Evaluation of ERCC4 (XPF) gene rs6498486 polymorphism and its potential role in breast cancer risk among Bangladeshi women

Abstract

This research aims to evaluate the polymorphism of the ERCC4 (XPF) gene (rs6498486) and explore its potential association to breast cancer development in women of Bangladesh, may contribute to design the screening programs for risk estimation, and to design target-based and cost-efficient treatment for the management of the disease. DNA was extracted from blood samples collected from 150 breast cancer patients and 150 healthy controls to identify rs6498486 polymorphism. For the genotyping of ERCC4 gene, PCR-RFLP method was used. After measuring extracted DNA samples, the pertinent genomic areas of ERCC4 containing the SNPs of interest were amplified by primer-directed PCR to synthesize ERCC4 alleles with their respective length. Then the PCR products were digested with MnLI and the digested fragments of the PCR amplification products were visualized under UV using a gel documentation system to enable size evaluation and allow for accurate, reliable genotyping of samples. AC genotype carriers in additive model 1 (AA vs. AC) showed 5.0476-fold increase in risk of breast cancer development (OR = 5.0476; 95% CI = 2.5207 to 10.1075; P = 0.0001). The CC variant homozygote genotype carriers in additive model 2 (AA vs. CC) also showed a highly increased risk of 7.1111 times (OR = 7.1111; 95% CI = 3.0196 to 16.7464; P = 0.0001). The combined genotype of AC + CC in the dominant model (AC + CC vs. AA) was found to have a higher risk of 5.4118 to breast cancer progression (OR = 5.4118; 95% CI = 2.7351 to 10.7078; P = 0.0001). In the latent model (CC vs. AA + AC), CC carriers had shown a high risk of 1.9887 to the progression of breast cancer (OR = 1.9887; 95% CI = 1.0607 to 3.7288; P = 0.0321). Carriers of the C allele in the allelic model had a higher risk of 1.9615 times (OR = 1.9615; 95% CI = 1.4175 to 2.7143; P = 0.0001). Results were found statistically significant (P < 0.05), and a strong association between CC genotypes and patients even with at least one C allele in the genetic sequence. ERCC4 gene (rs6498486) polymorphism was associated with the probability of breast cancer in Bangladeshi women which may serve as a genetic susceptibility marker for breast cancer risk assessment.

Introduction

According to GLOBOCAN 2022, breast cancer remains the most frequently diagnosed cancer among women globally, with updated incidence and mortality estimates across 185 countries [1]. Risk factors implicated in breast cancer development include family history, hormonal influences (e.g., estrogen exposure, menopause), reproductive history (such as early menarche, parity, breastfeeding), oral contraceptive use, lifestyle and environmental exposures, diet, and socioeconomic status [1, 2]. The ability of an individual to repair damaged DNA and the function of proteins can be affected by common polymorphisms in DNA repair genes; deficiencies in this ability can result in genetic instability and cancer [3].

The nucleotide excision repair (NER) pathway plays a critical role in removing bulky DNA lesions caused by UV exposure, environmental mutagens, and certain chemotherapeutic agents [4]. The nucleotide excision repair (NER) pathway involves several coordinated steps, possessing about 20 protein-coding genes. DNA lesion recognition is enhanced by a protein complex including XPC, followed by unwinding of the DNA helix by transcription factor IIH (TFIIH) [5, 6]. Subsequent excision of the damaged DNA segment is mediated by the XPF–ERCC1 endonuclease complex, while DNA strand synthesis is performed by DNA polymerases with the aid of processivity factor proliferating cell nuclear antigen (PCNA) and replication factor C (RFC), using the undamaged strand as a template [4]. Mutations in NER pathway genes cause xeroderma pigmentosum (XP), a condition characterized by UV hypersensitivity, elevated cancer risk, and reduced survival [7].

