF-alpha (Brown et al., 2019). Interestingly, altered NF-κB signaling specifically in cDC2 is associated with clinical response to anti-TNF-alpha therapy (Andres-Ejarque et al., 2021). Anti-TNF therapy is effective for treatment of non-infectious uveitis (Touhami et al., 2019), while anti-TNF therapy may also result in a dysregulated type I IFN response (Conrad et al., 2018) indicating potentially cross regulatory mechanisms via NF-κB signaling and type I IFN signaling affecting cDC2s. More research is needed to resolve the regulatory mechanisms driving CD1+ DC changes in type I IFN-negative inflammation, including non-infectious uveitis. It is also possible that the change in CD1c+ DCs observed in this study results from cytokine-induced precursor emigration or differentiation or that the affected peripheral blood DC3s marked by CX3CR1 are in a precursor or pre-activation state.

Other disease modifying factors possibly affect the CD1c+ DC pool in uveitis patients. In mice, antibiotic treatment to experimentally disturb the microbiota affects a cDC2 subset phenotypically similar to CD1c+ DCs and decreases their frequency in the intestine of mice, which suggests microbiota-dependent signals involved in the maintenance of cDC2 subsets (Brown et al., 2019). This is especially interesting in light of growing evidence that microbiota-dependent signals cause autoreactive T cells to trigger uveitis (Horai et al., 2015), which makes it tempting to speculate that gut-resident cDC2 subsets contribute to the activation of T cells in uveitis models. Dietary components can influence subsets of intestinal dendritic cells (Ko et al., 2020). Regardless, most likely, an ensemble of disease modulating factors is involved. For example, myeloid cytokines, such as GM-CSF, contribute to autoimmunity of the eye (Croxford et al., 2015) and GM-CSF has been shown to stimulate the differentiation of human CD1c+ subset from progenitors (Bourdely et al., 2020). However, GM-CSF signaling in conventional dendritic cells has a minor role in the inception of EAU (Bing et al., 2020). Our data support that stimulation of CD1c+subsets with GM-CSF or TLR ligands does not induce the transcriptional features of CD1c+ DCs during non-infectious uveitis, which is in line with previous observations that support that stimulated cDC2s do not convert from one into another subset (Bourdely et al., 2020).

Note that our results of a decreased subset of CD1c+ DCs in non-infectious uveitis are in contrast with previous flow-cytometry reports in non-infectious uveitis (Chen et al., 2016; Chen et al., 2015a; Chen et al., 2014). Chen et al., 2014 reported an increase of CD1c+ myeloid dendritic cells in non-infectious uveitis. It is important to note, however, that their study did not include the DC marker CD11c, thereby including CD1c+CD11c− populations that do not cluster phenotypically with CD1c+ (CD11c+) DCs (e.g., cluster 46, se Figure 3—figure supplement 1A), which may explain the differences compared to our study.

Better understanding of the changes in the CD1c+ DC pool during human non-infectious uveitis will help develop strategies to pharmacologically influence putative disease pathways involved at an early disease stage, which may lay the foundation for the design of effective strategies to halt progress toward severe visual complications or blindness. Perhaps targeting CD1c+ DCs may be achieved by dietary (microbiome) strategies and provide relatively safe preventive strategies for non-infectious uveitis.

To conclude, we have found that peripheral blood CD1c+ DCs have a gene module linked to a CX3CR1-positive CD1c+ DC subset implicated in non-infectious uveitis.

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Biological sample (Homo sapiens) Aqueous humor (AqH) Department of Ophthalmology,
University Medical Center Utrecht,
Utrecht, The Netherlands
Biological sample (Homo sapiens) Blood Plasma (EDTA tubes) Department of Ophthalmology,
University Medical Center Utrecht,
Utrecht, The Netherlands
Antibody Anti-human CD14-FITC Clone:
TÜK4 (mouse monoclonal)
Miltenyi CAT# 130-080-701 (Dilution:) 1:50
Antibody Anti-human CCR2-BV421 Clone:
K036C2 (mouse monoclonal)
BioLegend CAT# 357210 (Dilution:) 1:150
Antibody Anti-human CD11c-PerCP-Cy5.5
Clone: Bu15 (mouse monoclonal)
BioLegend CAT# 337210 (Dilution:) 1:200
Antibody Anti-human CD123-FITC Clone:
6 H6 (mouse monoclonal)
eBioscience CAT# 11-1239-42 (Dilution:) 1:20
Antibody Anti-human CD14-PerCP-Cy5.5
Clone: HCD14 (mouse monoclonal)
BioLegend CAT# 325622 (Dilution:) 1:100
Antibody Anti-human CD14-BV785 Clone:
M5E2 (mouse monoclonal)
BioLegend CAT# 301840 (Dilution:) 1:100
Antibody Anti-human CD141 BDCA3-APC Clone:
AD5-14H12 (mouse monoclonal)
Miltenyi CAT# 130-090-907 (Dilution:) 1:20
Antibody Anti-human CD163-BV510 Clone:
GHI/61 (mouse monoclonal)
BioLegend CAT# 333628 (Dilution:) 1:25
Antibody Anti-human CD180-PE/Cy7 Clone:
MHR73-11 (mouse monoclonal)
BioLegend CAT# 312910 (Dilution:) 1:100
Antibody Anti-human CD19-eF450 Clone:
HIB19 (mouse monoclonal)
eBioscience CAT# 48-0199-42 (Dilution:) 1:25
Antibody Anti-human CD19-BV605 Clone:
SJ25C1 (mouse monoclonal)
BD CAT# 562653 (Dilution:) 1:50
Antibody Anti-human CD19-AF700 Clone:
HIB19 (mouse monoclonal)
eBioscience CAT# 56-0199-42 (Dilution:) 1:50
Antibody Anti-human CD1c-APC Clone:
L161 (mouse monoclonal)
eBioscience CAT# 17-0015-42 (Dilution sorting cohort 2:) 1:50
Antibody Anti-human CD1c BDCA1-BV421 Clone:
L161 (mouse monoclonal)
BioLegend CAT# 331526 (Dilution:) 1:25
Antibody Anti-human CD1c BDCA1-APC Clone:
L161 (mouse monoclonal)
eBioscience CAT# 17-0015-42 (Dilution purity check cohort 1:) 1:20
Antibody Anti-human CD20-PE Clone: 2 H7
(mouse monoclonal)
eBioscience CAT# 12-0209-42 (Dilution:) 1:50
Antibody Anti-human CD3-AF700 Clone: UCHT1
(mouse monoclonal)
BioLegend CAT# 300424 (Dilution:) 1:50
Antibody Anti-human CD304 BDCA4-PE Clone:
AD5-17F6 (mouse monoclonal)
Miltenyi CAT# 130-090-533 (Dilution:) 1:20
Antibody Anti-human CD36-PE Clone: CB38
(mouse monoclonal)
BD CAT# 555455 (Dilution:) 1:200
Antibody Anti-human CD4-BV711 Clone: OKT4
(mouse monoclonal)
BioLegend CAT# 317440 (Dilution:) 1:50
Antibody Anti-human CD45-PerCP Clone: HI30
(mouse monoclonal)
BioLegend CAT# 304026 (Dilution:) 1:100
Antibody Anti-human CD5-BB515 Clone: UCHT2
(mouse monoclonal)
BD CAT# 564647 (Dilution:) 1:100
Antibody Anti-human CD56-AF700 Clone: B159
(mouse monoclonal)
BD CAT# 557919 (Dilution:) 1:50
Antibody Anti-human CD8-V500 Clone: RPA-T8
(mouse monoclonal)
BD CAT# 560774 (Dilution:) 1:50
Antibody Anti-human CX3CR1-PE/Dazzle594 Clone:
2 A9-1 (rat monoclonal)
BioLegend CAT# 341624 (Dilution:) 1:100
Antibody Anti-human HLA-DR-BV605 Clone:
G46-6 (mouse monoclonal)
BD CAT# 562845 (Dilution:) 1:150
Other Viability dye and labelling reagent.
Live/Dead-APC-eF780
eBioscience CAT# 65-0865-14 (Dilution:) 1:1000
Chemical compound, drug R848 Invivogen CAT# tlrl-r848 (Concentration:) 1 µg/ml
Chemical compound, drug Lipoteichoic acid (LTA) Sigma-Aldrich CAT# L2515-5MG (Concentration:) 1 µg/ml
Chemical compound, drug Lipopolysaccharide (LPS) Invivogen CAT# tlrl-3pelps (Concentration:) 10 ng/ml
Chemical compound, drug Pam3CSK4 Invivogen CAT# tlrl-pms (Concentration:) 5 µg/ml
Chemical compound, drug oxLDL Cell Biolabs CAT# STA-214 (Concentration:) 50 µg/ml
Chemical compound, drug TGFβ-b2 R&D Systems CAT# 302-B2-002/CF (Concentration:) 100 ng/ml
Chemical compound, drug FLT3L Cellgenix CAT# 1415-05 (Concentration:) 100 ng/ml
Chemical compound, drug TNFα R&D Systems CAT# 210-TA-020 (Concentration:) 100 ng/ml
Chemical compound, drug S100A12 (EN-RAGE) R&D Systems CAT# 1052-ER-050 (Concentration:) 1 µg/ml
Chemical compound, drug IL-4 R&D Systems CAT# 204-IL-50 (Concentration:) 10 ng/ml
Chemical compound, drug IFNα-2a Cell Sciences CAT# CRI003B (Concentration:) 1000 U/ml
Chemical compound, drug GM-CSF R&D Systems CAT# 215 GM-500 (Concentration:) 800 U/ml
Commercial assay or kit Olink Target 96 Immuno-Oncology Olink CAT# 95311 Olink Targeted Proteomics analysis
Commercial assay or kit TruSeq RNA Library Prep Kit Illumina CAT#RS-122-2001 RNA-seq
Commercial assay or kit AllPrep DNA/RNA/miRNA Universal Kit QIAGEN CAT# 80224 RNA isolations
Commercial assay or kit CD1c (BDCA-1)+Dendritic
Cell Isolation Kit, human
Miltenyi Biotec CAT#130-119-475 isolation of CD1c+ DCs from PBMCs.
Commercial assay or kit CD19 MicroBeads, human Miltenyi Biotec CAT#130-050-301 Depletion of CD19+ B cells from PBMCs
Commercial assay or kit CD304 (BDCA-4/Neuropilin-1)
MicroBead Kit, human
Miltenyi Biotec CAT#130-090-532 Depletion of plasmacytoid dendritic cells from PBMCs
Commercial assay or kit Human IL-23 Quantikine ELISA Kit R&D Systems CAT# D2300B Quantification of IL-23 in supernatant of CD1c+ DC cultures
Recombinant DNA reagent CD36 FW (Sequence 5′–3′)
AAAGAGGTCCTTATACGTACAGAGTTCGT
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CD36 RV (Sequence 5′–3′)
AGCCTTCTGTTCCAACTGATAGTGA
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent RUNX3 FW (Sequence 5′–3′)
CAATGACGAGAACTACTCCGC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent RUNX3 RV (Sequence 5′–3′)
GAAGCGAAGGTCGTTGAACC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent GUSB FW (Sequence 5′–3′)
CACCAGGGACCATCCAATACC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent GUSB RV (Sequence 5′–3′)
GCAGTCCAGCGTAGTTGAAAAA
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CCR2 FW (Sequence 5′–3′)
CCACATCTCGTTCTCGGTTTATC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CCR2 RV (Sequence 5′–3′)
CAGGGAGCACCGTAATCATAATC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CX3CR1 FW (Sequence 5′–3′)
AGTGTCACCGACATTTACCTCC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CX3CR1 RV (Sequence 5′–3′)
AAGGCGGTAGTGAATTTGCAC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent IRF8 FW (Sequence 5′–3′)
CGACGCGCACCATTCA
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent IRF8 RV (Sequence 5′–3′)
GCTTGCCCCCATAGTAGAAGCT
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent TLR7 FW (Sequence 5′–3′)
CAAGAAAGTTGATGCTATTGGGC
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent TLR7 RV (Sequence 5′–3′)
TGGTTGAAGAGAGCAGAGCA
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CCR5 FW (Sequence 5′–3′)
TGCTACTCGGGAATCCTAAAAACT
Integrated DNA Technologies qPCR primer
Recombinant DNA reagent CCR5 RV (Sequence 5′–3′)
TTCTGAACTTCTCCCCGACAAA
Integrated DNA Technologies qPCR primer
Software, algorithm R Project for Statistical Computing;
R version 4.0.3 (2020-10-10)
https://www.r-project.org/ RRID:SCR_001905 RNA-seq,flowSOM, statistical analysis
Software, algorithm FlowJo v10.6.1 BD Biosciences;
https://www.flowjo.com/solutions/flowjo
RRID:SCR_008520 Flow cytometry
Software, algorithm Seurat v3.1.5 Stuart et al., 2019;
http://seurat.r-forge.r-project.org/
RRID:SCR_007322 scRNA-seq analysis
Software, algorithm DESeq2 v1.30.1 https://bioconductor.org/packages/release/bioc/html/DESeq2.html RRID:SCR_015687 RNA-seq analysis
Software, algorithm WGCNA v 1.70-3 http://www.genetics.ucla.edu/labs/horvath/CoexpressionNetwork/ RRID:SCR_003302 Co-expression network analysis
Software, algorithm flowSOM https://github.com/SofieVG/FlowSOM, Van Gassen et al., 2023 RRID:SCR_016899 Flowcytometry analysis using a Self-Organizing Map.
Software, algorithm UCell v1.3.1 https://github.com/carmonalab/UCell, Andreatta and Carmona, 2023 scRNAseq Module score
Software, algorithm scGate v1.0.0 https://github.com/carmonalab/scGate, Andreatta et al., 2023 Purification of intraocular CD1c+ DCs in scRNAseq data

Funding Statement

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Contributor Information

Jonas JW Kuiper, Email: j.j.w.kuiper@umcutrecht.nl.

