Emerging biofilm formation and disinfectant susceptibility of ESBL-producing Klebsiella pneumoniae

Abstract

Klebsiella pneumoniae is an opportunistic pathogen responsible for various infections in humans and animals. It is known for its resistance to multiple antibiotics, particularly through the production of Extended-Spectrum Beta-Lactamases (ESBLs), and its ability to form biofilms that further complicate treatment. This study aimed to isolate and identify K. pneumoniae from animal and environmental samples and assess commercial disinfectants’ effectiveness against K. pneumoniae isolates exhibiting ESBL-mediated resistance and biofilm-forming ability in poultry and equine farms in Giza Governorate, Egypt. A total of 320 samples, including nasal swabs from equine (n = 60) and broiler chickens (n = 90), environmental samples (n = 140), and human hand swabs (n = 30), were collected. K. pneumoniae was isolated using lactose broth enrichment and MacConkey agar, with molecular confirmation via PCR targeting the gyrA and magA genes. PCR also identified ESBL genes (bla_TEM, bla_SHV, bla_CTX-M, bla_OXA-1) and biofilm genes (luxS, Uge, mrkD). Antimicrobial susceptibility was assessed, and the efficacy of five commercial disinfectants was evaluated by measuring inhibition zones. Klebsiella pneumoniae was isolated from poultry (13.3%), equine (8.3%), wild birds (15%), water (10%), feed (2%), and human hand swabs (6.6%). ESBL and biofilm genes were detected in the majority of the isolates, with significant phenotypic resistance to multiple antibiotics. The disinfectants containing peracetic acid and hydrogen peroxide were the most effective, producing the largest inhibition zones, while disinfectants based on sodium hypochlorite and isopropanol showed lower efficacy. Statistical analysis revealed significant differences in the effectiveness of disinfectants against K. pneumoniae isolates across various sample origins (P < 0.05). The presence of K. pneumoniae in animal and environmental sources, along with the high prevalence of ESBL-mediated resistance and biofilm-associated virulence genes, underscores the zoonotic potential of this pathogen. The study demonstrated that disinfectants containing peracetic acid and hydrogen peroxide are highly effective against ESBL-producing K. pneumoniae. Implementing appropriate biosecurity measures, including the use of effective disinfectants, is essential for controlling the spread of resistant pathogens in farm environments.

Introduction

Klebsiella pneumoniae is a significant pathogen affecting both animal and human health. In humans, K. pneumoniae is a leading bacteria responsible for nosocomial infections, contributing to serious conditions such as pneumonia¹. It can lead to severe respiratory issues and increased mortality in poultry, especially in crowded environments². Additionally, in equines, this bacterium can cause respiratory symptoms like hemorrhagic nasal discharge and pneumonia, and it has also been linked to abortion in pregnant mares^3,4.

K. pneumoniae is notorious for acquiring beta-lactam resistance genes, including extended-spectrum beta-lactamases (ESBLs), which pose serious treatment challenges and increase healthcare costs^5,6. These strains resist a broad range of beta-lactam antibiotics, including penicillins and cephalosporins. ESBL-producing K. pneumoniae strains present a particularly significant challenge due to their resistance mechanisms and potential for horizontal gene transfer⁷.

Wild birds serve as reservoirs, shedding the bacterium into the environment, which can lead to contamination of water sources and subsequent transmission to humans and animals^8,9. K. pneumoniae contamination in water sources poses significant public health risks, particularly through pathways such as agricultural runoff, sewage discharge, and animal feces^10,11. Contaminated water can transmit the bacterium to humans and animals, especially in vulnerable populations lacking adequate sanitation. Several studies have suggested that microbes form biofilms in poultry water systems^12,13. Notably, K. pneumoniae strains in water may carry antibiotic resistance and virulence genes, posing a risk of spreading these traits to other pathogens¹⁴.

Biofilms are bacterial communities composed of one or more species embedded within an extracellular matrix made of polysaccharides, proteins, and DNA. Their formation enhances the bacterium’s resistance to antimicrobial agents and external stressors, playing a pivotal role in its pathogenicity¹⁵. For K. pneumoniae, biofilms serve as a key virulence mechanism, offering increased environmental resilience and acting as reservoirs for genetic exchange, thereby promoting the spread of antimicrobial resistance¹⁶.

Studies have identified numerous genes associated with biofilm formation, including those involved in the production of aerobactin (iutA), allantoin (allS), type I fimbriae (fimA and fimH), type III fimbriae (mrkA and mrkD), capsular polysaccharides (CPS) (cpsD, treC, wabG, wcaG, wzc, k2A, and wzyK2), quorum sensing (QS) (luxS), and colonic acid (wcaJ)^17–19. Moreover, the uge gene, which encodes UDP-galacturonate 4-epimerase crucial for LPS biosynthesis, supports biofilm formation by maintaining cell surface integrity, aiding initial adhesion, and enhancing protection within the biofilm^20,21.