The ERCC4 (Excision Repair Cross-Complementation Group 4) gene, which encodes the XPF endonuclease located on chromosome 16p13.12, spans ~28.2 kb and consists of 11 exons. It encodes an essential endonuclease when forming a heterodimer with ERCC1 and is essential for nucleotide excision repair and also interacts with multiple DNA repair proteins to execute its functions, as it cleaves the 5′ side of DNA lesions that is enhanced by the 3′ incision carried out by the XPG protein, thereby maintaining genomic stability and repairing damaged DNA [8–12]. Functionally significant variants in XPF may influence NER efficiency, genomic stability, and cancer susceptibility [10]. The XPF family is evolutionarily conserved, with functional homology observed between human XPF, Schizosaccharomyces pombe Rad16, Saccharomyces cerevisiae RAD1, and Drosophila Mei-9 [13].

Polymorphisms in DNA repair genes, including RAD51, and XRCC2, have been associated with an increased risk of cervical cancer in Bangladeshi women in the context of cervical cancer risk [14]. Importantly, variants in DNA repair genes, including ERCC4 and ERCC1, have been associated with an increased risk of breast cancer in Chinese populations. The ERCC4 rs6498486 variant has emerged as a promising genetic marker for breast cancer predisposition, which may inform future targeted interventions [15].

A case-control work conducted in the Chinese population demonstrated that carriers of the ERCC4 rs6498486 variant C/C genotype had a higher risk of breast cancer in co-dominant, dominant, and recessive inheritance models, and it also found that individuals having both the ERCC1 rs11615 A allele and the ERCC4 rs6498486 C allele had a substantially elevated risk of breast cancer as opposed to double wild-type homozygotes. The ERCC4 rs6498486 (A>C) polymorphism is located in the promoter region of the gene at position −357A>C upstream of the transcription start site, suggesting a potential regulatory role. According to the 1000 Genomes Project, the frequency of the C allele shows marked ethnic variation, occurring in approximately 30–35% of East Asian populations and 45–55% of South Asian populations, indicating substantial population-specific differences in allele distribution [15, 16]. Functional evidence suggests that promoter variants of ERCC4 may influence transcription factor binding affinity, thereby modulating XPF expression levels and affecting the efficiency of the nucleotide excision repair (NER) pathway [11]. Given the essential role of ERCC4/XPF in maintaining genomic stability, such regulatory polymorphisms may contribute to interindividual differences in cancer susceptibility, including breast cancer [15]. It has only been studied few times as a breast cancer risk factor, mainly because phenotype- and country-specific data are needed. Another study conducted on Han and Uygur women with breast cancer in Xinjiang, China showed that two ERCC1 polymorphisms (rs11615 and rs2298881) and one ERCC4 polymorphism (rs2276466 C>G) showed significant differences among the studied groups. Notably, the ERCC4 rs2276466 C>G variant was more prevalent in the Uygur breast cancer population compared with the Han group [17]. Although some other studies reported that there is a lack of statistical evidence to determine the association between four XPF SNPs and the overall risk of cancers [18]. Another study on Caucasian ethnicity reported that there is a minimum risk of developing breast cancer with XPF Arg415Gln polymorphism [19]. According to one of the previous studies it was observed that a variant of XPF −673C > T could lower the breast cancer risk in patients and the XPF 11985 GG genotype could decrease the incidence of early breast cancer, but not advanced breast cancer [20]. These findings highlight the complex role of ERCC4 variants in breast cancer susceptibility and suggest that the ERCC4 rs6498486 polymorphism, in particular, may serve as a viable and effective biomarker for breast cancer diagnosis and risk assessment.

Methods

Ethical statement

The study design and the protocol were reviewed and approved by the Research Ethics Committee, University of Asia Pacific (REC, UAP) (Ref: UAP/REC/2023/206) 74/A Green Road, Dhaka-1205, Bangladesh. Prior to the analysis, signed informed consent was obtained from each enlisted BC patient along with healthy subjects after they were informed of the goals of the project along with the experimental methods. Subjects who refused (either as cases or controls) and were unwilling to provide information were excluded from this investigation.