Lynn M Hassman, Washington University School of Medicine, United States.

Betty Diamond, The Feinstein Institute for Medical Research, United States.

Funding Information

This paper was supported by the following grants:

  • UitZicht #2014-4 to Jonas JW Kuiper.

  • UitZicht #2019-10 to Jonas JW Kuiper.

  • UitZicht #2021-4 to Jonas JW Kuiper.

Additional information

Competing interests

No competing interests declared.

was a principal investigator in the immune catalyst program of GlaxoSmithKline, which was an independent research program. He did not receive any financial support. Currently, TR is an employee of Abbvie where he holds stock. TR had no part in the design and interpretation of the study results after he started at Abbvie.

Author contributions

Resources, Formal analysis, Validation, Investigation, Methodology, Writing – original draft, Patient inclusions and dendritic cell purifications and dendritic cell cultures.

Formal analysis, Validation, Investigation, Methodology.

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Patient inclusions and dendritic cell purifications.

Formal analysis, Methodology.

Resources, Formal analysis, Validation, Writing – review and editing, Dendritic cell cultures.

Formal analysis, Methodology, Knock-down experiments and dendritic cell cultures.

Data curation, Supervision, Investigation, Methodology, Project administration.

Conceptualization, Funding acquisition, Project administration.

Conceptualization, Resources, Data curation, Funding acquisition, Investigation, Writing – review and editing.

Conceptualization, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing.

Ethics

This study was conducted in compliance with the Helsinki principles. Ethical approval was requested and obtained from the Medical Ethical Research Committee in Utrecht. All patients signed written informed consent before participation (METC protocol number #14-065/M).

Additional files

Transparent reporting form
Supplementary file 1. Supplementary tables.

(A) Antibody panel used for sorting peripheral blood mononuclear cells. (B) Antibody panel used for determination of CD1c+ DC purity after MACS isolation. (C) Antibody panel used for phenotyping cDC2 populations in uveitis patients. (D) Overview of stimuli used for CD1c+ DC stimulations in Figure 3C. (E) Luminex analysis supernatant of LTA-stimulated CD1c+ DC sorted fraction (protein levels are in pg/mL). (F) Sequences of primers used for RT-qPCR. (G) Results from differential expression analysis and co-expression network analysis in cohort I. (H) Results from differential expression analysis and co-expression network analysis in cohort II. (I) 147 replicated co-expressed genes for cohort 1 and cohort 2

elife-74913-supp1.xlsx (21.2MB, xlsx)

Data availability

All raw data and data scripts are available via dataverseNL: https://doi.org/10.34894/9Q0FVO and deposited in NCBI's Gene Expression Omnibus accessible through GEO Series accession numbers GSE195501 and GSE194060.

The following datasets were generated:

Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients [Replication cohort] NCBI Gene Expression Omnibus. GSE195501

Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients. NCBI Gene Expression Omnibus. GSE194060

Kuiper JW. 2022. Data and R Scripts for: "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis". DataverseNL.

The following previously published datasets were used:

Dicken J, Mildner A, Leshkowitz D, Touw IP. 2014. The affect of specific ablation of Runx3 from Esam splenic dendritic cells. NCBI Gene Expression Omnibus. GSE48590

Briseño CG, Satpathy AT. 2018. Trancriptional profile of WT and Notch2 cDC2s after immunization with SRBC. NCBI Gene Expression Omnibus. GSE119242

Bosteels C, Neyt K, Vanheerswynghels M, van Helden MJ. 2020. Inflammatory Type 2 cDCs Acquire Features of cDC1s and Macrophages to Orchestrate Immunity to Respiratory Virus Infection. NCBI Gene Expression Omnibus. GSE149619

Kirkling ME, Cytlak U, Lau CM, Lewis KL. 2018. Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells. NCBI Gene Expression Omnibus. GSE110577

Kasper M, Heming M, Heiligenhaus A, Meyer zu Hörste G. 2021. Intraocular dendritic cells characterize HLA-B27-associated acute anterior uveitis. NCBI Gene Expression Omnibus. GSE178833