Recent evidence indicates that biofilm formation is significantly more prevalent in ESBL-producing K. pneumoniae strains, suggesting that therapeutic guidelines should incorporate the impact of biofilm production when optimizing treatment strategies and clinical outcomes, rather than relying solely on antibiotic susceptibility test results, as these biofilms can protect bacteria from both antimicrobial agents and immune defenses^22,23.

The genetic diversity among clinical isolates of K. pneumoniae, including variations in virulence and resistance genes, underscores the challenge of managing infections caused by this pathogen^14,24. Understanding the mechanisms behind genetic diversity in K. pneumoniae, including specific virulence and resistance genes, their interactions, and their contributions to the pathogen’s overall virulence, is crucial for developing effective strategies to combat biofilm-associated infections, improve patient outcomes, and ultimately lead to new therapeutic approaches for managing and treating these infections^25,26.

Biocides have long been used to reduce microbial populations on various surfaces, serving as a key tool in preventing the proliferation of multidrug-resistant (MDR) organisms and the transmission of infections²⁷. According to the European Commission, a “biocidal product” is defined as a substance that contains one or more active ingredients or facilitates their formation, and is designed to "destroy, deter, or render harmless" microorganisms through non-physical or non-mechanical means to mitigate or eliminate potential adverse effects on host health²⁸. These compounds are typically categorized into four groups based on their primary characteristics and mode of action: antiseptics, sterilants, disinfectants, and preservatives^29,30. A lack of adequate information regarding sanitation programs hinders effective regulation and control of zoonotic disease spread, thereby increasing health risks for both animals and farmers³¹. Farms implement sanitary measures such as spraying disinfectants in sheds and removing feces³².

According to Stringfellow et al.³² the farms implemented sanitation protocols, including disinfectants in shelters and removing feces. Disinfectants are frequently implemented according to the manufacturing guide. Nevertheless, the efficacy of disinfectants can be influenced by various factors, including the degree of organic burden, humidity, temperature, dilution rate, pH, and water hardness. Furthermore, the use of disinfectants without adequate validation and evaluation can lead to a substantial increase in selective pressure, which in turn results in a progressive decrease in the sensitivity of organisms to the disinfectants used. This can result in cross-resistance, in which the organisms develop resistance to antibiotics that are significant to public health³³.

Despite the recognized role of biofilm formation in K. pneumoniae virulence and spread, there is a notable gap in understanding the prevalence of ESBL-producing K. pneumoniae and its association with biofilm-related genes in livestock, particularly poultry, and equine. This study aims to characterize K. pneumoniae in livestock, their environments, and workers, focusing on biofilm formation, antibiotic resistance, ESBL genes, and genetic diversity. Additionally, it evaluates the effectiveness of five disinfectants as biosecurity measures to reduce infection risks in humans and animals.

Materials and methods

Sample collection and preparation

A total of 320 samples were collected between June 2022 and April 2023 from eight farms in Giza Governorate, Egypt, where poultry and equines were affected by respiratory infections. These included 150 nasal swabs from animals with respiratory illness (60 from equines and 90 from broiler chickens), 140 environmental samples, and 30 hand swabs from farm workers. Among the farms, three were poultry farms, and five were equine farms. All samples were analyzed for the presence of K. pneumoniae.

The nasal and hand swabs were collected using sterile swabs, with nasal samples placed in 2 mL of sterile saline (0.9% NaCl) and hand swabs in 9 mL of sterile buffered peptone water (Oxoid, Basingstoke, Hampshire, England).

Environmental samples included 50 livestock drinking water samples (30 from equine water troughs and 20 from poultry drinking sources), 50 feed samples collected from animal pens, and 40 fecal samples from wild birds (10 crows, 10 pigeons, and 20 laughing doves).

Wild birds were captured using mist nets set up for six hours in farm areas and checked every 20 min to identify and mark birds to prevent resampling. Fresh fecal samples from the captured birds were collected using sterile cotton swabs and stored in 15-mL polyethylene tubes.

All samples, including drinking water collected in sterile 1-L glass bottles and feed samples in sterilized bags, were transported to the laboratory in an icebox at 4 °C for microbiological analysis.

Isolation and identification of K. Pneumoniae

Each sample was inoculated into lactose broth (Oxoid, Hampshire, UK) and incubated overnight at 37 °C. Following enrichment, a loopful of the broth was streaked onto MacConkey agar (Oxoid, Hampshire, UK) and incubated at 37 °C for 18–24 h. To isolate Klebsiella species from the water samples, the membrane filtration technique was employed. For this process, 100 mL of each water sample was filtered through a sterile 0.45-µm pore-size membrane filter. The filters were then aseptically transferred onto the surface of MacConkey agar plates and incubated at 37 °C for 18–24 h.