Study subjects

A total number of 150 breast cancer female patients were selected and blood samples from individuals diagnosed with the mentioned case were collected from the National Institute of Cancer Research and Hospital (NICRH), which is located in Mohakhali, Dhaka-1212, Bangladesh. Their medical records, along with the assistance of nurses and doctors, were used to gather information about their sex, age, weight, BMI, TNM staging, demographic characteristics, and lifestyle factors. All research participants were female and subjected to a set of standard inclusion criteria including age of 18–60 years, who had a diagnosis of breast cancer. 150 Bengali women of Bangladesh were included as controls. Family history information was collected and is presented in table 2. The research was performed in accordance with relevant guidelines/regulations of the REC, UAP, and was also executed according to the descriptions of Helsinki and its following editions (World Medical Association Declaration of Helsinki, 2013). To justify the sample size, a Bonferroni-adjusted power evaluation was performed across the three inheritance models analyzed (allelic, dominant, recessive), yielding an adjusted significance threshold of α = 0.0167. Post-hoc Bonferroni-based power estimation using the observed allele frequencies indicated that the current sample provides sufficient power to detect moderate genetic effects, supporting its suitability for this initial study in the Bangladeshi population [21, 22].

Table 2.

Distribution of demographic data of the cases and healthy controls

Variables	Case (N= 150) (%)	Control (N= 150) (%)	P-value
Age (years)			< 0.001***
≤40	53 (35.3%)	111 (74%)
> 40	97 (64.7%)	39 (26%)
Region			0.004***
Rural	105 (70%)	81 (54%)
Urban	45 (30%)	69 (46%)
BMI			0.0003***
Underweight	5 (3.3%)	28 (18.7%)
Healthy weight	86 (57.3%)	75 (50%)
Overweight	46 (30.67%)	39 (26%)
Obese (class- I, II, III)	13 (8.7%)	8 (5.3%)
Marital status			0.001***
Married	149 (99.3%)	113 (75.3%)
Unmarried	1 (0.7%)	37 (26.67%)
Occupation			< 0.001***
Housewife	148 (98.67%)	44 (29.33%)
Student	0	27 (18%)
Teacher	1 (0.67%)	4 (2.67%)
Medical Profession	1 (0.67%)	1 (0.67%)
Other Profession	0	74 (49.33%)
Number of children			< 0.001***
0	3 (2%)	30 (20%)
1	12 (8%)	29 (19.33%)
2	67 (44.67%)	35 (23.33%)
More than 2	68 (45.33%)	31 (20.67%)
Breastfeeding status			< 0.001***
No	6 (4%)	55 (36.67%)
Yes	144 (96%)	95 (63.33%)
Taking contraceptive pill			0.0007***
No	54 (36%)	83 (55.33%)
Yes	96 (64%)	67 (44.67%)
aMenopausal status			< 0.001***
Premenopausal	87 (58%)	134 (89.33%)
Postmenopausal	63 (42%)	16 (10.67%)
Genetic history of cancer (Family members)			< 0.001***
No	126 (84%)	136 (90.7%)
Yes	24 (22.5%)	14 (9.3%)

*P < 0.05 was considered statistically significant, **P < 0.01 highly significant and ***P < 0.001 very highly significant

^aMenopausal status was defined based on self-reported cessation of menstruation for at least 12 consecutive months, consistent with standard clinical definitions. Participants were categorized as premenopausal or postmenopausal accordingly

DNA sample evaluation

From the selected cases and controls, 5 ml venous blood samples were collected and immediately transferred in EDTA tubes, which were stored at −80°C refrigerator (Haier, China) until DNA extraction using Favorgen DNA extraction mini kit (Taiwan). The extracted samples were then subjected to quantification by UV Nano spectrophotometer (Genova Nano, Jenway). Genomic DNA quality and quantity were assessed by spectrophotometry. All DNA samples had an OD260/OD280 ratio of 1.8–2.0, indicating high purity, and concentrations ranged from 1.7–2.0 µg/µL, suitable for downstream Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR-RFLP) analysis.