References

  1. Anders S, Pyl PT, Huber W. HTSeq -- a python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31:166–169. doi: 10.1093/bioinformatics/btu638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andreas N, Potthast M, Geiselhöringer AL, Garg G, de Jong R, Riewaldt J, Russkamp D, Riemann M, Girard JP, Blank S, Kretschmer K, Schmidt-Weber C, Korn T, Weih F, Ohnmacht C. RelB deficiency in dendritic cells protects from autoimmune inflammation due to spontaneous accumulation of tissue t regulatory cells. Journal of Immunology. 2019;203:2602–2613. doi: 10.4049/jimmunol.1801530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Andreatta M, Berenstein AJ, Carmona SJ. ScGate: Marker-based purification of cell types from heterogeneous single-cell RNA-seq datasets. Bioinformatics. 2022;38:2642–2644. doi: 10.1093/bioinformatics/btac141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Andreatta M, Berenstein AJ, Carmona SJ. Scgate: Marker-based purification of cell types from heterogeneous single-cell RNA-Seq Datasets. c110b07GitHub. 2023 doi: 10.1093/bioinformatics/btac141. https://github.com/carmonalab/scGate [DOI] [PMC free article] [PubMed]
  5. Andreatta M, Carmona SJ. UCell: robust and scalable single-cell gene signature scoring. 0287287GitHub. 2023 doi: 10.1016/j.csbj.2021.06.043. https://github.com/carmonalab/UCell [DOI] [PMC free article] [PubMed]
  6. Andres-Ejarque R, Ale HB, Grys K, Tosi I, Solanky S, Ainali C, Catak Z, Sreeneebus H, Saklatvala J, Dand N, de Rinaldis E, Chapman A, Nestle FO, Barnes MR, Warren RB, Reynolds NJ, Griffiths CEM, Barker JN, Smith CH, Di Meglio P, PSORT Consortium Enhanced NF-κB signaling in type-2 dendritic cells at baseline predicts non-response to adalimumab in psoriasis. Nature Communications. 2021;12:4741. doi: 10.1038/s41467-021-25066-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bakker DS, de Graaf M, Nierkens S, Delemarre EM, Knol E, van Wijk F, de Bruin-Weller MS, Drylewicz J, Thijs JL. Unraveling heterogeneity in pediatric atopic dermatitis: Identification of serum biomarker based patient clusters. The Journal of Allergy and Clinical Immunology. 2022;149:125–134. doi: 10.1016/j.jaci.2021.06.029. [DOI] [PubMed] [Google Scholar]
  8. Bausch-Fluck D, Goldmann U, Müller S, van Oostrum M, Müller M, Schubert OT, Wollscheid B. The in silico human surfaceome. PNAS. 2018;115:E10988–E10997. doi: 10.1073/pnas.1808790115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bing SJ, Silver PB, Jittayasothorn Y, Mattapallil MJ, Chan CC, Horai R, Caspi RR. Autoimmunity to neuroretina in the concurrent absence of IFN-γ and IL-17A is mediated by a GM-CSF-driven eosinophilic inflammation. Journal of Autoimmunity. 2020;114:102507. doi: 10.1016/j.jaut.2020.102507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bosteels C, Neyt K, Vanheerswynghels M, van Helden MJ, Sichien D, Debeuf N, De Prijck S, Bosteels V, Vandamme N, Martens L, Saeys Y, Louagie E, Lesage M, Williams DL, Tang SC, Mayer JU, Ronchese F, Scott CL, Hammad H, Guilliams M, Lambrecht BN. Inflammatory type 2 cdcs acquire features of cdc1s and macrophages to orchestrate immunity to respiratory virus infection. Immunity. 2020;52:1039–1056. doi: 10.1016/j.immuni.2020.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bourdely P, Anselmi G, Vaivode K, Ramos RN, Missolo-Koussou Y, Hidalgo S, Tosselo J, Nuñez N, Richer W, Vincent-Salomon A, Saxena A, Wood K, Lladser A, Piaggio E, Helft J, Guermonprez P. Transcriptional and functional analysis of cd1c+ human dendritic cells identifies a CD163+ subset priming CD8+CD103+ T cells. Immunity. 2020;53:335–352. doi: 10.1016/j.immuni.2020.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Briseño CG, Satpathy AT, Davidson JT, Ferris ST, Durai V, Bagadia P, O’Connor KW, Theisen DJ, Murphy TL, Murphy KM. Notch2-dependent dc2s mediate splenic germinal center responses. PNAS. 2018;115:10726–10731. doi: 10.1073/pnas.1809925115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Brown CC, Gudjonson H, Pritykin Y, Deep D, Lavallée V-P, Mendoza A, Fromme R, Mazutis L, Ariyan C, Leslie C, Pe’er D, Rudensky AY. Transcriptional basis of mouse and human dendritic cell heterogeneity. Cell. 2019;179:846–863. doi: 10.1016/j.cell.2019.09.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Caspi RR. A look at autoimmunity and inflammation in the eye. The Journal of Clinical Investigation. 2010;120:3073–3083. doi: 10.1172/JCI42440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chen P, Tucker W, Hannes S, Liu B, Si H, Gupta A, Lee RWJ, Sen HN, Nussenblatt RB. Levels of blood cd1c+ mdc1 and cd1chi mdc1 subpopulation reflect disease activity in noninfectious uveitis. Investigative Ophthalmology & Visual Science. 2014;56:346–352. doi: 10.1167/iovs.14-15416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Chen P, Denniston A, Hannes S, Tucker W, Wei L, Liu B, Xiao T, Hirani S, Li Z, Jawad S, Si H, Lee RWJ, Sen HN, Nussenblatt RB. Increased cd1c+ mdc1 with mature phenotype regulated by tnfα-p38 mapk in autoimmune ocular inflammatory disease. Clinical Immunology. 2015a;158:35–46. doi: 10.1016/j.clim.2015.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen M, Liang D, Zuo A, Shao H, Kaplan HJ, Sun D. An a2b adenosine receptor agonist promotes th17 autoimmune responses in experimental autoimmune uveitis (eau) via dendritic cell activation. PLOS ONE. 2015b;10:e0132348. doi: 10.1371/journal.pone.0132348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Chen P, Urzua CA, Knickelbein JE, Kim JS, Li Z, Hannes S, Kuo D, Chaigne-Delalande B, Armbrust K, Tucker W, Liu B, Agrón E, Sen HN, Nussenblatt RB. Elevated cd1c+ myeloid dendritic cell proportions associate with clinical activity and predict disease reactivation in noninfectious uveitis. Investigative Ophthalmology & Visual Science. 2016;57:1765–1772. doi: 10.1167/iovs.15-18357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Cheung VG, Nayak RR, Wang IX, Elwyn S, Cousins SM, Morley M, Spielman RS, Flint J. Polymorphic cis- and trans-regulation of human gene expression. PLOS Biology. 2010;8:e1000480. doi: 10.1371/journal.pbio.1000480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Conrad C, Di Domizio J, Mylonas A, Belkhodja C, Demaria O, Navarini AA, Lapointe A-K, French LE, Vernez M, Gilliet M. Tnf blockade induces a dysregulated type I interferon response without autoimmunity in paradoxical psoriasis. Nature Communications. 2018;9:25. doi: 10.1038/s41467-017-02466-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Croxford AL, Lanzinger M, Hartmann FJ, Schreiner B, Mair F, Pelczar P, Clausen BE, Jung S, Greter M, Becher B. The cytokine GM-CSF drives the inflammatory signature of CCR2+ monocytes and licenses autoimmunity. Immunity. 2015;43:502–514. doi: 10.1016/j.immuni.2015.08.010. [DOI] [PubMed] [Google Scholar]
  22. Cytlak U, Resteu A, Pagan S, Green K, Milne P, Maisuria S, McDonald D, Hulme G, Filby A, Carpenter B, Queen R, Hambleton S, Hague R, Lango Allen H, Thaventhiran JED, Doody G, Collin M, Bigley V. Differential IRF8 transcription factor requirement defines two pathways of dendritic cell development in humans. Immunity. 2020;53:353–370. doi: 10.1016/j.immuni.2020.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Davis S, Meltzer PS. GEOquery: A bridge between the gene expression omnibus (GEO) and bioconductor. Bioinformatics. 2007;23:1846–1847. doi: 10.1093/bioinformatics/btm254. [DOI] [PubMed] [Google Scholar]
  24. Diener N, Fontaine JF, Klein M, Hieronymus T, Wanke F, Kurschus FC, Ludwig A, Ware C, Saftig P, Bopp T, Clausen BE, Backer RA. Posttranslational modifications by adam10 shape myeloid antigen-presenting cell homeostasis in the splenic marginal zone. PNAS. 2021;118:e2111234118. doi: 10.1073/pnas.2111234118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Dutertre C-A, Becht E, Irac SE, Khalilnezhad A, Narang V, Khalilnezhad S, Ng PY, van den Hoogen LL, Leong JY, Lee B, Chevrier M, Zhang XM, Yong PJA, Koh G, Lum J, Howland SW, Mok E, Chen J, Larbi A, Tan HKK, Lim TKH, Karagianni P, Tzioufas AG, Malleret B, Brody J, Albani S, van Roon J, Radstake T, Newell EW, Ginhoux F. Single-Cell analysis of human mononuclear phagocytes reveals subset-defining markers and identifies circulating inflammatory dendritic cells. Immunity. 2019;51:573–589. doi: 10.1016/j.immuni.2019.08.008. [DOI] [PubMed] [Google Scholar]
  27. Ellis B, Haaland P, Hahne F, Le Meur N, Gopalakrishnan N, Spidlen J, Jiang M, Finak G. FlowCore: Flowcore: Basic structures for flow cytometry data. 2.2.0R Package. 2020 https://www.thermofisher.com
  28. Fasnacht N, Huang HY, Koch U, Favre S, Auderset F, Chai Q, Onder L, Kallert S, Pinschewer DD, MacDonald HR, Tacchini-Cottier F, Ludewig B, Luther SA, Radtke F. Specific fibroblastic niches in secondary lymphoid organs orchestrate distinct notch-regulated immune responses. The Journal of Experimental Medicine. 2014;211:2265–2279. doi: 10.1084/jem.20132528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Fu Q, Man X, Wang X, Song N, Li Y, Xue J, Sun Y, Lin W. CD83+ CCR7+ NK cells induced by interleukin 18 by dendritic cells promote experimental autoimmune uveitis. Journal of Cellular and Molecular Medicine. 2019;1:1827–1839. doi: 10.1111/jcmm.14081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Fujita K, Chakarov S, Kobayashi T, Sakamoto K, Voisin B, Duan K, Nakagawa T, Horiuchi K, Amagai M, Ginhoux F, Nagao K. Cell-Autonomous flt3l shedding via ADAM10 mediates conventional dendritic cell development in mouse spleen. PNAS. 2019;116:14714–14723. doi: 10.1073/pnas.1818907116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Girard M, Law JC, Edilova MI, Watts TH. Type i interferons drive the maturation of human dc3s with a distinct costimulatory profile characterized by high gitrl. Science Immunology. 2020;5:eabe0347. doi: 10.1126/sciimmunol.abe0347. [DOI] [PubMed] [Google Scholar]
  32. Hafemeister C, Satija R. Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression. Genome Biology. 2019;20:296. doi: 10.1186/s13059-019-1874-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hayden MS, Ghosh S. Regulation of NF-κB by TNF family cytokines. Seminars in Immunology. 2014;26:253–266. doi: 10.1016/j.smim.2014.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Heger L, Balk S, Lühr JJ, Heidkamp GF, Lehmann CHK, Hatscher L, Purbojo A, Hartmann A, Garcia-Martin F, Nishimura SI, Cesnjevar R, Nimmerjahn F, Dudziak D. CLEC10A is a specific marker for human cd1c+ dendritic cells and enhances their toll-like receptor 7/8-induced cytokine secretion. Frontiers in Immunology. 2018;9:744. doi: 10.3389/fimmu.2018.00744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Horai R, Zárate-Bladés CR, Dillenburg-Pilla P, Chen J, Kielczewski JL, Silver PB, Jittayasothorn Y, Chan C-C, Yamane H, Honda K, Caspi RR. Microbiota-Dependent activation of an autoreactive T cell receptor provokes autoimmunity in an immunologically privileged site. Immunity. 2015;43:343–353. doi: 10.1016/j.immuni.2015.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Huang X-F, Li Z, De Guzman E, Robinson P, Gensler L, Ward MM, Rahbar MH, Lee M, Weisman MH, Macfarlane GJ, Jones GT, Klingberg E, Forsblad-d’Elia H, McCluskey P, Wakefield D, Coombes JS, Fiatarone Singh MA, Mavros Y, Vlahovich N, Hughes DC, Marzo-Ortega H, Van der Horste-Bruinsma I, O’Shea F, Martin TM, Rosenbaum J, Breban M, Jin Z-B, Leo P, Reveille JD, Wordsworth BP, Brown MA. Genomewide association study of acute anterior uveitis identifies new susceptibility loci. Investigative Ophthalmology & Visual Science. 2020;61:3. doi: 10.1167/iovs.61.6.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Iberg CA, Bourque J, Fallahee I, Son S, Hawiger D. Tnf-Α sculpts a maturation process in vivo by pruning tolerogenic dendritic cells. Cell Reports. 2022;39:110657. doi: 10.1016/j.celrep.2022.110657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Jabs DA, Nussenblatt RB, Rosenbaum JT, Standardization of Uveitis Nomenclature (SUN) Working Group Standardization of uveitis nomenclature for reporting clinical data. Results of the first international workshop. American Journal of Ophthalmology. 2005;140:509–516. doi: 10.1016/j.ajo.2005.03.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Jimenez-Dalmaroni MJ, Xiao N, Corper AL, Verdino P, Ainge GD, Larsen DS, Painter GF, Rudd PM, Dwek RA, Hoebe K, Beutler B, Wilson IA. Soluble cd36 ectodomain binds negatively charged diacylglycerol ligands and acts as a co-receptor for tlr2. PLOS ONE. 2009;4:e7411. doi: 10.1371/journal.pone.0007411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Jin J, Hu H, Li HS, Yu J, Xiao Y, Brittain GC, Zou Q, Cheng X, Mallette FA, Watowich SS, Sun S-C. Noncanonical NF-κB pathway controls the production of type I interferons in antiviral innate immunity. Immunity. 2014;40:342–354. doi: 10.1016/j.immuni.2014.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Jung D, Ge X. PPInfer: Inferring functionally related proteins using protein interaction networks. 1.16.0R Package. 2020 https://www.bioconductor.org/packages/devel/bioc/vignettes/PPInfer/inst/doc/PPInfer.pdf
  42. Kasper M, Heming M, Schafflick D, Li X, Lautwein T, Meyer Zu Horste M, Bauer D, Walscheid K, Wiendl H, Loser K, Heiligenhaus A, Meyer Zu Hörste G. Intraocular dendritic cells characterize HLA-B27-associated acute anterior uveitis. eLife. 2021;10:e67396. doi: 10.7554/eLife.67396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Kirkling ME, Cytlak U, Lau CM, Lewis KL, Resteu A, Khodadadi-Jamayran A, Siebel CW, Salmon H, Merad M, Tsirigos A, Collin M, Bigley V, Reizis B. Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells. Cell Reports. 2018;23:3658–3672. doi: 10.1016/j.celrep.2018.05.068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ko HJ, Hong SW, Verma R, Jung J, Lee M, Kim N, Kim D, Surh CD, Kim KS, Rudra D, Im SH. Dietary glucose consumption promotes RALDH activity in small intestinal CD103+cd11b+ dendritic cells. Frontiers in Immunology. 2020;1:01897. doi: 10.3389/fimmu.2020.01897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Korenfeld D, Gorvel L, Munk A, Man J, Schaffer A, Tung T, Mann C, Klechevsky E. A type of human skin dendritic cell marked by cd5 is associated with the development of inflammatory skin disease. JCI Insight. 2017;2:e96101. doi: 10.1172/jci.insight.96101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Kuiper JJW, van Setten J, Devall M, Cretu-Stancu M, Hiddingh S, Ophoff RA, Missotten T, van Velthoven M, Den Hollander AI, Hoyng CB, James E, Reeves E, Cordero-Coma M, Fonollosa A, Adán A, Martín J, Koeleman BPC, Boer J de, Pulit SL, Márquez A, Radstake T. Functionally distinct erap1 and erap2 are a hallmark of hla-a29-(birdshot) uveitis. Human Molecular Genetics. 2018;27:4333–4343. doi: 10.1093/hmg/ddy319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Kuiper JJW, Venema WJ. HLA-A29 and birdshot uveitis: Further down the rabbit hole. Frontiers in Immunology. 2020;11:599558. doi: 10.3389/fimmu.2020.599558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Kuiper JJW, Verhagen FH, Hiddingh S, Wennink RAW, Hansen AM, Casey KA, Hoefer IE, Haitjema S, Drylewicz J, Yakin M, Sen HN, Radstake TRDJ, de Boer JH. A network of serum proteins predict the need for systemic immunomodulatory therapy at diagnosis in noninfectious uveitis. Ophthalmology Science. 2022;2:100175. doi: 10.1016/j.xops.2022.100175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Laban KG, Rijken R, Hiddingh S, Mertens JS, van der Veen RLP, Eenhorst CAE, Pandit A, Radstake TRDJ, de Boer JH, Kalmann R, Kuiper JJW. CDC2 and plasmacytoid dendritic cells diminish from tissues of patients with non-hodgkin orbital lymphoma and idiopathic orbital inflammation. European Journal of Immunology. 2020;50:548–557. doi: 10.1002/eji.201948370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Langfelder P, Horvath S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559. doi: 10.1186/1471-2105-9-559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Lee RW, Nicholson LB, Sen HN, Chan CC, Wei L, Nussenblatt RB, Dick AD. Autoimmune and autoinflammatory mechanisms in uveitis. Seminars in Immunopathology. 2014;36:581–594. doi: 10.1007/s00281-014-0433-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Lewis KL, Caton ML, Bogunovic M, Greter M, Grajkowska LT, Ng D, Klinakis A, Charo IF, Jung S, Gommerman JL, Ivanov II, Liu K, Merad M, Reizis B. Notch2 receptor signaling controls functional differentiation of dendritic cells in the spleen and intestine. Immunity. 2011;35:780–791. doi: 10.1016/j.immuni.2011.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-Seq data with deseq2. Genome Biology. 2014;15:12. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Maney NJ, Reynolds G, Krippner-Heidenreich A, Hilkens CMU. Dendritic cell maturation and survival are differentially regulated by TNFR1 and TNFR2. Journal of Immunology. 2014;193:4914–4923. doi: 10.4049/jimmunol.1302929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Márquez A, Cordero-Coma M, Martín-Villa JM, Gorroño-Echebarría MB, Blanco R, Díaz Valle D, Del Rio MJ, Blanco A, Olea JL, Cordero Y, Capella MJ, Díaz-Llopis M, Ortego-Centeno N, Ruiz-Arruza I, Llorenç V, Adán A, Fonollosa A, Ten Berge J, Atan D, Dick AD, De Boer JH, Kuiper J, Rothova A, Martín J. New insights into the genetic component of non-infectious uveitis through an immunochip strategy. Journal of Medical Genetics. 2017;54:38–46. doi: 10.1136/jmedgenet-2016-104144. [DOI] [PubMed] [Google Scholar]
  56. Obermoser G, Pascual V. The interferon-alpha signature of systemic lupus erythematosus. Lupus. 2010;19:1012–1019. doi: 10.1177/0961203310371161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. O’Rourke M, Fearon U, Sweeney CM, Basdeo SA, Fletcher JM, Murphy CC, Canavan M. The pathogenic role of dendritic cells in non-infectious anterior uveitis. Experimental Eye Research. 2018;173:121–128. doi: 10.1016/j.exer.2018.05.008. [DOI] [PubMed] [Google Scholar]
  58. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. Limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Research. 2015;43:e47. doi: 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Rönnblom LE, Alm GV, Oberg KE. Possible induction of systemic lupus erythematosus by interferon-alpha treatment in a patient with a malignant carcinoid tumour. Journal of Internal Medicine. 1990;227:207–210. doi: 10.1111/j.1365-2796.1990.tb00144.x. [DOI] [PubMed] [Google Scholar]
  60. Rönnblom LE, Alm GV, Oberg KE. Autoimmunity after alpha-interferon therapy for malignant carcinoid tumors. Annals of Internal Medicine. 1991;115:178–183. doi: 10.7326/0003-4819-115-3-178. [DOI] [PubMed] [Google Scholar]
  61. Saha I, Jaiswal H, Mishra R, Nel HJ, Schreuder J, Kaushik M, Singh Chauhan K, Singh Rawat B, Thomas R, Naik S, Kumar H, Tailor P. RelB suppresses type i interferon signaling in dendritic cells. Cellular Immunology. 2020;349:104043. doi: 10.1016/j.cellimm.2020.104043. [DOI] [PubMed] [Google Scholar]
  62. Shih VFS, Davis-Turak J, Macal M, Huang JQ, Ponomarenko J, Kearns JD, Yu T, Fagerlund R, Asagiri M, Zuniga EI, Hoffmann A. Control of relb during dendritic cell activation integrates canonical and noncanonical nf-κb pathways. Nature Immunology. 2012;13:1162–1170. doi: 10.1038/ni.2446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM, Hao Y, Stoeckius M, Smibert P, Satija R. Comprehensive integration of single-cell data. Cell. 2019;177:1888–1902. doi: 10.1016/j.cell.2019.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Sun SC. Non-canonical nf-κb signaling pathway. Cell Research. 2011;21:71–85. doi: 10.1038/cr.2010.177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Suttorp-Schulten MS, Rothova A. The possible impact of uveitis in blindness: A literature survey. The British Journal of Ophthalmology. 1996;80:844–848. doi: 10.1136/bjo.80.9.844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Thorne JE, Suhler E, Skup M, Tari S, Macaulay D, Chao J, Ganguli A. Prevalence of noninfectious uveitis in the united states: A claims-based analysis. JAMA Ophthalmology. 2016;134:1237–1245. doi: 10.1001/jamaophthalmol.2016.3229. [DOI] [PubMed] [Google Scholar]
  67. Touhami S, Diwo E, Sève P, Trad S, Bielefeld P, Sène D, Abad S, Brézin A, Quartier P, Koné Paut I, Weber M, Chiquet C, Errera M-H, Sellam J, Cacoub P, Kaplanski G, Kodjikian L, Bodaghi B, Saadoun D. Expert opinion on the use of biological therapy in non-infectious uveitis. Expert Opinion on Biological Therapy. 2019;19:477–490. doi: 10.1080/14712598.2019.1595578. [DOI] [PubMed] [Google Scholar]
  68. Van Gassen S, Callebaut B, Van Helden MJ, Lambrecht BN, Demeester P, Dhaene T, Saeys Y. FlowSOM: Using self-organizing maps for visualization and interpretation of cytometry data. Cytometry. Part A. 2015;87:636–645. doi: 10.1002/cyto.a.22625. [DOI] [PubMed] [Google Scholar]
  69. Van Gassen S, Quintelier K, Artuur C, Kratochvil M. Flowsom. 20dd5a6GitHub. 2023 https://github.com/SofieVG/FlowSOM
  70. Villani AC, Satija R, Reynolds G, Sarkizova S, Shekhar K, Fletcher J, Griesbeck M, Butler A, Zheng S, Lazo S, Jardine L, Dixon D, Stephenson E, Nilsson E, Grundberg I, McDonald D, Filby A, Li W, De Jager PL, Rozenblatt-Rosen O, Lane AA, Haniffa M, Regev A, Hacohen N. Single-cell rna-seq reveals new types of human blood dendritic cells, monocytes, and progenitors. Science. 2017;356:eaah4573. doi: 10.1126/science.aah4573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wang W, Chong WP, Li C, Chen Z, Wu S, Zhou H, Wan Y, Chen W, Gery I, Liu Y, Caspi RR, Chen J. Type I interferon therapy limits CNS autoimmunity by inhibiting CXCR3-mediated trafficking of pathogenic effector T cells. Cell Reports. 2019;28:486–497. doi: 10.1016/j.celrep.2019.06.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Wang B, Tian Q, Guo D, Lin W, Xie X, Bi H. Activated γδ T cells promote dendritic cell maturation and exacerbate the development of experimental autoimmune uveitis (EAU) in mice. Immunological Investigations. 2021;50:164–183. doi: 10.1080/08820139.2020.1716786. [DOI] [PubMed] [Google Scholar]
  73. Wilkerson MD, Hayes DN. ConsensusClusterPlus: A class discovery tool with confidence assessments and item tracking. Bioinformatics. 2010;26:1572–1573. doi: 10.1093/bioinformatics/btq170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Wu H, Wang C, Wu Z. PROPER: Comprehensive power evaluation for differential expression using RNA-seq. Bioinformatics. 2015;31:233–241. doi: 10.1093/bioinformatics/btu640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Yang WS, Yu H, Kim JJ, Lee MJ, Park S-K. Vitamin D-induced ectodomain shedding of TNF receptor 1 as a nongenomic action: D3 vs D2 derivatives. The Journal of Steroid Biochemistry and Molecular Biology. 2016;155:18–25. doi: 10.1016/j.jsbmb.2015.09.019. [DOI] [PubMed] [Google Scholar]