Suspected Klebsiella spp. colonies were selected according to Collee et al.³⁴ and subcultured to obtain pure cultures. To address the limitations of relying solely on colony morphology on MacConkey agar and to ensure accurate identification, the pure culture was subjected to a series of conventional biochemical tests, including catalase, oxidase, oxidative-fermentative, indole, methyl red, Voges-Proskauer, citrate, and triple sugar iron agar tests³⁵. All reagents used for these biochemical tests were sourced from Oxoid (Oxoid, Hampshire, UK).

Molecular confirmation of K. Pneumoniae isolates and detection of ESBL-mediated resistance and biofilm genes

Extraction of the genomic DNA

Two milliliters of enriched lactose broth were centrifuged at 13,000 rpm for 10 min. After discarding the supernatant, 200 µL of nuclease-free water was added to the pellet. The pellet was dissolved and heated in a water bath at 100 °C for 10 min, then cooled to 20 °C and left overnight. The mixture was centrifuged again at 13,000 rpm for 10 min, and the resulting supernatant was used as the DNA template for all PCR reactions³⁶. The extracted DNA was stored at -20 °C for future use.

Molecular confirmation of Klebsiella spp. and K. pneumoniae isolates

Klebsiella isolates were confirmed by amplifying the gyrA gene specific to the Klebsiella genus, as previously described³⁷. For the specific identification of K. pneumoniae, the magA primer was utilized³⁷. Details of the primer sequences, amplicon sizes, and amplification conditions for both the gyrA gene and magA gene are provided in Table 1.

Table 1.

Sequence of oligonucleotide primers used for PCR amplification of Klebsiella spp., ESBLs encoding genes and biofilm genes.

	Target gene	Primer sequence (5ʹ–3ʹ)	Amplicon size (bp)	Amplification conditions
Klebsiella spp.	gyrA	F: CGC GTA CTA TAC GCC ATG AAC GTA R: ACC GTT GAT CAC TTC GGT CAGG	441	Initial denaturation of 5 min at 94 °C followed by 35 cycles, denaturation at 94 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 s, and final extension at 72 °C for 10 min
K. pneumoniae	magA	F: ATT TGA AGA GGT TGC AAA CGAT R: TTC ACT CTG AAG TTT TCT TGT GTTC	130	Initial denaturation of 5 min at 94 °C followed by 35 cycles, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 40 s, and final extension at 72 °C for 10 min
ESBLs encoding genes	bla TEM	F: CGC CGC ATA CAC TAT TCT CAG AAT GA R: ACG CTC ACC GGC TCC AGA TTT AT	445	Initial denaturation of 5 min at 94 °C followed by 30 cycles, denaturation at 94 °C for 1 min, annealing at 61 °C for 1 min, extension at 72 °C for 1 min, and final extension at 72 °C for 5 min
	bla SHV	F: CTT TAT CGG CCC TCA CTCAA R: AGG TGC TCA TCA TGG GAA AG	237
	bla CTX-M	F: ATG TGC AGY ACC AGTAAR GTK ATG GC R: TGG GTR AAR TAR GTS ACC AGA AYC AGC GG	593
	bla OXA-1	F: ACA CAA TAC ATA TCA ACT TCG C R: AGT GTG TTT AGA ATG GTG ATC	813
biofilm genes	LuxS	F: GCC GTT GTT AGA TAG TTT CACAG R: CAG TTC GTC GTT GCT GTT GATG	447	Initial denaturation of 2 min at 95 °C followed by 35 cycles, denaturation at 95 °C for 20 s, annealing at 53 °C for 30 s, extension at 72 °C for 45 s, and final extension at 72 °C for 7 min
	Uge	F: TCT TCA CGC CTT CCT TCA CT R: GAT CAT CCG GTC TCC CTG TA	535
	mrkD	F: CCACCAACTATTCCCTCGAA R: ATGGAACCCACATCGACATT	226

Molecular detection of ESBL encoding genes

All strains confirmed as K. pneumoniae were further screened for relevant ESBL-encoding resistance genes using multiplex PCR as previously described^38,39. This PCR targeted bla_TEM, bla_SHV, bla_CTX-M, and bla_OXA-1 resistance determinant genes using specific oligonucleotide primer sets (Table 1). The PCR reaction was performed in a total volume of 25 µl, consisting of 3 µl of template DNA from each isolate, 12.5 µl of EmeraldAmp MAX PCR master mix (Takara, Japan), 0.5 µl of each primer (10 pmol/µl; Metabion, Germany), and PCR-grade water to complete the volume. Details of the primer sequences and amplification conditions are provided in Table 1.

All PCR products were electrophoresed on a 1.5% agarose gel (vivantis, Malysia) and visualized under a UV transilluminator. A 100 bp DNA ladder (Jenna Bioscience GmbH, Jenna, Germany) was run alongside the samples to determine the size of the PCR amplicon. A negative control, which included all PCR components except water instead of template DNA, was also included. The positive control consisted of the E. coli strain ATCC 25922.