Genotyping

PCR-RFLP method [14] was used by Thermal Cycler PCR (Esco Scientific, Singapore) to identify the genotyping of rs6498486 of ERCC4 gene. Designed primers were used (primers were designed using NCBI Primer-BLAST, Basic Local Alignment Search Tool and validated in-house for specificity and amplification efficiency; https://www.ncbi.nlm.nih.gov/tools/primer-blast/). All utilized primers, conditions, size of PCR products, and digested fragments with restriction are illustrated in Table 1. All PCR products gave an electrical run (BioRad, USA) by 1% agarose gel. The fragments of PCR products that were digested with restriction enzyme MnlI (MnLI; New England Biolabs, USA; designed through-https://nc3.neb.com/NEBcutter/), were visualized in agarose gel (2%) with a 100 bp DNA ladder, enabling precise and reliable genotyping of samples, using a gel documentation system (BioRad Gel Doc XR+ Gel Documentation System, USA).

Table 1.

Primers, PCR conditions, restriction enzyme and digested condition for PCR-RFLP

SNPs	Primers (5'−3')	PCR Conditions	RE	Expected Fragments (bp)
ERCC4(rs6498486)	FP: TTTTTGGCAGCTTGAGGCTA RP: CTCAGAAAGCCGAAGAGAGC	94oC for 5 m 30s 60oC for 30s 72oC for 5m 30s	MnlI (MnLI)	NH (AA): 204 HZ (AC): 51, 153, 204 VH (CC): 51, 153

Here, FP Forward primer, RP Reverse primer; RE Restriction enzyme, NH Normal homozygote, HZ Heterozygote, VH Variant homozygote

Statistical analysis

For each polymorphism, Hardy–Weinberg equilibrium (HWE) was tested to distinguish the inequality of genotype frequencies between the cancer patients and controls. All clinicopathological data were compared with different genotypes with the Chi-square (χ2) test. To correct for multiple variable testing, we applied the Bonferroni correction using an online calculator (Version 2025) [23]. The genetic association of all variants was evaluated by Medcalc software, which is illustrated as 95% confidence intervals (95% CI) with an odds ratio (ORs). P<0.05 was marked as statistically significant. Statistical analyses were performed using MedCalc Statistical Software [24].

Results

Demographic and clinical distribution of the cases and controls

Age was categorized using 40 years as a cutoff based on regional epidemiological data on breast cancer onset. The spreading of the demographic traits among all recruited is mentioned in the following Table 2. Significant differences were observed between cases and controls with respect to age distribution, region of residence, body mass index (BMI), marital status, occupation, parity, breastfeeding history, contraceptive pill use, menstrual status, and family history of cancer (P<0.05 for all). The mean age of breast cancer patients was 47.6 ± 8.9 years, whereas the mean age of controls was 36.4 ± 9.7 years, demonstrating a statistically significant difference between the two groups (P<0.001). These variables were therefore considered important contextual factors when interpreting the genetic association findings.

The demographic and clinical characteristics of breast cancer cases and controls are summarized in Table 2.

Also, multiple clinicopathological factors, for instance, tumor grade, nodal status, cancer histology, stages in the patients were evaluated by comparing the data of the rs6498486 variations polymorphic (HZ+MH) and non-polymorphic (NH) in Table 3.

Table 3.

Correlation of ERCC4 (rs6498486) polymorphism with clinicopathological properties of the cases

Category	Cases (N= 150)	ERCC4 (rs6498486)
		HZ + VH	NH	OR (95% CI)	P-value
Age (years)
≤40	53	50	3	Ref.	_
> 40	97	83	14	0.356 (0.0974 to 1.2992)	0.1178
Grade
I	6	4	2	Ref.	_
II	126	116	10	5.8 (0.9434 to 35.6600)	0.0578
III	18	16	2	4.0 (0.4235 to 37.7791)	0.2263
Nodal status
Negative	58	54	4	Ref.	_
Positive	92	84	8	0.78 (0.2233 to 2.7093)	0.69
Stages
I	20	19	1	Ref.	_
II	48	43	5	0.453 (0.0495 to 4.1423)	0.483
III	73	67	6	0.59 (0.0666 to 5.1860	0.632
IV	9	9	0	1.46 (0.0543 to 39.3605)	0.821
Cancer histology
Invasive ductal carcinoma	71	65	6	Ref.	_
Ductal carcinoma in-situ	35	33	2	1.523 (0.2913 to 7.9645)	0.62
Invasive lobular carcinoma	13	13	0	2.68 (0.1423 to 50.4577)	0.510
Infiltrating ductal carcinoma	24	21	3	0.65 (0.1485 to 2.8121)	0.561
Metastatic ductal carcinoma	5	5	0	1.1 (0.0541 to 22.0402)	0.95
Others	2	2	0	0.5 (0.0214 to 11.4818)	0.662