Editor's evaluation

Lynn M Hassman 1

These findings are valuable to ocular immunologists who the study pathophysiologic mechanisms driving inflammation in human uveitis, and for future identification of novel therapeutic targets. The authors convincingly perform high dimensional multi-omic analysis of testing and replication cohorts, followed by characterization of a disease-specific cell type using comparative analysis with previously validated experimental datasets. The analysis will be of particular interest to basic and translational ocular immunologists, as well as dendritic cell biologists.

Decision letter

Editor: Lynn M Hassman1
Reviewed by: James Walsh

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Whole transcriptome-sequencing and network analysis of CD1c+ human dendritic cells identifies cytokine-secreting subsets linked to type I IFN-negative autoimmunity to the eye" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Betty Diamond as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: James Walsh (Reviewer #1).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Improved informatics analysis to correct for false discovery and stronger correlation with intra-ocular cDC2s, per reviewer #3

2) Revision of claims to have identified a new type of cDC2, reframed to fit this cell state into the current, more rigorously defined, classification of cDC2 subtypes (authors have already cited key papers). This analysis may also benefit from stronger analysis of the transcriptional profile of intraocular (ie tissue state) CD36/CX3CR1+ cDC2s. Conclusions must be tempered given concerns of reviewers #1 and #2

Also, please correct number of references, it was at times impossible to determine which sources were being cited.

Reviewer #1 (Recommendations for the authors):

It is unclear why the CD14 is plotted vs CD3 in Figure 1F.

Line 166: Repeated word "co-expressed expressed".

Line 247: Run on sentence (and used multiple times).

Line 384: "No minimize bias" needs to be corrected.

Reviewer #2 (Recommendations for the authors):

Specific comments:

An issue is that the cd1c+ cells used for RNAseq were isolated using microbeads which is extremely impure. What other cells contaminated the prep, can the gene expression be reliably de-convoluted? What is the cell purity prior to RNAseq?

5B and D how many patients are displayed? Patient numbers should be shown for each figure throughout the manuscript.

Phenotype of the DCs should be shown in the presence of Notch2 and ADAM10 inhibitor? Is the DC3 reduced? CX3CR1, CD36, ccr2 CD163?

What is the output of the CX3CR1, CD36, ccr2 CD163 DC3 in Notch ligand-conditioing human CD34 HPC derived DCS?

Functional analysis for understanding T cell priming by the new DC3 subsets should be shown. what is the implication of the results for autoimmune Uveitis.

Technical details that should be addressed:

– All versions of the software should be noted in the methods section, for example ConsensusClusterPlus, Deseq2, WGCNA, etc

– For logicleTransform – were the default settings used or were the parameters altered, this needs to be indicated for interpretation of the log linear transformation.

– Heatmap color palettes are not ideal for colorblind readers, would recommend using viridis palettes

– For the differential gene expression and generation of weighted gene co-expression networks, why was the raw p-value used as a cut-off and not adjusted p-value? Was there any controls for possible false positives?

– For the FlowSOM clusters – what are the approximate sizes Cluster 81, 41, 61, and 83? What percent of the peripheral blood? What is the relative proportion of these clusters in Uveitis vs control?

Author should cite Korenfeld at al JCI insight 2017 on page 9

Reviewer #3 (Recommendations for the authors):

In general, figure panels should be made larger; several -- particularly in Figure 3 -- have panels that are nearly unreadable even when printed at full-page scale.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Transcriptome network analysis of human CD1c+ dendritic cells identifies an inflammatory cytokine-secreting subpopulation within the CD14+ DC3s that accumulates locally in type I IFN-negative autoimmunity to the eye" for further consideration by eLife. Your revised article has been evaluated by Betty Diamond (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

The authors utilized deep transcriptional profiling of isolated CD1c+ peripheral blood cells to identify a peripheral blood biomarker of uveitis, followed by flow cytometric analysis of protein expression to test the hypothesis that a subset of CD1c+ cells are reduced in uveitis patients. Identification of peripheral blood biomarkers of uveitis is important and their study is based on analysis of a reasonable number of study subjects with active disease, therefore the data supporting the first conclusion that a differential gene expression profile exists in uveitis is well-supported and convincing. The subsequent analysis which attempts to define and new cell type based on comparison with published expression datasets, while hypothesis-generating, is inadequate, as sufficient phenotypic and functional analyses were not performed to reach their conclusions. Similarly, the comparison with genes expressed by ocular CD1c+ cells from a separate dataset is not sufficient to conclude that the peripheral blood CD1c+ cells migrate into the eye.

Reviewer #1 (Recommendations for the authors):

The authors have addressed many of the concerns in the original reviews, and while the discovery of a subpopulation of blood-derived DCs that are changed in uveitis would be interesting the revision does not leave me convinced that this is truly a unique population of cells. Specifically the flow cytometry data in Figure 5/supplement suggests that the CD14 population is derived from a population that is bisected by the original gate, rather than from a population of CD1c+ DCs limiting functional analysis, and the scRNA seq does not show that the cells expressing black module genes are distinct from those that don't.

Reviewer #2 (Recommendations for the authors):

The authors set out to utilize advance informatics techniques to advance our understanding of a cell type previously shown to play a role in uveitis, type 2 conventional dendritic cells (previously termed mDC1). They accumulated a valuable set of samples from untreated, active disease and employed a testing and validation cohort which reproduced a core set of genes differentially expressed within the CD1c+ dendritic cells in the peripheral blood of patients with uveitis. Importantly these cells appear altered regardless of the subtype of uveitis. They then astutely question whether the transcriptional signature simply represents different proportions of cell subtypes or states and test this hypothesis using flow cytometry.

They also attempt to probe the mechanism driving this particular cell type/state by cleverly drawing on published data sets, however these hypothesis-generating experiments are not validated experimentally in a uveitis system.

They utilize in vitro analysis of similar cells isolated from human patients and show that the cells can be induced to make a specific set of cytokines which is different from a related dendritic cell type, however the lack of concordance with published activated DC2s, or the transcriptional signature in their own ex vivo activated DC2s raises more questions than it answers.