Molecular detection of the biofilm genes

Uniplex PCR was performed on K. pneumoniae isolates to detect the biofilm genes (luxS, Uge, and mrkD). The reaction was performed according to Arafa and Kandil²². The primer sequences, amplification conditions, and amplicon sizes are presented in Table 1. Positive control was included in each set of reactions and the negative control was nuclease-free water that replaced the DNA sample in the PCR mix. The PCR products (S1–S3) were seen on 1.5% agarose gels.

Antimicrobial susceptibility test of selected ESBL-resistant Klebsiella pneumoniae isolates harboring biofilm-associated genes

Antimicrobial susceptibility testing was conducted on 18 selected K. pneumoniae isolates from various sources, exhibiting ESBL resistance and biofilm-associated genes, using the Kirby-Bauer disc diffusion method on Mueller–Hinton agar (Oxoid, Hampshire, UK). A total of 14 antimicrobial agents were tested, including gentamycin(GEN:10 µg), ampicillin (AMP: 10 µg), amoxicillin-clavulanic acid (AMC: 30 µg), erythromycin (ERY: 15 µg), Azithroyn (AZM: 30 µg), cefotaxime (CTX: 30 µg), Ceftazidime (CAZ:30 µg), nalidixic acid (NAL: 30 µg), ciprofloxacin (CIP: 5 µg), norfloxacin(NOR: 5 µg), chloramphenicol (CHL: 30 µg), tetracycline (TET: 30 µg), ceftriaxone (CT: 30 µg), and Clindamycin (CLN:2 µg ) (Oxoid, Hampshire, UK). The interpretation of inhibition zone diameters was based on the recommendations of the Clinical and Laboratory Standards Institute (CLSI)⁴⁰. Isolates were classified as multidrug-resistant (MDR) if resistant to 3 different antimicrobial classes⁴¹.

Effects of different disinfectants on ESBL-producing Klebsiella pneumoniae isolates harboring biofilm-associated genes

Selection of disinfectants

Five commercial disinfectants were prepared and utilized according to the manufacturer’s instructions at ready-to-use concentrations. Disinfectant A contained potassium peroxy-monosulfate and sodium hypochlorite with 1.1% active chlorine (Antec International TD, USA), disinfectant B comprised peracetic acid and hydrogen peroxide at 1.5% (Egy-Holland, Egypt), disinfectant C included a mix of 17.2% isopropanol and 0.28% ammonium compounds (IACs). Disinfectant D was formulated with quaternary ammonium compounds (Fluka Analytical, St. Louis, USA). Finally, Disinfectant E combined quaternary ammonium compounds, glutaraldehyde, formaldehyde, isopropanol, and pine oil (AdvaCare Pharma, USA). Each disinfectant was appropriately diluted per the manufacturer’s guidelines to achieve effective ready-to-use concentrations.

Efficacy testing of disinfectant

The Sixteen Klebsiella pneumoniae isolates selected from animal origin (Equine, poultry, and environment) were inoculated onto Petri plates containing brain–heart infusion agar (BHIA, France) to ensure their purity and vitality. A single colony from each isolate was subcultured on triple sugar iron agar (TSI, Italy) and incubated at 37 °C for 24 h, followed by an additional 24-h incubation at 36 °C ± 1 °C. The microorganisms were then suspended in a sterile saline solution to achieve a final concentration of 0.5 McFarland (1.5 × 10⁸ colony-forming units/ml) and evenly spread onto Mueller–Hinton agar (Oxoid, Hampshire, UK) using the rolling technique and sterile swabs. Six 7-mm wells were created in the agar: one in the center and five others approximately 20 mm away from the center, establishing the agar diffusion test setup. Each well was filled with 50 μL of a different disinfectant, and the plates were incubated overnight to determine the inhibition zones. The efficacy of each disinfectant was assessed by measuring the diameter of the microbial inhibition zones around the wells. Bacteria were considered sensitive if the inhibitory zone diameter exceeded 8 mm. The tests were conducted in triplicate, and the results were evaluated accordingly. A well containing 50 μL of sterile saline served as a negative control. All experiments were conducted using sterile techniques^42,43.

Statistical analyses

The data were analyzed using SPSS version 18.0, with a p-value of less than 0.05 considered statistically significant. Chi-square testing was used to compare multiple groups of categorical samples.

Isolates from various sources were grouped based on their antimicrobial resistance (AMR) traits using a heatmap with hierarchical clustering, generated with the “Heatmap” R package (version 4.2.2, R Foundation for Statistical Computing). Clustering of strains was performed using the pheatmap library (version 1.0.12)⁴⁴.

Results

Occurrence of K. Pneumoniae isolates among different studied isolates

Out of 320 samples, 67 (20.9%) were positive for Klebsiella spp and 31 (9.7%) were positive for K. pneumoniae. Statistical analysis revealed significant variation among sources for the number of Klebsiella spp. positive samples (X² = 12.171, P = 0.016).

From poultry, 90 samples were examined, with 30 (33.3%) positive for Klebsiella spp. and 12 (13.3%) for K. pneumoniae. Equine samples, totaling 60, had 9 (15%) positive for Klebsiella spp. and 8 (8.3%) for K. pneumoniae. Wild bird samples (40) showed 8 (20%) positive for Klebsiella spp. and 6 (15%) for K. pneumoniae. Water samples (50) yielded 12 (24%) positive for Klebsiella spp. and 5 (10%) for K. pneumoniae. Feed samples (50) had 4 (8%) positive for Klebsiella spp. and 1 (2%) for K. pneumoniae. Human hand swab samples (30) showed 4 (13.3%) positive for Klebsiella spp. and 2 (6.6%) for K. pneumoniae.

Occurrence of ESBL-mediated resistance and biofilm genes in K. Pneumoniae isolates

The frequency and variation of ESBL-mediated resistance in K. pneumoniae isolates and biofilm-associated genes obtained from different animal sources and environments were displayed in the Table 2.

Table 2.

Frequency of ESBL resistance genes and Biofilm-associated genes in Klebsiella pneumoniae isolates from Poultry, Equine, Human, and Environmental Samples.

Source	No. of examined samples	Klebsiella spp.	K. pneumoniae	ESBL encoding genes				K. pneumoniae virulence genes (biofilm genes)
		No. positive* (%)	No. positive* (%)	bla TEM	bla SHV	bla CTX-M	bla OXA-1	Uge	mrkD	luxS
Poultry	90	30 (33.3)	12 (13.3)	12	12	11	2	8	7	6
Equine	60	9 (15)	5 (8.3)	4	4	4	0	4	4	4
Wild bird	40	8 (20)	6 (15)	6	6	6	1	3	3	3
Water	50	12 (24)	5 (10)	3	3	3	0	3	3	3
Feed	50	4 (8)	1 (2)	1	1	0	0	1	0	0
Human (hand’s swabs)	30	4 (13.3)	2 (6.6)	2	2	1	0	2	0	0
Total	320	67 (20.9)	31 (9.7)	28	28	24	3	21	17	16
X 2	–	12.171	4.650	3.644	1.296	1.241		1.194	1.098	1.458
P value	–	0.016	0.325	0.302	0.861	0.619	Nd	0.769	0.7775	0.691

X²: Chi-Square.

p value is significant < 0.05.

ND not detected.

Statistical analysis revealed no significant differences for the individual genes bla_TEM (X² = 3.644, P = 0.302), bla_SHV (X² = 1.296, P = 0.861), bla_CTX-M (X² = 1.241, P = 0.619), Uge (X² = 1.194, P = 0.769), mrkD (X² = 1.098, P = 0.7775), and luxS (X² = 1.458, P = 0.691).

Table 3 presents the pattern of biomarker resistance genes and biofilm-associated genes in selected ESBL-producing Klebsiella pneumoniae isolates harboring biofilm-associated genes. Isolates from poultry sources exhibited notable diversity, with two carrying the complete set of resistance genes (bla_TEM, bla_SHV, bla_CTX-M, bla_OXA-1) and biofilm-associated genes (Uge, mrkD, luxS). Similarly, equine sources contributed four isolates with a comparable profile, all possessing bla_TEM, bla_SHV, bla_CTX-M, and the biofilm-associated genes Uge, mrkD, and luxS.

Table 3.

The pattern of biomarker resistance genes and biofilm-associated genes in selected ESBL-producing Klebsiella pneumoniae isolates harboring biofilm-associated genes, used for antibiotic susceptibility testing and experimental analysis.

Source	Sample	No. of isolates	Biomarker resistance genes	Biofilm genes
Poultry Farm	Poultry	2	bla TEM , bla SHV , bla CTX-M , bla OXA-1	Uge, mrkD, luxS
	Poultry	4	bla TEM , bla SHV , bla CTX-M	Uge, mrkD, luxS
Equine Farm	Equine	4	bla TEM , bla SHV , bla CTX-M	Uge, mrkD, luxS
Equine Farm	Wild Birds (Crow)	1	bla TEM , bla SHV , bla CTX-M , bla OXA-1	Uge, mrkD, luxS
Poultry Farm	Wild Birds (Crow, Pigeon)	2	bla TEM , bla SHV , bla CTX-M	Uge, mrkD, luxS
Equine Farm	Water	1	bla TEM , bla SHV , bla CTX-M	Uge, mrkD, luxS
Poultry Farm	Water	2	bla TEM , bla SHV , bla CTX-M	Uge, mrkD, luxS
Poultry Farm	Human	1	bla TEM , bla SHV , bla CTX-M	Uge
Equine Farm	Human	1	blaTEM, blaSHV	Uge
Total		18

Wild bird isolates were diverse, including one isolate containing the full set of resistance and biofilm genes, which was identified on an equine farm. Water samples, however, displayed consistency, with all three isolates from equine and poultry farms harboring bla_TEM, bla_SHV, bla_CTX-M, and the biofilm-associated genes Uge, mrkD, and luxS. Human-derived isolates were variable, with one isolate carrying only bla_TEM, bla_SHV, bla_CTX-M, and Uge, while another had bla_TEM, bla_SHV, and Uge. The antibiotic resistance profiles of selected isolates recovered from Poultry, Equine, Human, and Environmental Samples, across different antibiotic classes, were displayed in Table 4 and Fig. 1.