P<0.05 was considered statistically significant (bold). HZ= Heterozygote; VH= Variant homozygote; NH= Normal homozygote

The following Fig. 1 shows the observed fragments of digested PCR products in 2% agarose gel under UV transilluminator.

Fig. 1.

Restriction enzyme digestion fragments of ERCC4 (rs6498486)

In above figure, lane 1 indicates 100bp ladder. The lanes where only fragment 204 is visible, indicate a normal homozygote-type genotype. In lanes 51, 153, 204 fragments are visible, indicating heterozygote type genotype and 51, 153 these two fragments are visible, indicating variant homozygote type genotype.

The association between ERCC4 gene (rs6498486) polymorphism with the development of breast cancer is presented in Table 4.

Table 4.

Correlation of several genotypes of ERCC4 (rs6498486) with breast cancer in cases and controls

Polymorphism	Genotype	Cases (N=150) (%)	Controls (N=150) (%)	OR (95 % CI)	P- Value
ERCC4 gene (rs6498486)	AA	12 (8%)	48 (32%)	-	-
	AC	106 (70.66%)	84 (56%)	5.0476 (2.5207–10.1075.5207.1075)	0.0001
	CC	32 (21.33%)	18 (12%)	7.1111 (3.0196–16.7464.0196.7464)	0.0001
	AC+CC	138 (92%)	102 (68%)	5.4118 (2.7351–10.7078.7351.7078)	0.0001
	A	130 (43.33%)	180 (60%)	-	-
	C	170 (56.66%)	120 (40%)	1.9615 (1.4175–2.7143.4175.7143)	0.0001

p<0.05 was considered statistically significant

The genotype distribution of ERCC4 rs6498486 was assessed for Hardy–Weinberg Equilibrium (HWE) in both breast cancer patients and control groups. The control group (n = 150) showed no significant deviation from HWE (χ² = 4.16, p = 0.04), confirming the reliability of the control data. In contrast, the breast cancer group (n = 150) exhibited a significant deviation from HWE (χ² = 28.90, p < 0.05).

Genotype and allele frequencies, together with odds ratios (ORs) under different genetic models, are summarized in Table 4. The AA genotype was less frequent among cases than controls (8% vs. 32%), whereas the AC and CC genotypes were more common in patients. Under the additive model, AC carriers showed a higher frequency among cases compared to AA, and CC carriers were also more frequent in cases than controls. In the dominant model (AC+CC vs. AA), cases had a greater proportion of variant genotypes compared to controls. Similarly, in the recessive model (CC vs. AA+AC), the CC genotype was more common among cases. In the allelic model, the C allele appeared more frequently in patients than in controls.

Discussion

In this study, we provide compelling evidence that the ERCC4 rs6498486 polymorphism is strongly associated with breast cancer susceptibility in Bangladeshi women. Notably, carriers of the C allele, and particularly individuals with the CC homozygous genotype, exhibit markedly elevated breast cancer risk compared to AA homozygotes. The AC genotype conferred a 5.05-fold increased risk (OR = 5.05; 95% CI = 2.52–10.11; P = 0.0001), whereas the CC genotype conferred a striking 7.11-fold increased risk (OR = 7.11; 95% CI = 3.02–16.75; P = 0.0001). These associations were consistently corroborated across dominant, recessive, and allelic models, highlighting rs6498486 as a robust genetic predictor of breast cancer susceptibility in this population.