The manuscript was difficult to read, largely because it is trying to accomplish too many goals, but also because the informatics techniques and external data sets were not described sufficiently for an average reader to readily evaluate the method and conclusions, and the conclusions were overstated throughout the paper. Overall, too many hypotheses were tested, alternative hypotheses were not considered/discussed. The data should probably be divided into at least 2 papers, one which explores the peripheral blood subsets more concretely, and one which attempts to elucidate a mechanisms by which low RUNX3 expression is associated with the genes expressed more highly in DC2s in the peripheral blood of uveitis patients.

1. The rationale for depleting CD14 in the validation cohort is not clear and justified. CD14 expression on dendritic cells has been established in the literature (ex Duterte Immunity 2019). This reviewer wonders if a better flow of data would be to start with the current second cohort, CD14 depleted, ID the black module, realize that some genes discovered have been associated with CD14+DC3, then utilize a second cohort that includes CD14+CD1c+ cells to validate and expand the original gene set.

2. Experiments probing the transcriptional regulation of the uveitis-enriched gene set are not definitive, but hypothesis-generating, and left in this story, are distracting from the primary observation of a cell type differentially present in the blood of uveitis patients.

3. The authors claim to have found an inflammatory cell type, but the gene expression profile does not recapitulate inflammation-induced DC2 gene expression profile. Figure 3 attempts to shed mechanistic light but only opens more questions, like if viral infection in mice (figure 3A lower panel) and multiple inflammatory stimuli (figure 3C) induce a transcriptional program opposite what they are finding in these cells in the peripheral blood of uveitis patients, how are the cells identified in this paper likely relevant to eye inflammation?

4. Pro-inflammatory CD14+DC3 increased in blood in SLE patients, but according to authors interpretation, they find a similar cell type is decreased in peripheral blood in uveitis. The authors adhere to a possible explanation that these cells are trafficking to the eye, but by the same logic, SLE patients should have an even more significant reduction, not increase in their peripheral DC3 counts. This is not discussed.

5. Even more importantly, the Chen et al. papers which are cited generally by the authors, showed the opposite- that CD1c+ DCs are increased in the blood of patients with uveitis, and correlate with disease activity. No attempt is made by the authors to compare their data with this data derived from a larger number of patients, or discuss the difference. The authors have essentially ignored this key discrepancy with previously published data.

6. Despite changing some text around the hypothesis that this cell type is reduced in the blood because it migrates to the eye (numerically impossible as pointed out by prior reviewer #1), this notion is reiterated several other places in the paper and should be removed, and frankly, reconsidered. It is also possible that the change in peripheral blood cell type/state frequency results from cytokine-induced precursor emigration/differentiation. Perhaps there is actually a fraction of DC2-type cells that are increased in the blood in uveitis (as Chen found) but express the transcriptional program identified in the paper because they are pre-activated cells?

7. The analysis of ocular DC2s which concludes that the current cell type, CD14+DC3s with black module gene expression, are present in the eye is not convincing. The methods are not clearly explained, however it appears that rather than utilizing unbiased cluster analysis and performing differential gene expression analysis between the patients with non-infectious uveitis, and the control (endophthalmitis), or using another technique like GSEA which they used in previous figures to correlate the black module genes with the genes expressed by the ocular DC2s, the authors appear to have selected individual cells that expressed the black modules genes, then compared the expression of black module genes to the cells that did not express black module genes.

8. The authors state in their response to reviewer #1 comments "we profiled available eye fluid biopsies and paired plasma by Olink proteomics to measure immune mediators from patients and controls from this study (and several additional samples, including aqueous humor from non-inflammatory cataract controls – see revised Figure 5 panel D). This analysis shows that cytokines produced by CD36+CX3CR1+ DCs such as TNF-α and IL-6 are specifically increased in eye tissue of patients, but not in blood."-Neither this data, or discussion of it are included in the revised manuscript.

Finally, a concern is that the title is a gross overstatement of their findings:

1. They have not demonstrated that the cells in this paper induce inflammation, and especially not in the context of uveitis- only that similar cells from healthy patients produce a different set of cytokines when stimulated in vitro compared to another cell type.

2. They have not demonstrated that these very cells migrate to the eye, only that similar genes are present in a possibly similar ocular cell type in another data set.

3. They do not demonstrate type I IFN-negative autoimmunity in the eye. This was a huge stretch, presumably from prior assumptions about the mechanisms driving uveitis along with the finding that their cell type does not share a transcriptional program with murine DC2s activated in a viral infection.

In regard to addressing the Previous Editor Concerns:

1. The informatics analysis for most of the paper is likely sufficient, however the methods are not communicated succinctly and clearly such that non-informatics experts can understand the rationale and method for each analysis. The analysis of the intraocular DCs was not clear and from the details provided, did appear appropriate.

2. Revision of claim to have identified a new type of cDC2- This is still not satisfactory as:

a. authors have not ruled out the possibility that the cells are monocyte-derived by transcriptional analysis, protein expression or functional analysis. The use of CD14-deplete cells to recapitulate the gene expression profile is not sufficient to determine that the cells in this paper are not monocyte-derived, as CD14-expression is demonstrated on cells confirmed by FLT3L response to be dendritic cells in Duterte et al. Immunity 2019.

b. To be defined as a new subset of the previously defined DC3 subset, one would need to exactly replicate the marker expression and then show that the new markers subset that subset further, the current manuscript may simple be focusing on different genes/proteins expressed by one or more previously described subsets.

c. As this paper is useful for describing a cell type or state that differentiates uveitis from healthy patients, these experiments do not need to be done to publish this paper, but the naming of the cell type should be tempered to simply describe the markers that were expressed and suggest how they fit into the Duterte/Villani schema of DC2/DC3 classification. In actuality, the discrimination of cDC2 from monocyte-derived DC2-like cells has proven difficult in many papers, thus the authors are advised to stay out of the mud, so-to-speak.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis" for further consideration by eLife. Your revised article has been evaluated by Betty Diamond (Senior Editor) and a Reviewing Editor.

Summary:

CD1c+ dendritic cells have been found in the peripheral blood and eyes of patients with active uveitis. The authors set out to characterize CD1c+ dendritic cells in uveitis. They establish that the CD1c+ population varies between uveitis and healthy controls in both gene expression and the frequency of a subset of CD1c+ DCs, recently termed DC3s. Finally, the authors utilize a previously published dataset to show that cells with similar gene expression can be found in the eye during active uveitis.

Review:

The authors compare sorted CD1c+ DCs from patients with non-infectious uveitis and healthy controls and find a gene expression signature associated with uveitis, regardless of anatomic subtype or severity, that includes expression of the chemokine receptor CX3CR1. They corroborate this finding with a second cohort of CD1c+CD14+ cells, which strengthens the uveitis-specific CD1c+ DC signature.

The authors then compare the genes enriched in these uveitis CD1c+ DCs with previously published datasets analyzing murine CD1c+ DCs. They found more overlap between uveitis patient CD1c+ DC genes and murine RUNX3/NOTCH2 KO CD1c+ DCs than with murine viral-infected cells. While the data suggests that IFN signaling may be less relevant in these cells, the authors' conclusion that the genes differentially expressed by peripheral blood CD1c+ DCs in uveitis are not mediated by type I IFNs is overstated and alternative explanations should also be considered.

Next, the authors used flow cytometry to show that blood CD36+CX3CR1+CD1c+ DCs (thus labeled DC3s) were diminished in uveitis vs healthy controls, suggesting that the difference in CD1c+ gene expression between uveitis and healthy controls may actually be due to differential presence of CD1c+ subsets. The difference is small, but statistically significant, although the observation could have been strengthened by quantifying this cell type longitudinally in the same patients during active and inactive disease.

Next the authors found that LTA-stimulated CX3CR1+ DC3s from healthy controls secrete higher levels of uveitis-relevant inflammatory cytokines, including TNF-α, compared to CX3CR1- DC3s. This experiment was performed on a small number of healthy controls and not compared with cytokine production by DC3s from uveitis patients, which could have further supported the authors conclusion that the differential gene expression identified in Figure 1 was due to reduced proportions of CX3CR1+ DC3 cells in uveitis patients vs healthy controls, rather than qualitative differences between uveitis and healthy DC3s.

Finally, the authors find expression of CD36 and CX3CR1 on CLEC10A+ (which they use as a proxy for CD1C) cells by aqueous dendritic cells from a previously published dataset, suggesting that DC3s similar to those found at reduced frequency in the peripheral blood are present in aqueous inflammation, supporting their relevance in uveitis.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

Specifically, there are errors in the methods, results, and legends that must be corrected.

Reviewer #1 (Recommendations for the authors):

In the revised paper entitled "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis," Hiddingh, Vandit, Verhagen et al. explore the gene expression of PBMCs in non-infectious uveitis patients and demonstrate a CX3CR1-positive Cd1c+ gene signature that is altered in non-infectious uveitis. They show that this population is decreased in the peripheral blood, could be regulated by notch signaling, expresses proinflammatory cytokines upon stimulation with LTA, and are present in the eye during uveitis.

The hypothesis that a cD1c+ population of DCs that could be related to uveitis in humans is intriguing and deserves further study. Their use of multiple methods to explore this population and the use of multiple cohorts are a strength of the manuscript, and it raises many intriguing questions that are potentially interesting, such as if this population is expressing inflammatory cytokines upon stimulation, why are they decreased in uveitis?

There are still areas where the manuscript is hard to follow and there are some concerns with the experimental methodology. The difficulty following the author's story is partially due to errors in cross-referencing statements in the text with their figures that support the data and understanding the experiments from the figure legends. For instance, in lines 313-315, the authors state "Furthermore, in CD1c+ DCs from healthy human donors, IFN-α did not induce downregulation of RUNX3 as observed CD1c+ DCs from non-infectious uveitis patients. Figure 2 – Figure 2 supplement 1". Data to support this statement is not found in Figure 2 or Figure 2 supplements (only healthy control data). The Figure 2 Supplement 1 legend references "the notch-negative condition in d" with a d in that figure.

Methodologically, the backgating for the manual gating of CD11c/CD1c suggests that the CD36+CX3CR1+ population is really part of a larger population of CD11c+ cells, raising the question of if this population is too poorly defined in this experimental context. This concern is slightly ameliorated by the appearance of a CD36hiCX3CR1hiCD1c+ population in the unsupervised clustering.

Despite these weaknesses, there is enough strength in using multiple methods and replication with multiple patient cohorts to overcome these concerns and to utilize it as a basis to further explore the functions of this population in uveitis pathogenesis.

Reviewer #4 (Recommendations for the authors):

The authors have responded to most of the previous reviews and have generated a more clear and cohesive manuscript.

Additional recommendations:

Figure 1

The text rationale for CD14 separation is confusing, consider omitting it.

A better methodology would have been to repeat analysis with new cohort I followed by validation using new cohort II rather than simply comparing the cohorts, but this reads more clearly and logically than the prior version and the overall conclusions seem valid.

Figure 1 Sup 1 not needed, emphasized the odd methodology sorting "cohort II" for CD14- recommend omitting this from the final version, or using instead Figure 3- Supplement 2 could be moved to the supplement for Figure 1 to explain why black module (from the CD14-sorted cohort) is stronger than then enriched modules from cohort I.

CD14+ CD1c+CD11c+CD36+CXCR3+ DC3s seem to be a subset of CD1c+CD11c+CD36+CXCR3+ DC3s, which may be why there is a stronger gene expression signature black module from cohort II vs the blue and green modules from cohort 1.

The supplemental experimental data shows that sorted DC3s from healthy peripheral blood treated with a variety of inflammatory stimuli upregulate RUNX3. One alternative explanation not discussed by the authors is that peripheral blood DC3s are in a precursor or pre-activation state.

Text: in CD1c+ DCs from healthy human donors, IFN-α did not induce downregulation of RUNX3 as observed in CD1c+ DCs from non-infectious uveitis patients, however supplemental figure 2 only tests CD1c DCs from healthy patients. CD1c+ DCs from uveitis patients were never stimulated with IFN to test whether they downregulate RUNX3 after this stimuli. This textual discussion of the experimental data is misleading.

Sup figure 3 final panel should be G, not H.

Aqueous scRNA samples are listed as obtained from Utrecht in the methods section and should cite the previous dataset.

Data used from prior sources should be more clearly detailed in legends and text. As the paper reads, it appears that the authors did the murine BMDC on the OP9 culture experiment detailed in Sup Figure 2.