Table 4.

Antibiotic resistance profiles of selected isolates recovered from Poultry, Equine, Human, and Environmental Samples.

Class	Antibiotics*	No. of resistant K. pneumoniae isolates (%)
		Poultry n = 6 (%)	Equine n = 4 (%)	Water n = 3(%)	Wild Birds n = 3 (%)	Human n = 2(%)	Total n = 18 (%)
Aminoglycosides	GEN	4 (66.6)	2 (50.0)	0 (0.0)	2 (66.6)	1 (50)	9 (50.0)
Penicillins	AMP	5 (83.8)	4 (100)	2 (66.6)	3 (100)	1 (50)	15 (83.3)
	AMC	5 (83.8)	3 (75.0)	0 (0.0)	2 (66.6)	0 (0)	10 (55.5)
Macrolides	ERY	3 (50.0)	1 (25.0)	1 (33.3)	2 (66.6)	1 (50)	8 (44.4)
	AZM	4 (66.6)	3 (75.0)	1 (33.3)	3 (100)	0 (0)	11 (61.1)
Cephalosporins	CTX	4 (66.6)	3 (75.0)	2 (66.6)	2 (66.6)	1 (50)	12 (66.6)
	CAZ	3 (50.0)	1 (25.0)	0 (0.0)	1 (25.0)	1 (50)	6 (33.3)
Quinolones	NAL	2 (33.3)	1 (25.0)	0 (0.0)	1 (33.3)	1 (50)	5 (27.7)
	CIP	2 (33.3)	1 (25.0)	1 (33.3)	0 (0.0)	0 (0)	4 (22.2)
	NOR	4 (66.6)	0 (0.0)	1 (33.3)	1 (33.3)	0 (0)	6 (33.3)
Amphenicols	CHL	3 (50.0)	1 (25.0)	1 (25.0)	1 (25.0)	0 (0)	6 (33.3)
Tetracycline	TET	5 (83.8)	3 (75.0)	1 (33.3)	3 (100)	1 (50)	13 (72.2)
Cephems	CT	5 (83.8)	2 (50.0)	1 (33.3)	2 (66.6)	1 (50)	11 (61.1)
Lincosamides	CLN	3 (50.0)	2 (50.0)	0 (0.0)	2 (66.6)	1 (50)	8 (44.4)

GEN gentamycin, AMP ampicillin, AMC amoxicillin/clavulanic acid, ERY erythromycin, AZM azithroyn, CTX cefotaxime, CAZ ceftazidime, NAL nalidixic acid, CIP ciprofloxacin, NOR norfloxacin, CHL chloramphenicol, TET tetracycline, CT ceftazidime, CLN clindamycin.

Fig. 1.

A heatmap with hierarchical clustering was generated using R packages to visualize ESBL-producing Klebsiella pneumoniae isolates carrying biofilm-associated genes. The isolates were grouped into clusters C1 and C2 based on their phenotypic resistance profiles, while the top of the heatmap (G1 and G2) illustrates the patterns of antibiotic resistance.

The effects of different disinfectants on ESBL-producing Klebsiella pneumoniae isolates harboring biofilm-associated genes

Table 5 shows the sizes of the inhibition zones generated by the different disinfectants. The product based on sodium hypochlorite and containing peracetic acid and hydrogen peroxide was significantly more active (p < 0.05) on all K. pneumoniae strains. We observed no significant differences between the different strains of K. pneumoniae when using disinfectant E (p > 0.05). On the other hand, the results in Fig. 2 show that among different K. pneumoniae isolates, poultry and water had the highest readings for the inhibition zone. In contrast, diseased equine had the lowest inhibition zone. In addition, disinfectant B, followed by disinfectant C, had the highest reading for the inhibition zone. Disinfectants based on peracetic acid and hydrogen peroxide were much more effective against K. pneumoniae isolates than disinfectant (A), which had the lowest inhibition zone (p < 0.001).

Table 5.

The median and interquartile range (IQR) of the inhibition zones (mm) produced by the disinfection products against selected K. pneumoniae isolates.

Sampling	Origin	Inhibition zone (mm) products tested
		Disinfectant A	Disinfectant B	Disinfectant C	Disinfectant D	Disinfectant E
Poultry	Diseased (n = 6)	12a IQR 11–13	49ab IQR 47–53	40a IQR 32–45	19a IQR 17–21	16 IQR 14–18
Equine	Diseased (n = 4)	0b	32b IQR 28–49	21b IQR 16–26	15b IQR13-16	14 IQR13-16
Water	Environmentaln(n = 3)	11a IQR 10–13	55a IQR 52–65	30ab IQR 28–31	15ab IQR 14–17	13 IQR 13–14
Wild	Environmental (n = 3)	0b	41ab IQR 40–42	21b IQR 20–22	13b IQR 12–14	14 IQR 13–15
P value		0.000	0.02	0.002	0.009	0.191

Disinfectants used: Disinfectant A (Potassium peroxymonosulfate,1%), Disinfectant B (peracetic acid and hydrogen peroxide, 1%), Disinfectant C (17.2% isopropanol), Disinfectant D (quaternary ammonium compounds, 0.5%), and Disinfectant E (quaternary ammonium compounds & glutaraldehyde, formaldehyde, 1%).

Different zones of different superscript letters (^{a,b,c & ab}) of the same column are significantly different at P ≤ 0.05.

Fig. 2.

In vitro effectiveness of five disinfectants (at 100% concentration) against ESBL-resistant Klebsiella pneumoniae isolates carrying biofilm-associated genes, sourced from various animal and environmental samples. ^a,b,c,dmeans significant differences between strains.

Discussion

Klebsiella pneumoniae is recognized as a significant pathogen in both nosocomial and community-acquired infections⁴⁵. While it typically resides in the respiratory tract and intestines of healthy individuals, it has the potential to cause severe infections in various tissues and organs, including pneumonia, meningitis, liver abscesses, urinary infections, and sepsis⁴⁶. This study highlights the prevalence of K. pneumoniae in both animals and environmental samples, demonstrating its widespread presence. K. pneumoniae was detected in poultry, equine, and wild bird samples, with a notable presence in avian species. It was also identified in environmental sources like water and feed and human hand swabs. Given its ubiquity and pathogenic potential in humans and animals, K. pneumoniae has attracted significant global attention from researchers¹. The pathogen accounts for approximately 14–20% of infections in the respiratory tract, biliary duct, surgical wounds, and urinary tract⁴⁷. These findings underscore the importance of monitoring and controlling K. pneumoniae across various environments to mitigate its impact on public and animal health.

Klebsiella pneumoniae is well-known for its ability to form biofilms, a critical virulence factor that enhances its antibiotic resistance and shields it from immune responses, thereby increasing its persistence in clinical environments^48,49. Biofilms are composed of a matrix of polysaccharides, extracellular DNA, and proteins, that protect the bacteria and limit antibiotic penetration, contributing to its resistance^15,50. Most Klebsiella pneumoniae isolates exhibit strong biofilm-forming capabilities, which are closely associated with extensive virulence and antimicrobial resistance genes⁵¹.

In this study, all Klebsiella pneumoniae isolates tested positive for the uge gene. Specifically, isolates came from poultry, equines, wild birds, water, feed, and human samples. In comparison, most isolates were positive for the mrkD gene and the luxS gene. These results are consistent with findings from Arafa and Kandil²², who reported that K. pneumoniae isolates from equines were positive for uge and luxS. Similarly, Hamam et al.⁵² found that K. pneumoniae isolates from urinary tract infections carried uge gene.

Studies from different regions reveal varying gene prevalence. Elmeslemany and Yonis⁵³ identified the uge gene in ducklings. In Brazil, Davies et al.⁵⁴ detected both the uge and mrkD genes in wild bird isolates. Similarly, Daehre et al.⁵⁵ in Germany and Ferreira et al.⁵⁶ in Brazil found widespread mrkD gene in broiler chickens and ICU isolates. In Malaysia, Barati et al.⁵⁷ found the uge gene in water isolates.

Conversely, Ashwath et al.¹⁹ observed a reduction in mrkA and mrkD gene expression in K. pneumoniae from clinical specimens, with expression levels varying among strong and moderate biofilm formers. In Iraq, Muhsin et al.⁵⁸ noted the presence of the mrkD gene in clinical and environmental isolates, indicating regional differences in gene prevalence.

In recent years, with the wide application of antibiotics, the resistance of clinically isolated K. pneumoniae has become stronger and stronger. K. pneumoniae that produce extended-spectrum beta-lactamase (ESBLs) have been observed and introduced significant challenges to antibiosis⁵⁹.

All Klebsiella pneumoniae isolates tested positive for the bla_TEM and bla_SHV genes, with most also harboring the bla_CTX-M gene. The bla_OXA-1 gene was less commonly detected, found in a few isolates from poultry and wild birds. These findings are consistent with those of Arafa et al.⁵, who reported the presence of the bla_TEM gene in equine isolates in Egypt, while bla_SHV and bla_CTX-M genes were not detected. Regional variations in the prevalence of resistance genes have been noted. For example, Siqueira et al.⁶⁰ characterized antimicrobial resistance in K. pneumoniae isolates from dogs and a horse in Brazil, identifying multiple ESBL genes, including bla_CTX-M, bla_TEM, and bla_SHV..

The detection of bla_TEM and bla_SHV genes in K. pneumoniae isolates from different sources, including animals and the environment, underscores the significant role of these genes in antimicrobial resistance (AMR). Recent research highlights the increasing concern over the transmission of antibiotic-resistant genes between domestic animals and their owners, emphasizing the zoonotic potential of resistant bacteria^61,62. This underscores the need for vigilant monitoring and control measures to manage the spread of antibiotic resistance.

As observed in this study, the coexistence of multiple ESBL genes with biofilm genes within the same strain indicates a significant potential for gene transfer, which plays a role in the spread of antimicrobial resistance (AMR). This observation is further supported by the findings of Elmeslemany and Yonis⁵³ and other researchers, who emphasized the link between integrons and ESBL genes, suggesting that these genes may be located on the same plasmid.

The increased prevalence of multidrug-resistant pathogens poses significant challenges in treating bacterial infections, largely attributed to the misuse of antimicrobials in both healthcare settings and communities. These findings highlight the need for coordinated efforts to address AMR across different sectors.

AMR is a critical One Health issue, with the spread of multidrug-resistant pathogens among animals, humans, and the environment complicating infection treatment due to biofilms. This underscores the need for vigilant monitoring and control measures to manage the spread of antibiotic resistance.

Chemical biocides are widely used to control infections in healthcare, industry, and targeted home hygiene, interacting with bacterial cells primarily by targeting the cytoplasmic membrane and enzymes. However, improper usage or sublethal concentrations of biocides can lead to antimicrobial resistance and promote the transfer of resistance genes⁶³. This concern is heightened by the potentially harmful effects of chronic biocide exposure on human health and the selection of less susceptible bacterial isolates⁶⁴.

Quaternary ammonium compounds (QACs), such as benzalkonium chloride, are commonly used in disinfectants for medical and food-processing environments, as well as in cosmetics and pharmaceuticals⁶⁵. In our in vitro study, disinfectants containing peracetic acid, isopropanol, and QACs were the most effective against bacterial species, with QAC-based disinfectants showing particular efficacy in Bangladesh. However, prolonged use of QACs in Egypt has led to resistance in poultry settings⁶⁶.

Sodium hypochlorite has been shown to reduce biofilm activity in bacteria like Enterococcus faecalis and Klebsiella pneumoniae, improving effectiveness at higher concentrations^67,68. Recent studies suggest that combining oxidizing agents like sodium hypochlorite and hydrogen peroxide with novel agents, such as chlorhexidine-conjugated gold nanoparticles, can be particularly effective in eliminating K. pneumoniae and preventing biofilm formation^69,70. While our study found that disinfectant A had minimal effectiveness, sodium hypochlorite-based disinfectants have been reported to be highly effective against certain bacterial species, such as S. lentus and M. luteus⁴². Implementing a sustainable control strategy and raising breeders’ knowledge and awareness is essential for the efficient management and mitigation of K. pneumoniae infection.

Conclusion

Klebsiella pneumoniae is notably present in poultry, resident birds, water, equine populations, and humans, with biofilm formation and ESBL genes contributing to its persistence. This investigation revealed that sodium hypochlorite product inhibits and clears K. pneumoniae with varying antibiotic resistance. The effect increased as the concentration increased within the range of bactericidal concentration. Comprehensive surveillance, biosecurity protocols, and efficient infection control methods are essential to minimize its spread and lower the risk of infection in animal and human populations. Collaborative efforts among veterinarians, wildlife biologists, public health officials, and environmental scientists are essential to understanding and addressing the complex dynamics of K. pneumoniae transmission across these interconnected ecosystems.

Author contributions

A.A.A., H.S.K., Z.A., and K.A.A. participated in the study design, bacterial isolation and identification, and molecular detection of biofilm genes by PCR. H.S.K. performed the experiments; D. H. analyzed the data and wrote the manuscript. All authors read and approved the manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

All the data generated or analyzed in this study are included in this published article.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The research was conducted according to the guidelines of the Ethical Committee of the Faculty of Veterinary Medicine, Cairo University, Egypt, and approved by the Institutional Animal Care and use committee, Vet Cu ((VET. CU. IACUC; approval no. Vet CU 18042024926). All experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of the Faculty of Veterinary Medicine, Cairo University, Egypt. The study was carried out in compliance with the ARRIVE guidelines. The oral consent of the humans involved in the study was obtained from all owners after they had been informed of the use of nasal swab samples. Ethical clearance to use human subjects was obtained from the designated health facility (National Research Centre, Giza, Egypt).

Consent for publication

All authors have read the manuscript and consent to publish.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-84149-x.