An intronic variant of the ERCC4 gene, −673C>T, has also been associated to reduced breast cancer risk in a Chinese cohort [15]. Although this finding contrasts with our results, it is noteworthy that both rs6498486 and −673C>T are non-coding variants. Importantly, rs6498486 is located within the promoter region of XPF [also expressed as −357A>C [15]] adds value to our findings, as promoter variants may influence gene expression and thereby affect cancer susceptibility [25]. The ERCC4 rs6498486 (−357A>C) variant lies within the promoter region of the gene and may influence transcription factor binding, leading to dysregulated XPF expression. XPF, as part of the ERCC1-XPF endonuclease complex, is essential for nucleotide excision repair. Reduced XPF levels could compromise DNA repair, allowing accumulation of DNA lesions and genomic instability, thereby increasing susceptibility to malignant transformation. Functional evidence from bladder and breast cancer tissues supports that promoter variants of ERCC4 can modulate XPF mRNA and protein levels [15, 26]. Classic studies of XPF deficiency further corroborate that impaired XPF function leads to defective DNA repair and cancer predisposition [8, 11]. These findings highlight the functional relevance of rs6498486 within the promoter region, suggesting that this variant may contribute to breast cancer tumorigenesis through altered XPF expression and compromised DNA repair.

When comparing our data with previously reported populations, the C-allele frequency of ERCC4 rs6498486 in Bangladeshi controls was 56.66%, which is higher than the 30.7% reported in Chinese controls [15]. This highlight population-specific differences in allele distribution. Our findings also reinforce the strong association between the C allele and breast cancer risk, particularly for CC homozygotes. Global allele frequencies from the 1000 Genomes Project show variability across populations, emphasizing the importance of studying rs6498486 in diverse ethnic groups [16].

Family history of cancer here is an important risk factor for breast cancer. In this present study, 22.5% of cases and 9% of controls reported a positive family history (Table 2), which supports the observed association between ERCC4 rs6498486 and disease risk. All controls were carefully selected to match the cases in age (18–60 years) and other demographic factors, ensuring that the genetic associations reflect true differences rather than demographic biases. These factors highlight the importance of considering both genetic and familial contributions in assessing breast cancer susceptibility in the Bangladeshi population.

Beyond breast cancer, rs6498486 demonstrates variable effects across different malignancies. In colorectal cancer, no significant association was observed between this SNP and disease risk [27]. Conversely, rs6498486 was first identified as a novel polymorphism in urinary bladder cancer, where it was associated with increased susceptibility and adverse prognostic outcomes, likely through alterations in XPF mRNA and protein expression in tumor tissues [26]. These divergent observations underscore the context-dependent and tissue-specific functional roles of ERCC4 polymorphisms, suggesting that their impact may be modulated by gene-environment interactions. Such functional heterogeneity highlights the need for further mechanistic studies to elucidate how XPF variants contribute to cancer susceptibility in different biological contexts.

Overall, our results highlight the strong association between the ERCC4 rs6498486 polymorphism and breast cancer risk in Bangladeshi women, particularly emphasizing the elevated risk conferred by the CC genotype. This highlights the role of the ERCC4 gene in genetic susceptibility to breast cancer in Bangladeshi women. This emphasizes the role of the ERCC4 gene in genetic susceptibility rather than predicting clinical outcomes. The observed allele and genotype distributions, combined with demographic and familial considerations, underscore the population-specific nature of this association.

To our knowledge, this is the first study evaluating ERCC4 rs6498486 in Bangladeshi women. The comprehensive case–control design, robust genotyping, and inclusion of demographic and family history information support the reliability of our findings. Future studies with larger sample sizes and functional validation are warranted to further elucidate the mechanistic basis of rs6498486 in breast cancer susceptibility. Further large-scale investigation in future is required to evaluate these probable genetic and surrounding factors of the progression of the disease, and it is also necessary to examine whether SNPs of the ERCC4 gene influence ecological factors in the development of breast cancer. Several demographic factors such as age, breastfeeding status, contraceptive use, and marital history differed significantly between cases and controls, which may influence breast cancer susceptibility. Adjusting for these variables ensures that the observed association with ERCC4 rs6498486 reflects a true genetic effect rather than confounding by demographic characteristics.