Figure 5 image is very misleading – "purify tissue CD1c+ DCs" suggests that cells were purified resulting in the displayed UMAP. CLEC10A and C5AR should both be shown and the label should not state CD1c+ if this expression was not assessed- this is misleading.

eLife. 2023 Apr 12;12:e74913. doi: 10.7554/eLife.74913.sa2

Author response


Essential revisions:

1) Improved informatics analysis to correct for false discovery and stronger correlation with intra-ocular cDC2s, per reviewer #3

We would like to thank the editor for the time and effort to review our work. As discussed in the response to reviewer #3, we outlined a 3-step strategy to control for false positive findings in our RNA-seq analysis, which includes the use of an independent cohort and replication of gene modules over individual genes (we believe is a more challenging, but also more robust approach rarely conducted in RNA-seq analysis of dendritic cells – especially in the era of single-cell RNA seq). We have provided data analysis including adjusted P-values in Figure 1A and Figure 1- Supplement 2F, as well as in the Supplementary File 1H-1J. We also outlined in answer to reviewer #2 that we significantly expanded the analysis of intra-ocular cDC2s in Figure 6. We hope the editor agrees this has now been adequately addressed.

2) Revision of claims to have identified a new type of cDC2, reframed to fit this cell state into the current, more rigorously defined, classification of cDC2 subtypes (authors have already cited key papers). This analysis may also benefit from stronger analysis of the transcriptional profile of intraocular (ie tissue state) CD36/CX3CR1+ cDC2s. Conclusions must be tempered given concerns of reviewers #1 and #2

We have significantly reanalyzed the data presented in Figure 4 to fit the current nomenclature and show that the uveitis-associated cDC2s are a CD14+ DC3 subset most distinguished by CD36 and CX3CR1 (Figure 4, Figure 4 – Supplement 1, Figure 4 – Supplement 2). We have tempered conclusions based on the suggestions of the reviewers and adapted our discussion to include this current nomenclature. We have also substantially extended the transcriptional profile of intraocular CD36+/CX3CR1+ cDC2s by addition of Figure 6. Here, we clustered eye-infiltrating cDC2s according to the expression of the uveitis-associated gene module and show that these cells show relatively higher expression for CD36, CX3CR1, and lower RUNX3, but comparable levels of CD14 (Figure 6C) – closely corroborating our blood CD1c+ DC analyses. These DC3s were also found at higher frequency in the eye of patients (Figure 6D). We hope the editor agrees we have substantially improved the analysis of intraocular DCs.

Also, please correct number of references, it was at times impossible to determine which sources were being cited.

We have corrected the numbering of references and added references per suggestion of the reviewers.

Reviewer #1 (Recommendations for the authors):

It is unclear why the CD14 is plotted vs CD3 in Figure 1F.

We have changed this in revised Figure 1F and plotted CD14 against CD45 and added additional data on gating for all other markers (CD3, CD19, CD1c) used to assess the purity of the cell fractions used for RNA-seq in the revised Figure 1 – Supplement 1. We hope the reviewer considers this to be more appropriate.

Line 166: Repeated word "co-expressed expressed".

Line 247: Run on sentence (and used multiple times).

Line 384: "No minimize bias" needs to be corrected.

We thank the reviewer for bringing these typos to our attention and have corrected these accordingly.

Reviewer #2 (Recommendations for the authors):

Specific comments:

An issue is that the cd1c+ cells used for RNAseq were isolated using microbeads which is extremely impure. What other cells contaminated the prep, can the gene expression be reliably de-convoluted? What is the cell purity prior to RNAseq?

We agree that the reviewer that microbeads may provide a challenge in purification of cell subsets. With this in mind, we therefore went to great lengths to attribute the results to CD1c+ DCs. First of all, we used a series of MACS isolations to remove contamination from other cells. For cohort I, fresh PBMCs were immediately subjected to magnetic-activated cell sorting (MACS) for the removal (positive selection) of CD304+ cells (pDC), followed by CD19+ cells (B cell), and subsequently isolation of CD1c+ cells by using the CD1c+ (BDCA1) isolation kit (see Methods). We now have provided additional experimental data of flow cytometry analysis of the MACS-isolated cell fractions used for RNA-seq of cohort I. As shown in Figure 1—figure supplement 1, we used highly purified CD1c+ cDC2 cell fractions (median [interquartile range] % = 96[3]% pure) with no difference between groups in any of the residual cell populations. We outlined this in the Results section on page 10. As shown in revised Figure 2A-C (see also reviewer #1 comment 1), we conducted additional experiment to show that the black module genes are not from CD14+ monocytes (not dependent on CD14+ surface expression), but from CD1c+ DCs. Also, in cohort II, we used CD3-CD19-CD56-HLA-DR+CD11c+CD1c+CD14- cells for RNA-seq analysis sorted by flow cytometry. We hope that the reviewer agrees we have provided sufficient additional information to conclude that the results can be attributed to CD1c+ DCs.

5B and D how many patients are displayed? Patient numbers should be shown for each figure throughout the manuscript.

We have added the amount of patients and donors used for each experiment in Figure 1A, B, D, Figure Supplement 1, Figure 2A-D,F, Figure 3C, Figure 4A,D,G,H,I, Figure 4 – Supplement 1, Figure 5A-D, and Figure 6A, D. We hope the reviewer agrees this has now been sufficiently addressed.

Phenotype of the DCs should be shown in the presence of Notch2 and ADAM10 inhibitor? Is the DC3 reduced? CX3CR1, CD36, ccr2 CD163?

As discussed above Reviewer #1: question 3. Upon request, we have conducted experiments using the inhibitors and our CD1c+ DC flow cytometry panel, but experienced significant autofluorescence and artifacts (see gating example in Author response image 1) that hampered the correct identification of CD1c+ DCs and their subsets using CD34+ HPC derived DCs. Unfortunately, so far, our attempts have failed to overcome these artifacts. We therefore believe it is appropriate to remove the supplemental figure from the manuscript. Regardless, we show multiple complementary lines of evidence from transcriptomic analysis in transgenic and human cells that strongly link NOTCH2 signaling to the black module in cDC2s. We address this in more detail in the Discussion section. We hope the reviewer agrees that for the scope of this paper, this has been sufficiently addressed.

Author response image 1. Manual gating example of human CD34-HPC derived DCs shows substantial autofluorescence.

Author response image 1.

What is the output of the CX3CR1, CD36, ccr2 CD163 DC3 in Notch ligand-conditioing human CD34 HPC derived DCS?

Functional analysis for understanding T cell priming by the new DC3 subsets should be shown. what is the implication of the results for autoimmune Uveitis.

Technical details that should be addressed:

– All versions of the software should be noted in the methods section, for example ConsensusClusterPlus, Deseq2, WGCNA, etc

We have added the versions for software used in the method section and in the Key Resources Table form.

– For logicleTransform – were the default settings used or were the parameters altered, this needs to be indicated for interpretation of the log linear transformation.

Yes, the default settings were used for the logicleTransform() function. We have added a detailed Rmarkdown to the study DataverseNL repository (see Data availability in methods section or https://doi.org/10.34894/9Q0FVO) so readers can detail and reproduce all our analysis.

– Heatmap color palettes are not ideal for colorblind readers, would recommend using viridis palettes

We agree with the reviewer and have changed the heatmap colors to viridis palettes in Figure 4 and Figure 4 – Supplement 1.

– For the differential gene expression and generation of weighted gene co-expression networks, why was the raw p-value used as a cut-off and not adjusted p-value? Was there any controls for possible false positives?

Our aim in this study was to use network-based inference of the CD1c+ DC compartment in non-infectious uveitis with the goal to reproduce gene modules (i.e., pathways) over of individuals genes. Although WGCNA does not recommends filtering genes by differential expression, we aimed to prioritize genes linked to uveitis while controlling for possible false positives in 3 steps: (1) As a compromise between not filtering genes and using only a strict fraction of differentially expressed genes at Padj<0.05, we included genes with raw P<0.05 to construct uveitis-relevant gene modules with sufficient resolution. (2) We used an independent cohort in which we constructed modules and tested for overlap in co-expressed genes (i.e., replicate a gene module) (3) that also should show consistent direction of effect (Figure 2G). In our opinion, the strategy to replicate disease-associated gene modules is much more robust as illustrated by corroboration of these data by unbiased flow cytometry data and scRNAseq analysis. Regardless, we have now also added analysis with adjusted P-values in the result section (revised Figure 1B, Figure 1 Supplement 2F), and describe that genes with high module membership were also significantly increased in uveitis after correction for multiple testing in the result section on page 11 (Padj<0.05, Supplementary File 1H). We hope the reviewer agrees that we have used several complementary strategies to control for false positives in our analysis.

– For the FlowSOM clusters – what are the approximate sizes Cluster 81, 41, 61, and 83? What percent of the peripheral blood? What is the relative proportion of these clusters in Uveitis vs control?

We would like to thank the reviewer for raising these questions. We determined the approximate cluster sizes for cluster 81,41,61, and 83 which revealed that the clusters together represented <1% in the singlet gate (input data for flowSOM). Because identification of rare cell types is challenging for unsupervised gating algorithms, including flowSOM (reliance on cellular density which is non optimal for rare population detection), we aimed to improve detection of CD1c+ DC phenotypes by gating out lymphocytes. To this end, we reanalyzed the flowcytometry data of PBMCs of patients and controls with flowSOM using Lin-(CD3-CD19-CD56-) HLA-DR+ gated cells as input. As shown in Figure 4 – Supplement 1 this clearly identified (again) a cluster of 4 CD1c+ DC phenotypes, which we show are highly reminiscent of DC2 and DC3 cells (revised Figure 4B). We have updated Figure 4A-F with this significantly improved data and now show that the percentage of one particular cluster (now called cluster 44) is the single cluster that is significantly decreased in blood of patients (revised Figure 4B,C), and importantly, this cluster is distinguished by higher CD36 and CX3CR1 expression but not CD14, in line with our RNA-seq data and scRNAseq analysis (revised Figure 4E, 4F, 4J, Figure 4 – Supplement 2). Finally, we show that cluster 44 can be well identified by manual gating of CD36+CX3CR1+ CD1c+ DCs. We have outlined this extensive reanalysis in the result section on page 15-16.

Author should cite Korenfeld at al JCI insight 2017 on page 9.

We have added the citation at that positioning in the manuscript (which is now page 15).

Reviewer #3 (Recommendations for the authors):

In general, figure panels should be made larger; several -- particularly in Figure 3 -- have panels that are nearly unreadable even when printed at full-page scale.

We have increased the panels of the figures and show some heatmap figures in greater detail (Figure 4 – Supplement 1) in the supplemental data.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Reviewer #1 (Recommendations for the authors):

The authors have addressed many of the concerns in the original reviews, and while the discovery of a subpopulation of blood-derived DCs that are changed in uveitis would be interesting the revision does not leave me convinced that this is truly a unique population of cells. Specifically the flow cytometry data in Figure 5/supplement suggests that the CD14 population is derived from a population that is bisected by the original gate, rather than from a population of CD1c+ DCs limiting functional analysis.

Our sincere thanks go out to the reviewer for providing additional feedback. We think the reviewer may refer to the Figure supplement of Figure 4 (which in this revision is now Figure 3). Flow cytometry analysis in the figure supplement of Figure 3 provide more detail on CD14 expression in the CD11c+CD1c+ DC gate. We have also updated Figure 3G, which shows that CD14+CD1c+ DCs can be subdivided in CX3CR1+ and CX3CR1- cells. The reviewer will hopefully agree that we have adequately addressed this issue.

…and the scRNA seq does not show that the cells expressing black module genes are distinct from those that don't.

We agree that further improvements can be made to our intital approach. Our aim was to demonstrate that inflamed eyes of patients contain cells that express genes associated with CX3CR1+ DC3s. We reanalyzed the single-cell RNA seq data and sorted CD1c+ DCs using CLEC10A as a classical cDC2 marker (Heger et al. Front Immunol. 2018), removing monocytes and macrophages using C5AR1 (CD88- cells, according to Duterte et al. Immunity 2019, Bourdely et al. Immunity 2020). We then used unsupervised clustering to identify gene clusters in the CD1c+ DCs and compared their average gene expression pattern for genes we associated with CX3CR1+ DC3s. Now we describe that cluster 1 exhibits the pattern of expression we found in peripheral blood to be associated with CX3CR1+ DC3. We hope the reviewer agrees that we have now shown that CD1c+ DCs in eye fluid appear to cluster into distinct clusters, one of which is similar to a CX3CR1+ DC3.

Reviewer #2 (Recommendations for the authors):

The authors set out to utilize advance informatics techniques to advance our understanding of a cell type previously shown to play a role in uveitis, type 2 conventional dendritic cells (previously termed mDC1). They accumulated a valuable set of samples from untreated, active disease and employed a testing and validation cohort which reproduced a core set of genes differentially expressed within the CD1c+ dendritic cells in the peripheral blood of patients with uveitis. Importantly these cells appear altered regardless of the subtype of uveitis. They then astutely question whether the transcriptional signature simply represents different proportions of cell subtypes or states and test this hypothesis using flow cytometry.

They also attempt to probe the mechanism driving this particular cell type/state by cleverly drawing on published data sets, however these hypothesis-generating experiments are not validated experimentally in a uveitis system.

They utilize in vitro analysis of similar cells isolated from human patients and show that the cells can be induced to make a specific set of cytokines which is different from a related dendritic cell type, however the lack of concordance with published activated DC2s, or the transcriptional signature in their own ex vivo activated DC2s raises more questions than it answers.

We appreciate the reviewer's constructive comments and additional feedback. The reviewer may have been confused by the description of "in vivo activated" cDC2s, whereas this should have been “inflammatory” cDC2s, which are type I IFN-Dependent murine cDC2 subsets induced by pneumonia viruses in mice. We regret this mistake. Specifically, we wanted to demonstrate that CD1c+ DC transcriptomes of patients with non-infectious uveitis do not match those of these type I IFN dependent cDC2. The signature of patients is also not induced by type I IFN stimulation. We have clarified this in more detail in the result section.

Furthermore, we show that the CX3CR1-positive CD1c+ DCs in this study secreted similar levels of IL-23 and higher levels of TNF α and IL-6 than the CD36-CX3CR1- DC3 subsets after activation. Interestingly, this observation is in agreement with Villani et al. (Science 2017; PMID: 28428369) who observed that stimulated CD1c+CD36+ DC3s (CD1c_B population) produced more TNF α than CD36-DC3s (CD1c_A). Additionally, Brown et al. (Cell 2019) found that CX3CR1+ cDC2s produce more IL-6 and TNF-α than their CX3CR1-negative counterparts. Combined, our data on ex vivo stimulated cDC2s indicate that the secretome of activated DC3s in this study is consistent with previous findings. This has been added to the Discussion section. Hopefully, the reviewer will agree that these points do answer some questions, but further research is needed to fully understand these changes and their relation to the cause of non-infectious uveitis.

The manuscript was difficult to read, largely because it is trying to accomplish too many goals, but also because the informatics techniques and external data sets were not described sufficiently for an average reader to readily evaluate the method and conclusions, and the conclusions were overstated throughout the paper. Overall, too many hypotheses were tested, alternative hypotheses were not considered/discussed. The data should probably be divided into at least 2 papers, one which explores the peripheral blood subsets more concretely, and one which attempts to elucidate a mechanisms by which low RUNX3 expression is associated with the genes expressed more highly in DC2s in the peripheral blood of uveitis patients.

We have rewritten sections to improve readability. We have provided more details on the analysis to accommodate readers without experience in computational analyses. We have moved the bulk of the enrichment analysis to the supplement and merged figures 1 and 2. In our opinion, this should have improved the readability of the manuscript, and we hope the reviewer agrees.

1. The rationale for depleting CD14 in the validation cohort is not clear and justified. CD14 expression on dendritic cells has been established in the literature (ex Duterte Immunity 2019). This reviewer wonders if a better flow of data would be to start with the current second cohort, CD14 depleted, ID the black module, realize that some genes discovered have been associated with CD14+DC3, then utilize a second cohort that includes CD14+CD1c+ cells to validate and expand the original gene set.

Based on the reviewer's recommendation, we started with the second cohort and re-ran all analyses. We have merged figure 1 and 2 and believe this improved the flow of the work. It is our hope that the reviewer will agree that this issue has now been addressed appropriately.

2. Experiments probing the transcriptional regulation of the uveitis-enriched gene set are not definitive, but hypothesis-generating, and left in this story, are distracting from the primary observation of a cell type differentially present in the blood of uveitis patients.

Based on the reviewer's recommendation, we moved non-essential transcriptional regulation parts to the supplement and removed the separate transcriptional regulation paragraph. We believe it is important to show that there is no enrichment for type I IFN signalling, but rather for signaling pathways that distinguish discrete subsets of CD1c+ DCs, which forms the basis for flow cytometry analysis. The Results section now summarizes the potential transcriptional regulation very briefly. Our hope is that the reviewer now considers this issue better taken care of within the Results section.

3. The authors claim to have found an inflammatory cell type, but the gene expression profile does not recapitulate inflammation-induced DC2 gene expression profile. Figure 3 attempts to shed mechanistic light but only opens more questions, like if viral infection in mice (figure 3A lower panel) and multiple inflammatory stimuli (figure 3C) induce a transcriptional program opposite what they are finding in these cells in the peripheral blood of uveitis patients, how are the cells identified in this paper likely relevant to eye inflammation?

CX3CR1+ DC3s produce more TNF α and IL-6, so they were regarded as “inflammatory” by us. However, we now believe that this is somewhat confusing, particularly regarding other subsets previously called "inflammatory". The manuscript has been revised to remove this. Unlike type I IFN, this subset is associated with different transcriptional programming mediated by unknown molecular cues. CX3CR1+ cDC2s display a different gene profile than inflammatory (type I IFN) cDC2s in our study, which is consistent with previous studies in mice (PMID: 34526403). We have outlined in greater detail what we believe drives these cells in non-infectious uveitis in the Discussion section.

4. Pro-inflammatory CD14+DC3 increased in blood in SLE patients, but according to authors interpretation, they find a similar cell type is decreased in peripheral blood in uveitis. The authors adhere to a possible explanation that these cells are trafficking to the eye, but by the same logic, SLE patients should have an even more significant reduction, not increase in their peripheral DC3 counts. This is not discussed.

Our view is similar to the reviewer's that this line of reasoning is paradoxical. In the Discussion section, we have substantially revised the comparison of type I IFNs in SLE and signaling in dendritic cells of patients with non-infectious uveitis. Hopefully, the reviewer finds that the revised discussion adequately addresses this issue.

5. Even more importantly, the Chen et al. papers which are cited generally by the authors, showed the opposite- that CD1c+ DCs are increased in the blood of patients with uveitis, and correlate with disease activity. No attempt is made by the authors to compare their data with this data derived from a larger number of patients, or discuss the difference. The authors have essentially ignored this key discrepancy with previously published data.

We agree with the reviewer that a comparison with Chen et al's previous work is warranted. Chen and colleagues attempted to quantify CD1c+ myeloid dendritic cells in their work, but CD11c wasn't used in their flow cytometry panel. Based on our data, this approach would include quantification of CD1c+ CD11c-negative cells as well (Author response image 2). If we include all CD1c+ populations (regardless of CD11c), we would have an overall increase in "CD1c+ DCs" (Author response image 2) – similar to the conclusion by Chen et al. Even when CD11c is not considered in cluster analysis, however, CD1c+ CD11c- cells (cluster 46) do not cluster with our identified CD1c+ DCs, which indicates they may represent a different type of cell. In the Discussion section, we addressed this issue. We hope the reviewer agrees that this discrepancy has now been adequately discussed.

Author response image 2.

Author response image 2.

6. Despite changing some text around the hypothesis that this cell type is reduced in the blood because it migrates to the eye (numerically impossible as pointed out by prior reviewer #1), this notion is reiterated several other places in the paper and should be removed, and frankly, reconsidered. It is also possible that the change in peripheral blood cell type/state frequency results from cytokine-induced precursor emigration/differentiation. Perhaps there is actually a fraction of DC2-type cells that are increased in the blood in uveitis (as Chen found) but express the transcriptional program identified in the paper because they are pre-activated cells?

Based on the reviewer's suggestion in the Discussion section, we have adopted a hypothesis that cytokine-induced precursor emigration/differentiation may also contribute to the change in peripheral blood cell type/state frequency. We have removed the hypothesis that these cells migrate to the eye.

7. The analysis of ocular DC2s which concludes that the current cell type, CD14+DC3s with black module gene expression, are present in the eye is not convincing. The methods are not clearly explained, however it appears that rather than utilizing unbiased cluster analysis and performing differential gene expression analysis between the patients with non-infectious uveitis, and the control (endophthalmitis), or using another technique like GSEA which they used in previous figures to correlate the black module genes with the genes expressed by the ocular DC2s, the authors appear to have selected individual cells that expressed the black modules genes, then compared the expression of black module genes to the cells that did not express black module genes.

We agree with the reviewer that a more unbiased cluster analysis of ocular CD1c+ dendritic cells would be more appropriate. Therefore, we reanalyzed the single cell RNA seq data and conducted cluster analysis of the CD1c+ DCs. Because we aimed to demonstrate that inflamed eyes of patients contain cells that express key genes associated with CX3CR1+ DC3s, we sorted single-cell RNA seq data for CD1c+ using CLEC10A as a classical tissue-cDC2 marker (Heger et al. Front Immunol. 2018), removing monocytes using C5AR1 (CD88- cells, according to Duterte et al. Immunity 2019, Bourdely et al. Immunity 2020). We then clustered cells and compared their gene expression for genes associated with CX3CR1+ DC3. Cluster 1 exhibits the pattern of expression we found in peripheral blood to be associated with CX3CR1+ DC3. We hope the reviewer agrees that CD1c+ DCs in eye fluid appear to cluster into distinct clusters, one of which has a gene profile of key genes that is reminiscent of CX3CR1+ DC3s. Hopefully, the reviewer will agree that we have now addressed this section more effectively.

8. The authors state in their response to reviewer #1 comments "we profiled available eye fluid biopsies and paired plasma by Olink proteomics to measure immune mediators from patients and controls from this study (and several additional samples, including aqueous humor from non-inflammatory cataract controls – see revised Figure 5 panel D). This analysis shows that cytokines produced by CD36+CX3CR1+ DCs such as TNF-α and IL-6 are specifically increased in eye tissue of patients, but not in blood."-Neither this data, or discussion of it are included in the revised manuscript.

We regret this mistake in the revision. This description should not have been included in the rebuttal.

Finally, a concern is that the title is a gross overstatement of their findings:

1. They have not demonstrated that the cells in this paper induce inflammation, and especially not in the context of uveitis- only that similar cells from healthy patients produce a different set of cytokines when stimulated in vitro compared to another cell type.

2. They have not demonstrated that these very cells migrate to the eye, only that similar genes are present in a possibly similar ocular cell type in another data set.

3. They do not demonstrate type I IFN-negative autoimmunity in the eye. This was a huge stretch, presumably from prior assumptions about the mechanisms driving uveitis along with the finding that their cell type does not share a transcriptional program with murine DC2s activated in a viral infection.

We agree with the reviewer and have changed the title to: “Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis”. This seems to be more appropriate for the manuscript, and we hope the reviewer agrees.

In regard to addressing the Previous Editor Concerns:

1. The informatics analysis for most of the paper is likely sufficient, however the methods are not communicated succinctly and clearly such that non-informatics experts can understand the rationale and method for each analysis. The analysis of the intraocular DCs was not clear and from the details provided, did appear appropriate.

We would like to thank the editor for his/her time. We have amended the single cell RNA sequencing analysis in response to both reviewers to accommodate unbiased clustering and reworked the figures and manuscript as needed.

2. Revision of claim to have identified a new type of cDC2- This is still not satisfactory as:

a. authors have not ruled out the possibility that the cells are monocyte-derived by transcriptional analysis, protein expression or functional analysis. The use of CD14-deplete cells to recapitulate the gene expression profile is not sufficient to determine that the cells in this paper are not monocyte-derived, as CD14-expression is demonstrated on cells confirmed by FLT3L response to be dendritic cells in Duterte et al. Immunity 2019.

b. To be defined as a new subset of the previously defined DC3 subset, one would need to exactly replicate the marker expression and then show that the new markers subset that subset further, the current manuscript may simple be focusing on different genes/proteins expressed by one or more previously described subsets.

c. As this paper is useful for describing a cell type or state that differentiates uveitis from healthy patients, these experiments do not need to be done to publish this paper, but the naming of the cell type should be tempered to simply describe the markers that were expressed and suggest how they fit into the Duterte/Villani schema of DC2/DC3 classification. In actuality, the discrimination of cDC2 from monocyte-derived DC2-like cells has proven difficult in many papers, thus the authors are advised to stay out of the mud, so-to-speak.