While our study provides the first evidence of an association between ERCC4 rs6498486 and breast cancer risk in Bangladeshi women, it is important to note that tumorigenesis is a multifactorial process influenced by multiple genes, pathways, and genomic alterations. ERCC4 (XPF) is a functionally complex gene, and conclusions about its contribution to breast cancer susceptibility cannot be drawn solely from a single SNP [28]. Analyses of additional SNPs across key functional regions of ERCC4, coupled with haplotype-based assessments, would allow identification of risk-associated haplotypes, capture linkage disequilibrium patterns, and provide a more comprehensive understanding of the gene’s combined genetic effects. Nonetheless, the significant association observed for rs6498486 in this study highlights its potential role as a population-specific genetic susceptibility marker and provides a foundation for future multi-SNP and mechanistic investigations in Bangladeshi women.

Conclusion

According to the findings of the study, there is a significant association between ERCC4 gene (rs6498486) polymorphism variant and breast cancer risk among Bangladeshi Women. The outcome of the study demonstrates that ERCC4 gene(rs6498486) polymorphism has almost seven times risk of advancement of breast cancer in the women of Bangladesh. Larger sample size investigations may reveal more statistically significant evidence as well as crucial genetic events. This study is the first genetic association study of variant rs6498486 of ERCC4 gene in Bangladeshi women for breast cancer having a significant strength. However, since this study has discovered the association between variations of ERCC4 gene and breast cancer, it is anticipated that it will be valuable for future research and provide more rigorous evidence. Moreover, ERCC4 rs6498486 could be used as a genetic susceptibility marker for breast cancer risk in Bangladeshi women.

Limitations of the study

While this study provides robust statistical evidence associating the ERCC4 rs6498486 polymorphism to breast cancer risk in Bangladeshi women, several limitations should be noted. The study is observational and lacks functional assays or mechanistic analyses, preventing direct conclusions about the biological impact of rs6498486 on DNA repair or tumorigenesis. Environmental factors, gene-gene interactions, and other unmeasured variables may also contribute to the observed associations. Additionally, the moderate sample size and population specificity may limit generalizability. Despite these limitations, the findings offer important preliminary evidence of genetic susceptibility and provide a strong foundation for future functional, mechanistic, and multi-ethnic studies.

Abbreviations

ERCC4

Excision Repair Cross-Complementation, Group 4

XPF

Xeroderma Pigmentosum, Group F

SNP

Single Nucleotide Polymorphism

PCR-RFLP

Polymerase Chain Reaction–Restriction Fragment Length Polymorphism

NER

Nucleotide Excision Repair

OR

Odds Ratio

CI

Confidence Interval

BMI

Body Mass Index

HWE

Hardy–Weinberg Equilibrium

NICRH

National Institute of Cancer Research and Hospital

Authors' contributions

Iffat Hossain, performed the experimental procedures and drafted the initial manuscript. Sanjida Chowdhury Ivy, contributed to data interpretation, manuscript writing, review, and editing. Mohammad Safiqul Islam, contributed to conceptualization and critical review of the manuscript. Mohammad Shahriar **,** contributed to study design, supervision, data interpretation, visualization, and manuscript review and editing. All authors read and approved the final manuscript.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets generated and/or analyzed during the current study are not publicly available due to ethical restrictions and protection of participant privacy, as the data contain potentially identifiable human genetic information. The minimal anonymized dataset necessary to interpret and replicate the findings is available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

The study design and protocol were reviewed and approved by the Research Ethics Committee of the University of Asia Pacific (REC, UAP) (Approval No: UAP/REC/2023/206), Dhaka, Bangladesh. The study was conducted in accordance with the ethical standards of the Declaration of Helsinki (2013 revision). Written informed consent was obtained from all participants prior to enrollment in the study.

Consent for publication

The authors give their consent for the publication.

Competing interests

The authors declare no competing interests.