Our naming of the population has been changed to CX3CR1+ DC3s, which describes the CD5- CD163+ DC3s cells that are CX3CR1-positive in flow cytometry analysis. As a result, we have removed any description related to discriminating cDC3s from monocyte-derived DC3-like cells. We hope the editors agree that this has now been dealt with more clearly and without making any unsubstantiated claims.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Reviewer #1 (Recommendations for the authors):

In the revised paper entitled "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis," Hiddingh, Vandit, Verhagen et al. explore the gene expression of PBMCs in non-infectious uveitis patients and demonstrate a CX3CR1-positive Cd1c+ gene signature that is altered in non-infectious uveitis. They show that this population is decreased in the peripheral blood, could be regulated by notch signaling, expresses proinflammatory cytokines upon stimulation with LTA, and are present in the eye during uveitis.

The hypothesis that a cD1c+ population of DCs that could be related to uveitis in humans is intriguing and deserves further study. Their use of multiple methods to explore this population and the use of multiple cohorts are a strength of the manuscript, and it raises many intriguing questions that are potentially interesting, such as if this population is expressing inflammatory cytokines upon stimulation, why are they decreased in uveitis?

We would like to thank the reviewer for his/hers time to review our work and pointing out the strength our our revised work.

There are still areas where the manuscript is hard to follow and there are some concerns with the experimental methodology. The difficulty following the author's story is partially due to errors in cross-referencing statements in the text with their figures that support the data and understanding the experiments from the figure legends. For instance, in lines 313-315, the authors state "Furthermore, in CD1c+ DCs from healthy human donors, IFN-α did not induce downregulation of RUNX3 as observed CD1c+ DCs from non-infectious uveitis patients. Figure 2 – Figure 2 supplement 1". Data to support this statement is not found in Figure 2 or Figure 2 supplements (only healthy control data).

Our apologies for how the sentence in line 313 was formulated. We meant to say that while RUNX3 was lower in patients with uveitis in RNA-seq data, stimulation of CD1c+ DCs from healthy controls with IFN-α did result in a decrease in RUNX3 as support for that fact that IFN-α is unlikely causing the lower expression of RUNX3 as observed by RNA-seq in uveitis patients. It has been changed to “Furthermore, while RUNX3 was downregulated in RNA-seq data from CD1c+ DCs from non-infectious uveitis patients (Figure 1I), stimulation of CD1c+ DCs with from healthy human donors with IFN-α resulted in upregulation of RUNX3”. Our hope is that the reviewer will agree that this is a more appropriate formulation.

The Figure 2 Supplement 1 legend references "the notch-negative condition in d" with a d in that figure.

This was a typo and has been changed to "the notch-negative condition in b".

Methodologically, the backgating for the manual gating of CD11c/CD1c suggests that the CD36+CX3CR1+ population is really part of a larger population of CD11c+ cells, raising the question of if this population is too poorly defined in this experimental context. This concern is slightly ameliorated by the appearance of a CD36hiCX3CR1hiCD1c+ population in the unsupervised clustering.

Despite these weaknesses, there is enough strength in using multiple methods and replication with multiple patient cohorts to overcome these concerns and to utilize it as a basis to further explore the functions of this population in uveitis pathogenesis.

We are grateful for the reviewer's time and efforts, and are pleased that he/she believes our work is strong enough to publish.

Reviewer #4 (Recommendations for the authors):

The authors have responded to most of the previous reviews and have generated a more clear and cohesive manuscript.

Thanks to the reviewer for reviewing our work and providing recommendations to improve data presentation clarity.

Additional recommendations:

Figure 1

The text rationale for CD14 separation is confusing, consider omitting it.

A better methodology would have been to repeat analysis with new cohort I followed by validation using new cohort II rather than simply comparing the cohorts, but this reads more clearly and logically than the prior version and the overall conclusions seem valid.

Figure 1 Sup 1 not needed, emphasized the odd methodology sorting "cohort II" for CD14- recommend omitting this from the final version, or using instead Figure 3- Supplement 2 could be moved to the supplement for Figure 1 to explain why black module (from the CD14-sorted cohort) is stronger than then enriched modules from cohort I.

As recommended by previous reviewers, we have included Figure 1 Supplement 1 and moved the CD14 analysis to Figure 3 – Supplement 2 (instead of near Figure 1). We believe it is important to highlight this section since it emphasises that CD14+ DC3s and CX3CR1+ DC3s are not identical populations. The current structure of the manuscript conforms to previous recommendations from other reviewers. We hope the reviewer agrees.

CD14+ CD1c+CD11c+CD36+CXCR3+ DC3s seem to be a subset of CD1c+CD11c+CD36+CXCR3+ DC3s, which may be why there is a stronger gene expression signature black module from cohort II vs the blue and green modules from cohort 1.

The possibility of such a scenario is not ruled out. However, we show that CX3CR1 and CD14 expressions are moderately correlated (Pearson's correlation coefficient = 0.35, Figure 3 Supp 2). Furthermore, Figure 3G shows that only the CD14 DC3 population that expresses CX3CR1 is significantly altered in patients when looking at CD14 DC3s.

The supplemental experimental data shows that sorted DC3s from healthy peripheral blood treated with a variety of inflammatory stimuli upregulate RUNX3. One alternative explanation not discussed by the authors is that peripheral blood DC3s are in a precursor or pre-activation state.

We agree that this may be a possibility. We have added this to the Discussion section as follows “It is also possible that the change in CD1c+ DCs observed in this study results from cytokine-induced precursor emigration or differentiation or that the affected peripheral blood DC3s marked by CX3CR1 are in a precursor or pre-activation state.”

Text: in CD1c+ DCs from healthy human donors, IFN-α did not induce downregulation of RUNX3 as observed in CD1c+ DCs from non-infectious uveitis patients, however supplemental figure 2 only tests CD1c DCs from healthy patients. CD1c+ DCs from uveitis patients were never stimulated with IFN to test whether they downregulate RUNX3 after this stimuli. This textual discussion of the experimental data is misleading.

Our apologies for how the sentence in line 313 was formulated. We meant to say that while RUNX3 was lower in patients with uveitis in RNA-seq data, stimulation of CD1c+ DCs from healthy controls with IFN-α did result in a decrease in RUNX3 as support for that fact that IFN-α is unlikely causing the lower expression of RUNX3 as observed by RNA-seq in uveitis patients. It has been changed to “Furthermore, while RUNX3 was downregulated in RNA-seq data from CD1c+ DCs from non-infectious uveitis patients (Figure 1I), stimulation of CD1c+ DCs with from healthy human donors with IFN-α resulted in upregulation of RUNX3”. Our hope is that the reviewer will agree that this is a more appropriate formulation.

Sup figure 3 final panel should be G, not H.

This was a typo. We have changed the panel figures in the legend of Figure 3 – Supplement 1.

Aqueous scRNA samples are listed as obtained from Utrecht in the methods section and should cite the previous dataset.

We regret that this was not clear for ther reviewer, the method now states that “Single cell RNA-seq (scRNA-seq) data from a previous study of as reported by Kasper et al. 2021 of aqueous humor of 4 HLA-B27-positive anterior uveitis (identical to the AU group in this study) patients were obtained and downloaded via Gene Expression Omnibus (GEO) repository with the accession code GSE178833.” We hope the reviewer agrees this is now further clarfified in sufficient details.

Data used from prior sources should be more clearly detailed in legends and text. As the paper reads, it appears that the authors did the murine BMDC on the OP9 culture experiment detailed in Sup Figure 2.

Figure legends and text now include more details on the paper references from which we obtained data.

Figure 5 image is very misleading – "purify tissue CD1c+ DCs" suggests that cells were purified resulting in the displayed UMAP. CLEC10A and C5AR should both be shown and the label should not state CD1c+ if this expression was not assessed- this is misleading.

We agree with the reviewer. We now changed this back to the description of using scGate analysis to select CLECL10A+ and C5AR1- negative cells in the figure and figure legend. We hope the reviewer agrees this better reflects the analysis conducted.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients [Replication cohort] NCBI Gene Expression Omnibus. GSE195501
    2. Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients. NCBI Gene Expression Omnibus. GSE194060
    3. Kuiper JW. 2022. Data and R Scripts for: "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis". DataverseNL. [DOI] [PMC free article] [PubMed]
    4. Dicken J, Mildner A, Leshkowitz D, Touw IP. 2014. The affect of specific ablation of Runx3 from Esam splenic dendritic cells. NCBI Gene Expression Omnibus. GSE48590
    5. Briseño CG, Satpathy AT. 2018. Trancriptional profile of WT and Notch2 cDC2s after immunization with SRBC. NCBI Gene Expression Omnibus. GSE119242
    6. Bosteels C, Neyt K, Vanheerswynghels M, van Helden MJ. 2020. Inflammatory Type 2 cDCs Acquire Features of cDC1s and Macrophages to Orchestrate Immunity to Respiratory Virus Infection. NCBI Gene Expression Omnibus. GSE149619 [DOI] [PMC free article] [PubMed]
    7. Kirkling ME, Cytlak U, Lau CM, Lewis KL. 2018. Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells. NCBI Gene Expression Omnibus. GSE110577 [DOI] [PMC free article] [PubMed]
    8. Kasper M, Heming M, Heiligenhaus A, Meyer zu Hörste G. 2021. Intraocular dendritic cells characterize HLA-B27-associated acute anterior uveitis. NCBI Gene Expression Omnibus. GSE178833 [DOI] [PMC free article] [PubMed]

    Supplementary Materials

    Transparent reporting form
    Supplementary file 1. Supplementary tables.

    (A) Antibody panel used for sorting peripheral blood mononuclear cells. (B) Antibody panel used for determination of CD1c+ DC purity after MACS isolation. (C) Antibody panel used for phenotyping cDC2 populations in uveitis patients. (D) Overview of stimuli used for CD1c+ DC stimulations in Figure 3C. (E) Luminex analysis supernatant of LTA-stimulated CD1c+ DC sorted fraction (protein levels are in pg/mL). (F) Sequences of primers used for RT-qPCR. (G) Results from differential expression analysis and co-expression network analysis in cohort I. (H) Results from differential expression analysis and co-expression network analysis in cohort II. (I) 147 replicated co-expressed genes for cohort 1 and cohort 2

    elife-74913-supp1.xlsx (21.2MB, xlsx)

    Data Availability Statement

    All raw data and data scripts are available via dataverseNL: https://doi.org/10.34894/9Q0FVO and deposited in NCBI's Gene Expression Omnibus accessible through GEO Series accession numbers GSE195501 and GSE194060.

    The following datasets were generated:

    Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients [Replication cohort] NCBI Gene Expression Omnibus. GSE195501

    Kuiper JJ. 2022. Whole transcriptome-sequencing of CD1c+ conventional type 2 dendritic cells of human non-infectious uveitis patients. NCBI Gene Expression Omnibus. GSE194060

    Kuiper JW. 2022. Data and R Scripts for: "Transcriptome network analysis implicates CX3CR1-positive type 3 dendritic cells in non-infectious uveitis". DataverseNL.

    The following previously published datasets were used:

    Dicken J, Mildner A, Leshkowitz D, Touw IP. 2014. The affect of specific ablation of Runx3 from Esam splenic dendritic cells. NCBI Gene Expression Omnibus. GSE48590

    Briseño CG, Satpathy AT. 2018. Trancriptional profile of WT and Notch2 cDC2s after immunization with SRBC. NCBI Gene Expression Omnibus. GSE119242

    Bosteels C, Neyt K, Vanheerswynghels M, van Helden MJ. 2020. Inflammatory Type 2 cDCs Acquire Features of cDC1s and Macrophages to Orchestrate Immunity to Respiratory Virus Infection. NCBI Gene Expression Omnibus. GSE149619

    Kirkling ME, Cytlak U, Lau CM, Lewis KL. 2018. Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells. NCBI Gene Expression Omnibus. GSE110577

    Kasper M, Heming M, Heiligenhaus A, Meyer zu Hörste G. 2021. Intraocular dendritic cells characterize HLA-B27-associated acute anterior uveitis. NCBI Gene Expression Omnibus. GSE178833


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES