Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2019 Mar 21;93(7):e02256-18. doi: 10.1128/JVI.02256-18

Minichromosome Maintenance Proteins Cooperate with LANA during the G1/S Phase of the Cell Cycle To Support Viral DNA Replication

Prerna Dabral a, Timsy Uppal a, Cyprian C Rossetto a, Subhash C Verma a,
Editor: Richard M Longneckerb
PMCID: PMC6430539  PMID: 30651368

LANA-mediated latent DNA replication is essential for efficient maintenance of KSHV episomes in the host. During latency, virus relies on the host cellular machinery for replication, which occurs in synchrony with the cellular DNA. LANA interacts with the components of multiple cellular pathways, including cellular replication machinery, and recruits them to the viral origin for DNA replication. In this study, we characterize the interactions between LANA and minichromosome maintenance (MCM) proteins, members of the cellular replication complex. We demonstrated a cell cycle-dependent interaction between LANA and MCMs and determined their importance for viral genome replication and maintenance through biochemical assays. In addition, we mapped a 50-amino acid region in LANA which was capable of abrogating the association of MCM6 with LANA and blocking DNA replication. We also detected LANA along with MCMs at the replication forks using a novel approach, isolation of proteins on nascent DNA (iPOND).

KEYWORDS: KSHV, latency, latent DNA replication, MCMs, tumor virus

ABSTRACT

Latency-associated nuclear antigen (LANA) is essential for maintaining the viral genome by regulating replication and segregation of the viral episomes. The virus maintains 50 to 100 episomal copies during latency and replicates in synchrony with the cellular DNA of the infected cells. Since virus lacks its own replication machinery, it utilizes the cellular proteins for replication and maintenance, and LANA has been shown to make many of these proteins available for replication by directly recruiting them to the viral origin of replication within the terminal repeat (TR) region. Our studies identified members of the minichromosome maintenance (MCM) complex as potential LANA-interacting proteins. Here, we show that LANA specifically interacts with the components of the MCM complex, primarily during the G1/S phase of the cell cycle. MCM3 and -4 of the MCM complex specifically bound to the amino-terminal domain, while MCM6 bound to both the amino- and carboxyl-terminal domains of LANA. The MCM binding region in the N-terminal domain mapped to the chromatin binding domain (CBD). LANA with point mutations in the carboxyl-terminal domain identified an MCM6 binding domain, and overexpression of that domain (amino acids [aa] 1100 to 1150) abolished TR replication. Introduction of a peptide encompassing the LANA aa 1104 to 1123 reduced MCM6 association with LANA and TR replication. Moreover, a recombinant Kaposi’s sarcoma-associated herpesvirus (KSHV) expressing LANA with a deletion of aa 1100 to 1150 (BAC16Δ1100–1150, where BAC is bacmid) showed reduced replication and persistence of viral genome copies compared to levels with the wild-type BAC16. Additionally, the role of MCMs in viral replication was confirmed by depleting MCMs and assaying transient and long-term maintenance of the viral episomes. The recruitment of MCMs to the replication origins through LANA was demonstrated through chromatin immunoprecipitation and isolation of proteins on nascent replicated DNA (iPOND). These data clearly show the role of MCMs in latent DNA replication and the potential for targeting the C-terminal domain of LANA to block viral persistence.

IMPORTANCE LANA-mediated latent DNA replication is essential for efficient maintenance of KSHV episomes in the host. During latency, virus relies on the host cellular machinery for replication, which occurs in synchrony with the cellular DNA. LANA interacts with the components of multiple cellular pathways, including cellular replication machinery, and recruits them to the viral origin for DNA replication. In this study, we characterize the interactions between LANA and minichromosome maintenance (MCM) proteins, members of the cellular replication complex. We demonstrated a cell cycle-dependent interaction between LANA and MCMs and determined their importance for viral genome replication and maintenance through biochemical assays. In addition, we mapped a 50-amino acid region in LANA which was capable of abrogating the association of MCM6 with LANA and blocking DNA replication. We also detected LANA along with MCMs at the replication forks using a novel approach, isolation of proteins on nascent DNA (iPOND).

INTRODUCTION

Kaposi’s sarcoma-associated herpesvirus (KSHV), or human herpesvirus 8 (HHV-8), an oncogenic virus of the gammaherpesvirus family, is associated with several malignancies, including Kaposi’s sarcoma (KS), multicentric Castleman’s disease, and primary effusion lymphomas (PEL) in immunocompromised individuals (1, 2). Similar to the life cycles of other herpesviruses, the life cycle of KSHV consists of a dominant latent phase and a transient lytic phase. During latency, which is the default program of the virus, there is restricted expression of viral genes, and the virus predominantly relies on the cellular proteins to sustain itself inside the host (3). In contrast, the lytic or productive phase is characterized by the expression of viral genes in a fully orchestrated manner accompanied by the production of virions (4, 5). Among the viral genes expressed during latency is the latency-associated nuclear antigen (LANA), which serves as the master regulator of latency (6). LANA, a 1,162-amino-acid (aa) protein, is a multifunctional nuclear protein which plays an important role in inducing malignancies (79). LANA is crucial for the maintenance of KSHV episomes in the infected cells by supporting replication and segregation of the viral genome into the daughter cells (10). LANA achieves this by tethering to the host chromosome through its N-terminal chromatin binding domain (CBD) and binding to the viral genome through its C-terminal DNA binding domain (1115).

During latency, virus replicates along with the host cellular DNA, and LANA plays an important role in initiating replication at the origins of terminal repeats (TR) (16, 17). The latent DNA replication occurs once per cell cycle in conjunction with cellular replication and maintains 50 to 100 copies of viral episomes in KSHV-infected cells (18). Since only a limited number of viral genes are expressed during latency and since these proteins lack any enzymatic activity, including helicase/polymerase required for DNA replication, virus depends on the host’s cellular proteins for these functions. LANA has been shown to interact with many cellular replication proteins and recruits them to the origin of replication in the TR in order to facilitate latent DNA replication (19, 20). LANA bound to the replication origin is thought to recruit replication proteins in an orchestrated manner, starting with the recruitment of the origin recognition complex (ORC) followed by recruitment of Cdc6, Cdt1, and MCMs to form the prereplicative (pre-RC) complex during the G1 phase of the cell cycle (6, 21).

LANA has been shown to interact with topoisomerase IIb and recruits it to the origin through its N terminus, and blocking the topoisomerase activity abrogated latent viral replication (22). LANA is shown to interact with members of the ORCs through its C terminus during the G1/S phase of the cell cycle, and these interactions are essential for viral genome persistence and replication (2325). LANA also recruits DNA polymerase clamp loader, proliferating cell nuclear antigen (PCNA), and replication factor C (RFC) to the latent origin in order to drive replication and was found to be essential for episome persistence (26).

Minichromosome maintenance complexes, or MCMs, were shown to be part of the viral chromatin at the replication origin in the terminal repeat region, but the mechanism of their recruitment to the viral genome was not clear (2325). Our yeast-two hybrid assay identified MCMs as potential LANA-interacting proteins (27). The complex composed of MCM2 to MCM7 (MCM2–7) is a six-membered replicative helicase that binds to the replication origin and melts double-stranded DNA (dsDNA) to initiate replication and acts as a helicase on elongating DNA (2831). MCMs are localized in the nucleus and are present at a concentration of ∼105 to 106 copies per cell (3235). Initiation of replication requires the formation of a prereplication complex (pre-RC) at the origin of replication where components of the replication machinery are assembled sequentially. The process begins with the recruitment of origin recognition complex (ORC) during the G1 phase of the cycle, followed by the recruitment of MCM2–7 complex in an inactive state by Cdt1 (36). MCMs are phosphorylated by cellular kinases, Dbf4-dependent kinase (DDK) and cyclin-dependent kinase (CDK), for activation and recruitment of other cellular proteins essential for replication, including Cdc45 and GINS (37, 38).

Here, we show that LANA binds to MCM complex and recruits these proteins to the origin of DNA replication, which was confirmed by chromatin immunoprecipitation (ChIP) assays, as the depletion of LANA significantly reduced MCM loading onto the origin. These proteins specifically associated during the replicative, G1/S phase of the cell cycle, as determined by specific localization of LANA and MCMs in the nuclei of KSHV-infected cells. MCMs interacted with both N and C termini of LANA, and amino acid (aa) residues 1100 to 1150 contributed to its binding to MCM6. Importantly, expression of this domain (aa 1100 to 1150) of LANA competitively reduced MCM binding to LANA and suppressed DNA replication. Additionally, a recombinant KSHV having a deletion of aa 1100 to 1150 in LANA’s C-terminal domain (BAC16Δ1100–1150, where BAC is bacmid) showed reduced replication and persistence of the viral genome compared to the level of the virus with wild-type LANA (BAC16wt). We also show that depletion of MCMs blocked transient DNA replication and reduced copies of the latency-persisting episomes. Most importantly, the association of MCMs with LANA was confirmed on replicating DNA by detecting proteins on newly synthesized DNA using a novel approach, isolation of proteins on nascent DNA (iPOND).

RESULTS

LANA associates with MCMs in KSHV-infected cells.

LANA, the most abundantly expressed viral protein during latency, interacts with viral DNA and many cellular proteins, including the replication complexes, and recruits them to the origin of DNA replication in the terminal repeat region (23, 24, 26). MCMs, the cellular helicases, were identified as LANA-interacting proteins in our protein-protein and yeast-two hybrid assays (27). Chromatin immunoprecipitation assays showed the presence of MCMs on the chromatin of the terminal repeat region, but whether they were recruited through viral factors for replication was not known. To determine whether LANA can directly bind to MCMs and recruit them to the episomes, we assayed LANA’s interactions with MCMs through coimmunoprecipitation (co-IP) of the endogenous proteins from KSHV-positive BCBL-1 and BC3 cells and control BJAB cells. The lysates were treated with DNase to eliminate any association of proteins through DNA. Immunoprecipitation with LANA, followed by detection with specific antibodies of the MCM complex (MCM2, MCM3, MCM4, MCM5, MCM6, and MCM7), showed LANA’s interaction with MCM3, MCM4, and MCM6 (Fig. 1A, lanes 5 and 6). The specificity of this interaction was confirmed by the lack of coprecipitating MCMs from KSHV-negative BJAB cells (Fig. 1A, lane 4).

FIG 1.

FIG 1

LANA associated with MCM3, MCM4, and MCM6 in KSHV-positive PEL cells. (A) Coimmunoprecipitation of endogenous LANA with MCMs using mouse anti-LANA antibody from KSHV-positive BC3 and BCBL-1 cells. KSHV-negative BJAB cells were used as a negative control. The immunoprecipitated proteins were detected using antibodies to LANA and MCM2, MCM3, MCM4, MCM5, MCM6, and MCM7. LANA was detected with anti-LANA antibody. (B) HEK293T cells were cotransfected with full-length LANA and full-length MCMs with either a Flag or Myc tag (a, LANA-Myc and MCM4-Flag; b, LANA-Flag and MCM6-Myc, c, LANA-Myc and MCM3-Flag). The cells were lysed at 36 h posttransfection; immunoprecipitation was performed with either anti-Myc (IP: Myc) or anti-Flag (IP: Flag) antibody, as indicated. LANA and MCMs were then detected by immunoblotting (IB) with the indicated antibodies. Cells transfected with empty vector (V), pA3M, were used as a negative control. (a. (C) HEK293T cells were cotransfected with full-length LANA and full-length MCMs with either a Flag or Myc tag (a, LANA-Myc and MCM4-Flag; b, LANA-Flag and MCM6-Myc, c, LANA-Myc and MCM3-Flag). The cells were lysed at 36 h posttransfection; immunoprecipitation was performed with either anti-Myc (IP: Myc) or anti-Flag (IP: Flag) antibody, as indicated. LANA and MCMs were then detected by immunoblotting (IB) with the indicated antibodies. Cells transfected with empty vector (V), pA3F, were used as a negative control.

To further confirm that the association between the LANA and the MCMs was not dependent on any other viral proteins, we tested their interactions in an overexpression system. We performed coimmunoprecipitation from HEK293T cells transiently expressing LANA along with MCMs associating endogenously in a previous assay. MCM3-Flag, MCM4-Flag, or MCM6-Myc was cotransfected with an appropriate epitope-tagged LANA or empty vector, followed by immunoprecipitation of LANA using tag-specific antibodies, and detection of MCMs showed specific coprecipitations of MCM3, -4, and -6 (Fig. 1B, subpanels a to c). Lack of MCM precipitation in vector transfected cells confirmed the specificity of their interactions. To further validate their interactions, we performed reverse coimmunoprecipitation using antibodies to precipitate MCMs and detection of LANA with the indicated antibodies (Fig. 1C). LANA specifically coprecipitated with these MCMs (MCM3, -4, and -6) but not with the empty vectors, confirming their interaction (Fig. 1C, subpanels a to c).

LANA colocalizes with MCMs in KSHV-positive cells during the replicative phase.

Viral DNA replication during latency is thought to occur in conjunction with cellular DNA replication. The recruitment of MCMs to the origins is well defined, which begins in the late-G1 phase of the cell cycle through a sequential assembly of the components of the pre-RC complex (3944). The MCMs are converted into active helicases only during the G1/S phase of the cell cycle through phosphorylation with cellular kinases. Since the latent DNA replication occurs in synchrony with cellular replication, we wanted to determine whether the interaction between LANA and MCMs is limited to the actively replicating phase of the cell cycle or occurs throughout the cell cycle. To this end, we performed immunofluorescence assays (IFAs) in replicating (G1/S) cells as well as in mitotic (G2/M)-phase cells. To achieve these specific phases, cells were treated with mimosine (G1/S) and colchicine (G2/M) and stained with rat anti-LANA and mouse anti-MCM3, -MCM4, and -MCM6 antibodies. LANA showed a distinct punctate pattern in the nuclei of PEL cells (Fig. 2A), as expected. In many of the foci of MCMs (MCM3, -4, and -6), enrichment matched to the LANA dots during the G1/S phase of the cell cycle (Fig. 2A, frames a to c). An enlargement of the specific foci (red, LANA; green, MCMs) showed colocalization of LANA with these MCMs, represented by yellow spots, during the G1/S, replicating phase of the cells cycle (Fig. 2A, frames a to c). In contrast, cells in the mitotic phase (colchicine-treated) did not show LANA’s localization with MCMs (Fig. 2A, frames a to c). Nuclear staining with TO-PRO3 (blue) confirmed that these proteins were in the nuclear compartment. Differential interference contrast (DIC) images show the outline and the integrity of the cells.

FIG 2.

FIG 2

LANA colocalizes with the components of MCM complex in KSHV-positive cells during the replicative, G1/S, phase. (A) Immunofluorescence analysis of endogenous LANA and MCM4, MCM3, and MCM6 in mimosine-treated KSHV-positive cells. Cells were stained with rat anti-LANA and mouse anti-MCM4 (a), anti-MCM3 (b), and anti-MCM6 (c) and subsequently detected with secondary anti-rat Alexa Fluor 594 (red) for LANA and anti-mouse Alexa Fluor 488 (green) for MCMs. Nuclei stained with TO-PRO-3 are shown in blue. DIC images were captured to depict cell morphology. LANA and the components of the MCM complex colocalized in the same nuclear compartments, as indicated by yellow punctate dots, during the G1/S phase of the cell cycle. (B) Immunofluorescence analysis of endogenous LANA and MCM4, MCM3, and MCM6 in colchicine-treated (G2/M arrested) KSHV-positive cells. Cells were stained with rat anti-LANA and mouse anti-MCM4 (a), MCM3 (b), and MCM6 (c) antibodies. Secondary antibodies, anti-rat Alexa flour 594 (red) and anti-mouse Alexa flour 488 (green), were used for LANA and MCM4 (a) and MCM3 (b), respectively. Secondary antibodies, anti-rat Alexa flour 488 (green) and anti-mouse Alexa flour 594 (red), were used for LANA and MCM6 (c), respectively. Nuclei were stained with TO-PRO-3 (in blue).

The amino and carboxyl termini of LANA interact with MCMs.

In order to determine the domains of LANA responsible for interaction with MCMs, we performed coimmunoprecipitation assays in HEK293T cells transfected with LANA mutants expressing either the amino-terminal (aa 1 to 340) or the carboxyl-terminal (aa 940 to 1162) domain of LANA (LANA-N or LANA-C, respectively) along with epitope-tagged full-length MCMs. Immunoprecipitation with anti-Myc antibody and subsequent detection of coprecipitating MCM3 and MCM4 showed their binding to the amino-terminal but not to the carboxyl-terminal domain of LANA (Fig. 3A, subpanels a and b). Similarly, immunoprecipitation of LANA-N and LANA-C with anti-Flag antibody and subsequent detection of coprecipitating MCM6 showed its binding with both termini of LANA (Fig. 3A, subpanel c). Specificities of these interactions were confirmed by the lack of any coprecipitating protein with empty vectors. In order to confirm that these interactions are direct, we used a glutathione S-transferase (GST) pulldown assay in which lysates from MCM3-, MCM4-, and MCM6-expressing HEK293T cells were incubated with bacterially purified GST fused with LANA-N or LANA-C. Similar to the above immunoprecipitation results, MCM3 and MCM4 interacted with only the amino-terminal domain of LANA, whereas MCM6 interacted with both the amino and carboxyl termini of LANA (Fig. 3A, subpanel d). GST alone was used as a control, which did not bind to any MCMs, confirming the specificity of their interactions. In addition, we confirmed direct associations of MCMs with LANA through proteins prepared from a cell-free in vitro translation system. In vitro-translated MCM4 was incubated with bacterially purified LANA truncations, LANA-N, and LANA-C fused to GST. We performed an in vitro translation and interaction assay with only MCM4 because the other MCMs were untranslatable. Importantly, MCM4 bound to the amino-terminal domain of LANA, similar to results of the above-described binding assays (Fig. 3A, subpanel e). This assay confirmed that both the amino and carboxyl termini of LANA are capable of binding to MCMs.

FIG 3.

FIG 3

The amino and carboxy termini of LANA interacted with the MCMs. (A) HEK293T cells were transfected with Myc-tagged empty vector (V), EGFP-LANA-N (N; aa 1 to 340), and EGFP–LANA-C (C; aa 940 to 1160) along with Flag (F)-tagged MCM3 (a) and MCM4 (b) or with empty vector (V) and pA3F–LANA-N (N) and pA3F–LANA-C (C), along with Myc (M)-tagged MCM6 (c). The cells were lysed at 36 h posttransfection; immunoprecipitation was performed with anti-Myc antibody or anti-Flag antibody, as indicated, followed by detection with anti-Flag and anti-Myc antibodies. (d) HEK293T cells transfected with MCM3, MCM4, or MCM6 were lysed 36 h posttransfection. After preclearing with GST beads, the cellular lysates were incubated with GST alone, LANA-N–GST, or LANA-C–GST beads. The bead-bound proteins were resolved on SDS-PAGE and detected with anti-Flag, anti-Myc, and anti-GST antibodies. (e) In vitro-translated MCM4-Flag protein was rotated with GST alone, LANA-N–GST, or LANA-C–GST beads. The bead-bound proteins were resolved by SDS-PAGE and visualized by autoradiography. SDS-PAGE and Coomassie staining were used to detect the expression of GST and the GST fusion proteins. The red arrows indicate the LANA N-terminal or C-terminal protein. (B) HEK293T cells were transfected with pA3M (empty vector, V), a LANA truncation mutant spanning amino acids 1 to 340 (LANA1–340)-GFP-Myc, LANA1–250-GFP-Myc, LANA1–150-GFP-Myc, LANA33–150-GFP-Myc, or LANA1–32-GFP-Myc. Cellular lysates were subjected to immunoprecipitation with anti-Myc antibody to detect coimmunoprecipitated endogenous MCM3, MCM4, and MCM6. (C) The schematic shows point mutations in the LANA N terminus spanning amino acids 1 to 32 (a). HEK293T cells were transfected with pA3M (empty vector), wild-type LANA1–32-GFP-Myc, and point mutants LANA5–7-GFP-Myc, LANA8–10-GFP-Myc, LANA11–13-GFP-Myc, LANA14–15-GFP-Myc, and LANA5–15-GFP-Myc (b). Cellular lysates were subjected to immunoprecipitation with anti-Myc antibody to detect coimmunoprecipitated endogenous MCM3. (D and E) MCM3 and MCM4 bind to LANA independent of MCM6. BCBL-1 cells transduced with Tet-inducible shMCM6 were treated with doxycycline for MCM6 depletion (shMCM6-KD) or untreated (shMCM6-C) before being subjected to immunoprecipitation with MCM3 and MCM4, as indicated (D). The lysates were treated with DNase before immunoprecipitation and detection of coprecipitated LANA. BC3 cells transduced with Tet-inducible shMCM6 were treated with doxycycline for MCM6 depletion (shMCM6-kD) or untreated (shMCM6-C) before being subjected to immunoprecipitation with MCM3 and MCM4, as indicated (E). The lysates were treated with DNase before immunoprecipitation and detection of coprecipitated LANA. Isogenic antibody (IgG) was used as a control.

In order to further map the region of LANA responsible for binding to MCMs, we performed coimmunoprecipitation assays with truncations of the amino terminus of LANA, including aa 1 to 32, 1 to 150, 1 to 250, 1 to 340, and 33 to 150. Immunoprecipitation with anti-Myc antibody and subsequent detection of MCMs identified the region of amino acids 1 to 32 of LANA (LANA1–32) as the minimal domain required for MCM3 and MCM6 while MCM4 mapped to LANA1–150 and, more specifically, to the LANA33–150 region (Fig. 3B).

Since LANA1–32 is also the chromatin binding domain, we wanted to identify the amino acid residues of this region responsible for its interaction with MCMs. A schematic of the LANA1–32 region with alanine mutations between aa 5 and 15 is depicted in Fig. 3C (subpanel a). Transfection of these expression vectors into HEK293T cells, followed by immunoprecipitation with anti-Myc antibody to precipitate LANA1–32, showed amino acids 14 and 15 (T and G) to be critical for LANA’s association with MCM3 (Fig. 3C, subpanel b).

Since MCMs are recruited as a hexameric complex at the origin of DNA replication, the components of the MCMs (MCM2–7) associate to form the complex. Therefore, we wanted to determine whether one MCM associated with LANA and the other binding MCMs precipitated by virtue of their self-association. To address that, we depleted one LANA-associating MCM (MCM6) and detected the association of LANA with other two LANA binding MCMs (MCM3 and MCM4). Immunoprecipitation of MCM3 from the MCM6-depleted and control cells coprecipitated almost similar levels of LANA from both BCBL-1 and BC3 cells (Fig. 3D and E, subpanels a). Similarly, MCM4 coprecipitated LANA from the MCM6-depleted and control BCBL-1 and BC3 cells, suggesting a direct association of these proteins with LANA (Fig. 3D and E, subpanels b).

A 50-aa region in C-terminal LANA is important for MCM binding and latent DNA replication.

Since MCM6 interacted with the C-terminal domain of LANA, we wanted to identify specific amino acid residues of the C-terminal domain responsible for interaction with MCM6. We performed MCM6 coimmunoprecipitation assays with existing C-terminal point mutants of LANA to identify whether any of these specific amino acid residues were important for binding. Immunoprecipitation of LANA-C mutants and subsequent detection of MCM6 with anti-Myc antibody showed reduced levels of coprecipitating MCM6 with a few mutants (Fig. 4A). Most of these critical residues lie in the LANA1100–1150 region (Fig. 4A). Since MCMs are important for replication, we asked whether a LANA mutant with reduced MCM binding would have any effect on DNA replication. We addressed this by performing a transient replication assay with some of the C-terminal mutants of LANA having reduced MCM6 binding. Replication efficiencies were assayed by determining the DpnI-resistant (replicated) copies of the TR plasmid, which showed a significant reduction with many mutants and almost complete abrogation with a K1109/1113/1114A mutant of LANA (Fig. 4B; DpnI-resistant band intensities are presented as a bar graph). The point mutant M1117A, however, showed reduced MCM6 binding but only slightly reduced replication, which suggested that additional factors contribute to MCM association with LANA (Fig. 4). Since the amino acids at K1109/1113/1114 were important for MCM6 binding and replication, we generated a small clone of LANA1100–1150 encompassing these residues to determine whether this can compete MCM6 binding with LANA. To this end, we performed a coimmunoprecipitation assay of MCM6 with LANA in the presence of LANA1100–1150, which showed a significantly reduced level of coprecipitating MCM6 (Fig. 4C). Since the levels of MCM6 were similar in cells with and without LANA1100–1150 expression, we concluded that amino acids 1100 to 1150 can compete their binding (Fig. 4C). Next, we wanted to determine whether disruption of MCM6 binding with LANA with this competing domain can have an effect on replication. To assay that, HEK293L cells were transfected with LANA- and TR-containing plasmids in the presence or absence of LANA1100–1150-expressing vector. Cells were harvested at 96 h posttransfection for the extraction of DNA and digested with EcoRI to linearize the DNA and with EcoRI and DpnI to determine the replicated DNA copy numbers. The DpnI-resistant band (marked by an arrow) showed a complete abrogation in the replication of TR plasmids in cells expressing LANA1100–1150 compared to that in the cells with similar amounts of empty vector (Fig. 4D, compare lane 4 with lane 3). The levels of transfected TR plasmids were similar in both samples (Fig. 4D, input lanes 1 and 2). Cells transfected with LANA1100–1150 showed a cross-hybridizing signal to the vector backbone of LANA1100–1150 but did not affect the TR plasmid signal (Fig. 4D, lane 2).

FIG 4.

FIG 4

LANA aa 1100 to 1150 are essential for association with MCM6. (A) HEK293T cells were transfected with the indicated Flag-tagged LANA C-terminal point mutants and Myc-tagged MCM6. At 36 h posttransfection, cellular lysates were subjected to immunoprecipitation with anti-Flag antibody to detect coimmunoprecipitated MCM6 following detection with anti-Myc antibody. (B) HEK293L cells were transfected with plasmids expressing full-length LANA and LANA C-terminal point mutants in the presence of TR plasmid. Cells were harvested at 96 h posttransfection; DNA was extracted using Hirt’s procedure and digested with either EcoRI or EcoRI and DpnI. The DNA was subjected to Southern blotting and detection using TR probe. Densitometric quantification of DpnI-resistant test bands compared to that of respective inputs is shown. (C) HEK293T cells were transfected with MCM6-Myc and full-length LANA in the presence and absence of LANA1100–1150. Cellular lysates were subjected to immunoprecipitation with anti-Flag antibody to detect coimmunoprecipitated MCM6 following detection with anti-Myc antibody. (D) HEK293L cells were transfected with plasmids expressing full-length LANA and full-length LANA with LANA1100–1150 in the presence of TR plasmid. Cells were harvested at 96 h posttransfection; DNA was extracted using Hirt’s procedure and digested with either EcoRI or EcoRI and DpnI. The DNA was subjected to Southern blotting and detection using TR probe. The arrow indicates the p8TR band.

We further wanted to determine whether the peptide encompassing these critical residues of LANA-C would have an impact on disrupting LANA’s association with MCM6. To this end, we synthesized a 20-amino acid peptide (KRPRSPSSVYCQNKDTSKKVQMARLAWE) within the LANA1104–1123 region of that encompassed amino acid residues 1109/1113/1114, which were important for MCM6 binding and DNA replication. A same-sized (20-aa) scrambled (sc) peptide (KRPRSPSSQQEPQQQEPQQQEPQQQEPQ) was used as a control. We introduced a nuclear localization signal (NLS) sequence (underlined) in these peptides for efficient translocation into the nucleus. Immunoprecipitation of LANA with anti-Flag antibody showed reduced coprecipitation of MCM6 in the presence of the specific LANA peptide compared to almost similar amounts in the absence of any peptide or in the presence of scrambled peptide (Fig. 5A). Relative amounts of coprecipitating MCM6 were determined based on the amounts precipitated in lanes without any peptide after values were normalized to their respective inputs (Fig. 5A).

FIG 5.

FIG 5

Introduction of LANA-specific peptide, aa 1104 to 1123, reduced LANA-MCM6 binding and TR-mediated replication. (A) HEK293T cells were transfected with Flag-tagged full-length LANA and Myc-tagged full-length MCM6. The cells were lysed at 36 h posttransfection, and the lysates were incubated in the absence and presence of LANA specific (sp) and scrambled (sc) peptides. The immunoprecipitation was performed with anti-Flag antibody, followed by detection of MCM6 with anti-Myc antibody. Relative densities of the coprecipitating MCM6 are shown below the respective bands. (B) HEK293L cells were transfected with plasmids expressing full-length LANA and TR plasmids with and without LANA specific (sp) and scrambled (sc) peptides. Cells were harvested at 96 h posttransfection; DNA was extracted using Hirt’s procedure and digested with either EcoRI (to linearize) or with EcoRI and DpnI. The DNA was subjected to Southern blotting and detection using TR probe. The arrow indicates the TR plasmid band. Relative densities of the replicated bands (indicated by arrow) normalized to the value of the Dpn1-resistant band from cells transfected with no peptide are shown below their respective lanes.

We further wanted to determine whether the disruption of MCM6 association with LANA through this peptide would translate into reduced levels of TR replication. To this end, we performed a transient replication assay by transfecting LANA and TR plasmids in HEK293L cells in the absence and presence of the specific and scrambled peptides. Transfected cells were harvested at 96 h posttransfection to extract DNA, followed by digestion with EcoRI to linearize the DNA or with DpnI and EcoRI to determine the replicated copy numbers after Southern hybridization. Quantification of DpnI-resistant bands showed significantly reduced levels of replicated TR plasmid in cells transfected with LANA-specific peptide compared to levels in cells transfected with no peptide or cells with scrambled peptide (Fig. 5B). The relative quantities of the replicated DNA were calculated in reference to the DpnI-resistant band from cells with no peptides after values were normalized to the respective inputs (Fig. 5B).

Recombinant KSHV with deletion of LANA1100–1150 showed reduced replication.

Our experiments so far confirmed the importance of the MCMs-LANA association to KSHV latent DNA replication. In addition, amino acid residues of the C terminus of LANA were important for MCM6 recruitment and DNA replication. To verify whether these C-terminal residues of LANA have an effect on KSHV genome replication/maintenance, we generated a recombinant KSHV with a deletion of aa 1100 to 1150 of LANA (BAC16Δ1100–1150) through homologous recombination-based two-step BAC recombineering (Fig. 6A). The bacmids (BAC16wt and BAC16Δ1100–1150) were transfected into HEK293L cells and selected with hygromycin. Transfections of both BAC16wt and BAC16Δ1100–1150 were similar, as monitored by green fluorescent protein (GFP) signals, at 24 h posttransfection, but BAC16Δ1100–1150 displayed a higher rate of GFP signal decrease than the cells transfected with BAC16wt. We further determined the copy numbers of viral genome retained following hygromycin selection for 6 days. Episomal DNA extracted using Hirt’s procedure from these cells showed significantly lower KSHV copy numbers in BAC16Δ1100–1150 cells than in BAC16wt cells (Fig. 6B and C). The reduction in episomal copies in BAC16Δ1100–1150 cells prompted us to evaluate whether the reduction was due to a defect in DNA replication observed in transient replication assays. To achieve this, we labeled the BAC16wt and BAC16Δ1100–1150 cells (day 6 samples post-hygromycin selection) with iododeoxyuridine (IdU) to label the replicating DNA, which was extracted through Hirt’s procedure for immunoprecipitation with anti-IdU antibody. The replicated DNA captured on antibody-protein A/G beads was eluted for quantification using quantitative PCR (qPCR) with primers to amplify the terminal repeat region. As expected, we observed significantly smaller amounts of newly replicated DNA in BAC16Δ1100–1150 cells than in BAC16wt cells (Fig. 6D).

FIG 6.

FIG 6

Recombinant BAC16Δ1100–1150 displays reduced latent DNA replication. (A) A schematic illustrates BAC16Δ1100–1150 generation via homologous recombination (a). Nucleotides 1100 to 1150 of LANA/ORF73 were deleted by two-step BAC recombineering and Kanr/I-SceI counterselection. The presence of the Kanr/I-SceI cassette was confirmed by NdeI digestion and Southern hybridization with a LANA-specific probe (b). Shown at left is an ethidium bromide gel of NdeI-digested BAC16wt and intermediates with or without the Kanr/I-SceI cassette, as indicated. Southern blotting with LANA-specific probe displayed the expected 5,811-bp band in the intermediate (+kan). (B and C) KSHV latent genomic copies were quantified by extracting genomic DNA from uninduced BAC16wt and BAC16Δ1100–1150 cells at day 3 and day 6, as indicated, using Hirt’s extraction procedure. The relative copy numbers were calculated by amplifying viral genome with TR-specific primers using the ΔΔCT (where CT is threshold cycle) method after values were normalized to those of GAPDH. The relative genome copy numbers were significantly reduced for BACΔ1100–1150 cells compared to levels in BAC16wt cells. All experiments were performed three times in replicates, and the error bars represent standard deviations of the means from three independent experiments. (D) IdU-labeled viral DNA was immunoprecipitated with anti-IdU antibody from the BAC16wt and BAC16Δ1100–1150 cells. The relative copies were calculated by amplifying viral genome with TR-specific primers and using the ΔΔCT method after normalization to the respective inputs. BAC16Δ1100–1150 cells showed significantly smaller amounts of newly replicated DNA compared to levels in BAC16wt cells. These experiments were performed three times in replicates, and the error bars represent standard deviations of the means from three independent experiments. Statistical analysis was performed with Prism, version 7.0, software (GraphPad, Inc.) using an unpaired t test for the significance (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

MCMs are required for LANA-dependent latent DNA replication.

Lower MCM6 binding to LANA C-terminal mutants and subsequent reduction in replication could also be due to reduced binding of other cellular factors within that region. To confirm the absolute role of MCMs in KSHV DNA replication, we depleted the levels of MCM components (MCM3 or -6) in HEK293L cells and assayed DNA replication using a TR-containing plasmid. We transduced HEK293L cells with doxycycline-inducible short hairpin RNA (shRNA) to deplete MCM3 or MCM6 (shMCM3 knockdown [shMCM3-KD] or shMCM6-KD cells). Stably transduced cells were assayed for the depletion of MCMs after doxycycline treatment and showed a significant reduction (shMCM3-KD or shMCM6-KD) in MCM levels compared to levels in the untreated cells (control shMCM3 [shMCM3-C] or shMCM6-C cells) (Fig. 7A and B, subpanels a). A transient replication assay was performed by transfecting these cells with LANA- and TR-containing plasmids. Transfected cells were harvested at 96 h posttransfection to extract DNA, followed by digestion with EcoRI to linearize DNA or with DpnI and EcoRI to determine the number of replicated copies after Southern hybridization. Since LANA is crucial for TR DNA replication, cells without LANA expression did not show any replicated/DpnI-resistant band (Fig. 7A and B, subpanels b, lanes 7, 9, and 11). HEK293L cells expressing LANA showed replicated TR copies (Fig. 7A and B, subpanels b, lanes 8, asterisks), as expected. Cells transduced with shMCM3 or MCM6 lentivirus and treated with doxycycline (shMCM3-KD or shMCM6-KD) showed no replicated TR plasmid in contrast to the doxycycline-untreated (shMCM3-C or shMCM6-C) cells (Fig. 7A and B, subpanels b, compare lanes 12 with lanes 10). Lanes 1 to 6 represent the amounts of TR plasmid DNA extracted from respective cells (Fig. 7A and B, subpanels b). This confirmed that MCMs (both MCM3 and MCM6) are critical for LANA-mediated replication of TR plasmids.

FIG 7.

FIG 7

MCMs are required for KSHV latent DNA replication. (A) An immunoblot shows the efficiency of lentivirus-based knockdown of MCM3 in lysates from HEK293L cells, shMCM3 transduced HEK293L control cells (293L shMCM3-C), and doxycycline-treated shMCM3 transduced HEK293L (293L shMCM3-KD) (a). HEK293L, HEK293L shMCM3 control, and MCM3-depleted cells were transfected with plasmids expressing full-length LANA in the presence of TR plasmid (b). Cells were harvested at 96 h posttransfection; DNA was extracted using Hirt’s procedure and digested with either EcoRI (to linearize) or EcoRI and DpnI. The DNA was subjected to Southern blotting and detected using TR probe. (B) An immunoblot shows the efficiency of lentivirus-based knockdown of MCM6 from HEK293L cells, shMCM6 transduced HEK293L control cells (293L shMCM6-C), and shMCM6-depleted 293L cells (293L shMCM6-KD) (a) HEK293L control cells and HEK293L shMCM6 control and MCM6-depleted cells were transfected with plasmids expressing full-length LANA in the presence of TR plasmid (b). Cells were harvested at 96 h posttransfection; DNA was extracted using Hirt’s procedure and digested with either EcoRI or EcoRI and DpnI. The DNA was subjected to Southern blotting and detected using TR probe.

LANA recruits MCMs at the terminal repeat region.

We determined that MCMs were critical for latent DNA replication, and these were previously shown to be part of the viral chromatin (23, 24); therefore, we asked whether MCMs are recruited through a viral factor, LANA, or loaded onto the viral chromatin independent of LANA. To address this, we depleted LANA from KSHV-infected BCBL-1 and BC3 cells by stably transducing an shLANA lentiviral vector (45). The efficiency of LANA depletion was determined by comparing the levels of LANA with those of the control shRNA transduced cells, which showed a significant reduction in shLANA transduced cells (Fig. 8A and B). We determined the levels of MCMs (MCM3, -4, and -6) bound to the chromatin of the KSHV genome (TR region chromatin) through chromatin immunoprecipitation and compared the levels with those of the control cells. We found that all of the tested MCMs (MCM3, -4, and -6) had significantly reduced binding to the chromatin of the TR region in both BCBL-1 (Fig. 8A) and BC3 (Fig. 8B) LANA-depleted (shLANA) cells compared to levels in the control (shControl) cells. This confirmed that MCMs are recruited to the viral genome through LANA.

FIG 8.

FIG 8

LANA recruits MCMs at the TR region during latent DNA replication. (A) Immunoblot showing the efficiency of LANA depletion in the lysates from LANA knockdown and control BCBL-1 cells. (B) Immunoblot showing efficiency of LANA depletion in the lysates from LANA knockdown and control BC3 cells. A chromatin immunoprecipitation assay was performed from the BCBL-1 and BC3, control, and LANA-depleted cells using antibodies specific for MCM3, -4, and -6. The relative copy numbers of chromatin-bound DNA were calculated by amplifying viral genome with TR-specific primers and using the ΔΔCT (where CT is threshold cycle) method after normalization to the respective inputs. All the experiments were performed three times in replicates, and the error bars represent standard deviations of the means from three independent experiments. Statistical analysis was performed with Prism, version 7.0, software (GraphPad, Inc.) using an unpaired t test for the significance (*, P < 0.05; **, P < 0.01; ****, P< 0.0001).

MCM depletion led to a reduction in KSHV genome replication and persistence.

Since MCMs were found to be essential for the replication of TR-containing plasmids in transient replication assays, we wanted to determine whether depletion of MCMs in KSHV-infected cells affects viral genome replication and persistence. To this end, we transduced BCBL-1 and BC3 cells with doxycycline-inducible shMCM3 or shMCM6 lentiviral vectors. These cells were treated with puromycin to select a pure population of transduced cells, which were further treated with doxycycline to determine the levels of MCM depletion. Detection of MCM3 and MCM6 showed an efficient depletion in doxycycline-treated (MCM3/MCM6-KD) cells compared to levels in the untreated (control) cells (Fig. 9A and B). These cells were used for assaying DNA replication by pulsing them with IdU, a thymidine analog. IdU gets incorporated into the replicating DNA; therefore, a pulse-labeling with IdU followed by immunoprecipitation with anti-IdU antibodies determined the amounts of actively replicated DNA. Detection of IdU-labeled DNA by PCR amplification of a specific region of the KSHV genome, the TR region in this case (TR initiates replication), showed a lower level of IdU-labeled DNA in MCM (MCM3 or MCM6)-depleted BCBL-1 (Fig. 9C) and BC3 (Fig. 9D) cells compared to levels in the control cells. This confirmed that MCMs play a critical role in KSHV genome replication during latency.

FIG 9.

FIG 9

MCMs are essential for latent viral DNA replication. (A) Immunoblot showing depletion of MCM3 in MCM3-depleted BC3, BCBL-1, and control cells. (B) Immunoblot showing depletion of MCM6 in MCM6-depleted BC3, BCBL-1, and control cells. (C) IdU-labeled viral DNA was immunoprecipitated with anti-IdU antibody from the control and MCM-depleted BCBL-1 cells. (D) IdU-labeled viral DNA was immunoprecipitated with anti-IdU antibody from the control and MCM-depleted BC3 cells. IdU-labeled DNA was quantified using TR-specific primers. The relative copy numbers were calculated using the ΔΔCT (where CT is threshold cycle) method after normalization to the respective inputs. All the experiments were performed three times in replicates, and the error bars represent standard deviations of the means from three independent experiments. Statistical analysis was performed with Prism, version 7.0, software (GraphPad, Inc.) using an unpaired t test for the significance (*, P < 0.05; **, P < 0.01). (E) Gardella gel analysis was performed on 1 million BCBL-1 and BC3 control or MCM3-depleted cells. (F) Gardella gel analysis was performed on 1 million BCBL-1 and BC3 control or MCM6-depleted cells. Cells were harvested to prepare plugs, which were lysed in the lysis buffer for 48 h. The plugs were loaded on 0.8% Gardella gels. Ethidium bromide-stained images are shown on the left side of the respective TR probe hybridized Southern blot image.

In order to determine the effects of MCMs on KSHV genome persistence, these lentivirally transduced cells were treated with doxycycline for 2 weeks, followed by assaying the levels of the KSHV genome through Gardella gel analysis, which determines the native form of episomally persisting viral genome. Not surprisingly, we observed significantly reduced KSHV episomes (reduced signal intensities) in both MCM3-depleted (Fig. 9E) and MCM6-depleted (Fig. 9F, KD lanes) BCBL-1 and BC3 cells compared to levels in the same number of control (C lanes) cells. This confirmed that depleted levels of MCMs reduced KSHV genome replication, which ultimately resulted in lower copy numbers of latently persisting KSHV genomes.

LANA and MCMs are on the nascent DNA at the replication fork.

DNA replication is a fundamental process for biological inheritance, which requires the functional and physical interaction of many proteins on replicating DNA (36). During latency, the KSHV genome maintains itself in the host by replicating and efficiently segregating its genome to the daughter cells (21, 46, 47). Since KSHV lacks its own set of replication proteins, it relies on the cellular proteins for these essential functions. We found LANA to be present at the replicating DNA using a recently developed technique, isolation of proteins on nascent DNA (iPOND), which enables the identification of proteins assembled at the replication fork (48). We used a modified version of this approach, two-step iPOND, to determine proteins on replicating viral DNA (49). This technique employs the use of 5-ethynyl-2′-deoxyuridine (EdU), a thymidine analog, to label the replicating DNA (Fig. 10A). Following a brief pulse with EdU label, cells were cross-linked to preserve the protein-DNA composition. EdU (with an alkyne functional group)-labeled DNA was subjected to a click reaction with biotin-azide after the isolation of nuclei. DNA was fragmented, and the protein-DNA complex was subjected to an enrichment of viral DNA by an immunoprecipitation with anti-LANA antibody since LANA binds to the KSHV genome (13). LANA-DNA complex was eluted from Sepharose beads by competing it off with LANA peptide (the same peptide used for generating the antibody). Eluted complex was then subjected to streptavidin pulldown to precipitate the EdU-labeled (replicated) and biotin-clicked DNA. Proteins associated with replicated DNA were determined by immunoblotting. Immunoprecipitation of LANA-enriched viral genome and biotin pulldown isolated the replicated DNA, thus allowing the identification of proteins present on the viral replication fork. We labeled the KSHV-positive BCBL-1 and BrK.219 cells with EdU for 30 min, followed by cross-linking and permeabilization for clicking with biotin-azide or dimethyl sulfoxide (DMSO), a control. Immunoprecipitation with anti-LANA antibody followed by elution showed efficient precipitation of LANA, as expected, and a LANA binding protein, PCNA (Fig. 10B, eluted lanes). Further precipitation of replicated DNA (biotin labeled) with streptavidin from the eluate showed LANA and PCNA, which are part of the replication complex (Fig. 10B, streptavidin pulldown lanes). Detection of MCM6, a representative component of the MCM complex, confirmed MCMs to be a part of the replicating DNA. Samples clicked with DMSO did not show any detectable levels of these proteins, confirming the specificity of streptavidin pulldown of replicated/biotinylated DNA (Fig. 10B, streptavidin pulldown lanes).

FIG 10.

FIG 10

LANA and MCMs are part of the replication complex. (A) Schematic of two-step iPOND performed on KSHV-positive cells. Approximately 100 million KSHV-positive cells were labeled with 5-ethynyl-2′deoxyuridine (EdU) for 30 min, harvested, and washed with 1× PBS (1). Protein and DNA were cross-linked using 1% formaldehyde for 20 min and quenched using 125 mM glycine (2). The cells were permeabilized with 0.25% Triton X-100 in PBS for 30 min at room temperature (3), and nuclei were isolated following centrifugation (4). Click chemistry was performed on the nuclei to conjugate biotin-azide to EdU, and DMSO was used as a negative control (5). The chromatin was sheared using sonication to generate fragments of 100 to 300 bp (6). Protein-DNA complex bound to LANA was captured using monoclonal LANA antibody (7). Protein A/G beads were used to capture antigen-antibody complexes, which were eluted from the beads using peptide specific for LANA (8). Streptavidin beads were used to capture EdU-labeled (replicated) DNA-protein complexes (9). Proteins bound to streptavidin beads were eluted by boiling the beads at 95°C and detected using specific antibodies (10). (B) Immunoblot of LANA, MCM6, and PCNA obtained through two-step iPOND using respective antibodies from KSHV-positive BCBL-1 and BrK.219 cells. A total of 100 million cells were labeled with EdU and permeabilized, and a click reaction was performed using biotin-azide and DMSO. The cells were lysed and sonicated, and proteins were pulled down using LANA antibody. The proteins associated with DNA were pulled down using streptavidin beads and eluted by boiling in the loading buffer.

DISCUSSION

KSHV, the etiological agent of Kaposi’s sarcoma, primary effusion lymphoma, and multicentric Castleman’s disease, establishes life-long latency in the host and expresses a limited subset of genes during latency (1, 2, 5). LANA is the most predominantly expressed protein during latency and is essential for maintenance and persistence of the virus inside the host cells (5052). LANA plays an important role in persistence by tethering the viral genome to the host chromosome through simultaneous interaction with the terminal repeat region of the viral genome and the host chromatin (11, 13). In addition, LANA is also essential for the duplication of viral genome as it is involved in the recruitment of cellular replication factors at the latent origin of viral genome replication (23, 24).

MCMs were identified as potential LANA binding partners in our previous study (27). Additionally, MCMs were shown to be a part of the viral chromatin during latent replication, and small interfering RNA (siRNA) depletion of MCM5 reduced the replication of a plasmid containing two copies of the TR region (2×TR) (23). In addition, MCM3 along with ORC2 was found to accumulate at multiple sites on the viral genome as part of the pre-RC complex (25). However, the mechanism of MCMs recruitment to the viral genome was not known. In this study, we determined that LANA specifically binds to MCMs and recruits them to the latent origin of the terminal repeat region. MCM complex, a hexameric component comprising MCM2 to MCM7, binds to the replication origin in a stepwise manner and unwinds the DNA to initiate replication (5355). We identified three components of the MCM complex, MCM3, MCM4, and MCM6, directly binding to LANA in various biochemical assays. Further, we wanted to know whether MCMs associated with LANA throughout the cell cycle as LANA remains bound to the chromatin during both G1/S and mitotic phases of the cell cycle, but MCMs are loaded only during the replicative phase of the cell cycle (12, 53). Not surprisingly, MCMs associated with LANA only during the G1/S (replicative) phase of the cell cycle, which indicated that either LANA stabilizes the loading of MCMs to the origin or differential posttranslational modifications of LANA help in the recruitment of MCMs only during the G1/S phase. Our attempts to determine differential posttranslational modifications of LANA during the G1/S and mitotic phases have not been successful yet, but mutation at the threonine at amino acid position 14 to alanine in LANA disrupted the binding of MCM3, which bound to the minimal LANA1–32 region. This may suggest that specific amino acid residues and posttranslational modifications, including phosphorylation, may contribute to its binding to replication proteins.

Interestingly, one component of the MCM complex, MCM6, bound to both the amino- and carboxyl-terminal domains of LANA, which could be due to the fact that the two termini of LANA (amino and carboxyl) can associate together (56). This association possibly helps in bringing the viral genome bound to the carboxyl terminus of LANA to the host chromosome at the site of the amino terminal-bound LANA for efficient replication. Previous studies have shown that the association of viral genome to the host chromosome is required as LANA mutants defective in chromosome binding (LANA5–15 alanine substitution mutants) do not support efficient DNA replication (57). Importantly, the binding of MCM6 in the carboxyl terminus of LANA was also important as expression of a small region of LANA spanning the MCM6 binding residues (aa 1100 to 1150) disrupted its association with LANA. Additionally, overexpression of this MCM6-interacting domain in a replication assay disrupted replication of a TR-containing plasmid. To further investigate the relevance of this region in LANA-MCM6 binding and TR-mediated replication, we used a custom peptide of the LANA-C region, aa 1104 to 1123, in our assays. As expected, overexpression of a LANA-specific peptide reduced MCM6 binding to LANA and significantly reduced TR-mediated replication compared to levels with the control peptide. Furthermore, our recombinant KSHV-infected cell line with a deletion of 50 aa in the C-terminal domain of LANA (aa 1100 to 1150) showed a rapid loss of viral episomes compared to the cells with wild-type LANA. The rapid loss of viral genome from cells containing recombinant KSHV with a deletion of aa 1100 to 1150 in the C-terminal domain was attributed to significantly reduced replication of the viral genome. These studies suggested that targeting the C-terminal domain of LANA could provide a potential target for blocking KSHV latent DNA replication. A recent study also identified aa 1138 to 1140 of LANA as the key residues essential for its interaction with BRD proteins, which play an important role in viral genome persistence and viral DNA replication (58). Since the main residues for MCM6 binding (aa 1104 to 1123) are adjacent to the BRD-interacting residues (aa 1138 to 1140), it can be postulated that targeting LANA1100–1150 could disrupt the binding of multiple proteins and, thus, significantly reduce the persistence of viral genome in the latently infected cells.

The functional relevance of MCMs, which act as replicative helicases, on KSHV replication was also tested in transient replication assays as well as in genome persistence after depletion of MCMs from e KSHV-infected cells. Since MCMs are important helicases required for unwinding the DNA during replication, their functions were not compensated by other cellular proteins, as MCM-depleted cells showed reduced replication of TR plasmid. MCM depletion from the KSHV-infected BC3 and BCBL-1 cells also reduced the number of persisting copies of the viral genome, possibly due to reduced replication over successive rounds of cell division, which were detected by the incorporation of thymidine analog in replicating cells.

Although the association of MCM5 was shown at viral chromatin, the mechanism of its recruitment was not known. Our chromatin immunoprecipitation assay from KSHV-infected cells with depleted levels of LANA, which directly binds to MCMs, showed significantly reduced levels of MCMs at the chromatin of the TR region. This confirmed that MCMs are recruited at the TR through their binding with LANA. The involvement of MCMs in replicating the viral genome was confirmed by detecting MCMs on the replicated viral DNA using a new approach, isolation of proteins on nascent DNA (iPOND). Since iPOND detects the proteins on any replicating DNA, we modified the approach to determine proteins on virally replicated DNA. We introduced an additional step to immunoprecipitate LANA, which specifically binds to the KSHV genome, to preferentially enrich the LANA-bound viral DNA. The replicated DNA, which was subjected to a click reaction with biotin, was isolated by selective precipitation with streptavidin, and the proteins bound to these replicated DNAs were assayed. Importantly, we detected MCMs at the replicating DNA along with already known proteins, which are the components of cellular replication machinery. This confirmed that MCMs are involved in replicating latent viral genome and that LANA directly binds to MCM3, MCM4, and MCM6 to recruit them to the replication origin on the viral genome.

MATERIALS AND METHODS

Cell culture.

The KSHV-negative, Burkitt lymphoma cell line, BJAB and KSHV-positive PEL cell lines BCBL-1 and BC3 were cultured in RPMI 1640 medium supplemented with 10% bovine growth serum, 2 mM l-glutamine, and penicillin-streptomycin (5 U/ml and 5 μg/ml, respectively). The BrK.219 line (generated by infecting BJAB cells with rKSHV.219) was obtained from Thomas Schulz (Hannover Medical School, Germany) and cultured in RPMI 1640 medium in the presence of 4.2 μg/ml puromycin (59). The human embryonic kidney cell lines HEK293T and HEK293L were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% bovine growth serum, 2 mM l-glutamine, and penicillin-streptomycin (5 U/ml and 5 μg/ml, respectively). All cell lines were grown at 37°C in a humidified environment with 5% CO2.

Antibodies and peptides.

The following commercial antibodies were used for this study: rat anti-LANA (Advanced Biotechnologies, Inc.); mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (US Biological); mouse anti-Flag M2 (Sigma-Aldrich, St. Louis, MO, USA); mouse anti-Myc 9E10 (Sigma-Aldrich, St. Louis, MO, USA); rabbit polyclonal anti-MCM2, -MCM5, -MCM10, and -PCNA (Santa Cruz Biotechnology); mouse monoclonal anti-MCM3, -MCM4, and -MCM7 (Santa Cruz Biotechnology). Mouse monoclonal anti-LANA hybridoma was generated at GenScript using the peptide sequence CEPQQREPQQREPQQ. This peptide was also used for eluting LANA in the iPOND assay.

A specific peptide, KRPRSPSSVYCQNKDTSKKVQMARLAWE (sp pep), from the C-terminal MCM6 binding residues (aa 1104 to 1123) and a scrambled peptide, KRPRSPSSQQEPQQQEPQQQEPQQQEPQ (sc pep), were synthesized at GenScript. Nuclear localization signal sequences (underlined) were added for efficient translocation of these peptides into the nucleus.

Plasmids.

MCM4 and LANA1100–1150 were generated by PCR amplification and cloning into a Flag-tagged vector, pA3F, and a Myc-tagged vector, enhanced GFP (EGFP)-Myc, respectively. Integrity of the clones was confirmed by sequencing at the Nevada Genomics Center, University of Nevada, Reno, NV. MCM3 and MCM6 constructs were obtained from Alan Diehl (Medical University of South Carolina) and John Schimenti (Cornell University), respectively. Carboxyl-terminal point mutants of LANA were obtained from Paul Liebermann (Wistar Institute, Philadelphia, PA). Flag-tagged LANA, pA3F-LANA, LANA deletion constructs LANA-N (aa 1 to 340) and LANA-C (aa 940 to 1162), Myc-tagged LANA, pA3M-LANA, GFP-NLS-Myc, GFP–LANA-N–Myc (aa 1 to 340), the truncation mutants GFP–LANA-N250–Myc (aa 1 to 250), GFP–LANA-N150–Myc (aa 1 to 150), GFP–LANA-N32–Myc (aa 1 to 32), and GFP–LANA-N33–150–Myc (aa 33 to 150), and alanine substitution mutants of LANA1–32 were described earlier (60). The shRNA vectors for MCM3 and MCM6 were purchased from Dharmacon (GE Life Science).

MCM knockdown using lentiviral vectors.

The pTRIPZ lentiviral vector (Dharmacon, GE Life Sciences) containing shRNA for MCM3 and MCM6 were cotransfected with lentivirus packaging vectors pCMV-dR8.2 and pCMV-VSVG (Addgene, Inc.) into HEK293T cells using polyethylenimine (PEI) (Polysciences, Inc.) to produce the respective lentiviral particles. Supernatants from the transfected HEK293T cells were collected for 5 days, followed by concentration of the virus by ultracentrifugation (25,000 rpm, 1.5 h, 4°C). The concentrated lentiviral particles were used for transducing the target cells (BCBL-1, BC3, and HEK293L) in the presence of 5 μg/ml Polybrene, followed by selection with 1 μg/ml puromycin. The cells were treated with 1 μg/ml doxycycline for at least 72 h for the induction of knockdown. The RNA interference (RNAi) efficiency was assessed by Western blot analysis with specific MCM3 and MCM6 antibodies.

Coimmunoprecipitation assays.

To perform coimmunoprecipitation, cells were washed with phosphate-buffered saline (PBS) and lysed in 750 μl of NP-40 cell lysis buffer (1% Nonidet P-40, 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 1 mM EDTA) supplemented with protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 μg/ml pepstatin, 10 μg/ml leupeptin, and 10 μg/ml aprotinin). Cellular lysates were sonicated with a probe sonicator and centrifuged at 12,000 rpm for 10 min at 4°C to remove cellular debris. The lysate was further treated with 100 U of DNase to eliminate any cross-linking DNA. The supernatants were precleared with protein A/G Sepharose beads (GE Healthcare) for 30 min at 4°C. Approximately 5% of the lysate was saved as the input sample, and the remaining cellular lysate was rotated overnight with specific antibodies. The immunocomplexes were captured using 50 μl of protein A/G-conjugated Sepharose beads, which were incubated with the lysates for 2 h at 4°C. The bead-bound immunocomplexes were collected by centrifugation at 2,000 rpm for 5 min at 4°C, followed by three washes with 1 ml of ice-cold NP-40 buffer supplemented with protease inhibitors. The immunoprecipitation and input samples were boiled in 50 μl of SDS-PAGE sample loading buffer for 8 min, resolved on an SDS-polyacrylamide gel, and transferred onto 0.45-μm-pore-size nitrocellulose membranes (Bio-Rad laboratories) at 100 V for 80 min. The blots were blocked with 5% nonfat milk in Tris-buffered saline with Tween 20 (TBST) buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20) and incubated overnight at 4°C with specific primary antibodies. The proteins were detected following incubation with infrared dye-tagged secondary antibodies using an Odyssey infrared scanner (LiCor Biosciences, Lincoln, NE).

IFA.

An immunofluorescence assay (IFA) on KSHV-positive cells arrested in the G1/S phase was performed by growing the cells on poly-l-lysine-treated coverslips for 12 h, followed by incubation with mimosine for 120 min. The cells were air dried for 10 min, fixed with 4% paraformaldehyde for 15 min at room temperature, and permeabilized with 0.2% Triton X-100 in PBS for 10 min at room temperature. Cells were blocked with PBS containing 0.4% fish skin gelatin and 0.05% Triton X-100 for 30 min at room temperature. The cells were then incubated with specific primary antibodies overnight at 4°C and washed with PBS three times before being incubated with Alexa Fluor-conjugated secondary antibodies (Molecular Probes) for 45 min at room temperature. Nuclear staining was performed using TO-PRO-3 (Molecular Probes), and images were captured using a confocal laser scanning microscope (Carl Zeiss, Inc.).

An immunofluorescence assay on the KSHV-positive cells, arrested in the G2/M phase, was performed after cells were treated with colchicine. Cells were grown on coverslips coated with poly-l-lysine for 12 h, followed by incubation with colchicine for 120 min before fixation with formaldehyde. Staining and microscopy were performed as described above.

In vitro translation and GST pulldown assay.

In vitro translation of pA3F MCM4 was performed using a Promega TNT T7 quick-coupled transcription/translation system whereby 2 μg of the plasmid was translated in a 50-μl reaction mixture containing 1 mM [35S]methionine. To perform GST pulldown assays, GST control and LANA-N and LANA-C GST fusion proteins were expressed in Escherichia coli BL21 competent cells, and following induction with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG), the fusion proteins were extracted using glutathione-Sepharose beads. The in vitro-translated proteins were rotated overnight with control-GST, LANA-N–GST, and LANA-C–GST overnight in NETN binding buffer (0.1% NP-40, 20 mM Tris, 1 mM EDTA, and 100 mM NaCl) along with protease inhibitors. Following overnight incubation, the beads were washed with NETN buffer three times, and coprecipitated proteins were resolved using SDS-PAGE and detected using autoradiography.

Transient replication assay.

HEK293L cells in 100-mm dishes were cotransfected with 30 μg of TR-containing plasmid, p8TR, with 30 μg of pA3F LANA, or with an empty vector, pA3F, as filler DNA in 293L cells, 293L shMCM3/shMCM6 control (C) cells, and doxycycline-treated 293L shMCM3/shMCM6 knockdown (KD) cells. At 96 h posttransfection, cells were washed with phosphate-buffered saline followed by extraction of DNA using a modified Hirt’s lysis method, as described earlier (61). Extracted DNA was dissolved in 30 μl of sterile water. Ten percent of the extracted DNA was linearized with EcoRI and the remainder was digested with DpnI and EcoRI to remove the nonreplicated DNA. The digested DNA was separated on an 0.8% agarose gel followed by Southern transfer onto a Hybond N+ membrane (GE Healthcare) and hybridized with 32P-labeled TR probes. Probes specific to the KSHV terminal repeat region were synthesized using a random primer labeling kit, followed by purification on G-50 columns (GE Healthcare). The auto-radiographic signals were detected using a PhosphorImager, according to the manufacturer’s instructions (Molecular Dynamics, Inc.).

Peptide transfection, coimmunoprecipitation, and transient replication assay.

LANA-specific (sp pep) and LANA-scrambled (sc pep) peptides were transfected in the cells using Pierce protein transfection reagent according to the manufacturer’s protocol. For coimmunoprecipitation assays, pA3F plasmid expressing LANA and MCM6 were transfected into HEK293T cells using PEI, harvested at 24 h posttransfection, and lysed to set up immunoprecipitation in the presence of specific or scrambled peptides. Immunoprecipitation and detection were done as described above. Replication assays were performed by transfecting the specific and scrambled peptides into HEK293L cells using Pierce transfection reagent for 4 h before transfecting the plasmids, pA3F LANA and p8TR, for replication assays. The replication assay was done as described above following digestion with EcoRI and DpnI.

Generation of recombinant KSHV, BAC16Δ1100–1150.

G-blocks (IDT) were designed to have a linear DNA fragment containing a kanamycin resistance expression cassette and an IsceI restriction enzyme site, flanked by homologous sequences to the region of LANA targeted for removal. The G-block sequence is the following (boldface indicates the targeting sequence for the Kan cassette insertion, underlining indicates the sequence required for the second round of recombination and seamless removal of the Kan cassette, and the remaining sequence is the Kanr/I-SceI sequence): CCTGCTTGCCCCACCCTGGACCAGACCAGTCGCCCATAACTTATAACCAAGGTCCTGGGGACTCTCCGATTTATTCAACAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCATTACCCTGTTATCCCTAGATCGATGTACGGGCCAGATATACGCGAGACCAGTCGCCCATAACTTATAACCAAGGTCCTGGGGACTCTCCACAGGAAATGACATAAAAGCC. This G-block was then electroporated (0.1-cm cuvette, 1.8 kV, 200 Ω, 25 μF) into competent GS1783 E. coli cells harboring BAC16 and induced at 42°C for 15 mins. The Kanr/I-SceI-containing mutants were selected on chloramphenicol/kanamycin agar plates, and correct insertional mutants were confirmed by PCR, restriction enzyme digestion (NdeI digestion), and Southern blot analysis using a LANA-specific probe. In the second red-mediated recombination step, the integrated Kanr/I-SceI cassette was removed following treatment with 1% l-arabinose and consequent arabinose-mediated I-SceI enzyme induction. The resultant kanamycin-sensitive and chloramphenicol-resistant colonies were analyzed by restriction digestion, and the deletion in LANA was confirmed by sequencing. BAC DNA was purified using a NucleoBond Xtra BAC kit (Clontech) according to the manufacturer's instructions. BAC16wt DNA and BAC16Δ1100–1150 DNA were transfected into 293L cells with Metafectene Pro reagent (Biontex Laboratories GmbH, San Diego, CA) as described earlier (62). The cells containing bacmid were selected with hygromycin to obtain a pure population of cells. Both of the cell lines were monitored for the maintenance of the KSHV genome by genomic DNA extraction qPCR.

IdU labeling and immunoprecipitation of replicated DNA.

MCM3- and MCM4-depleted KSHV-positive BCBL-1 and BC3 cells were pulsed with 30 μM IdU (Sigma-Aldrich, St. Louis, MO, USA) for 30 min and washed twice with cold PBS. Episomal DNA was extracted by the modified Hirt’s method, dissolved in 500 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA), and sonicated to get an average length of 700 bp. The samples were heat denatured at 95°C for 5 min and incubated on ice, and 10% of the extracted DNA was saved to use as the input control. Fifty microliters of 10× IP buffer (100 mm NaPO4, pH 7.0, 1.4 M NaCl, and 0.5% Triton X-100) was added to the IP samples, which were then incubated with 1 μg of mouse anti-IdU antibody (BD Biosciences) at room temperature with constant rotation for 1 h. Antibody-bound IdU-labeled DNA was precipitated using magnetic protein A/G beads (GE Healthcare, Inc.) after incubation for 30 min. The beads were washed once with 1× IP buffer (10 mm NaPO4, pH 7.0, 140 mM NaCl, and 0.05% Triton X-100), resuspended in 200 μl of lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 0.5% SDS, 0.25 mg/ml proteinase K), and incubated overnight at 37°C for elution. This was followed by addition of 100 μl of lysis buffer and incubation at 50°C for 1 h. The eluted DNA was phenolized and precipitated for the quantitation of IdU-labeled DNA in a semiquantitative real-time PCR by amplifying the TR region.

Gardella gel electrophoresis.

Gardella gels were used for assessing the episome maintenance. KSHV-positive BCBL-1 and BC3 cells depleted of MCM3 and MCM6 were loaded onto the agarose gel with a lysis plug containing DNase-free proteinase K (Sigma-Aldrich, St. Louis, MO, USA) and SDS, followed by electrophoresis in a Tris-borate-EDTA buffer. The plugs were loaded on 0.8% Gardella gel and resolved at 108 V for 30 h. The gel was transferred onto a Hybond N+ membrane (GE Healthcare) and hybridized with 32P-labeled TR probes to detect KSHV episome.

ChIP.

Chromatin immunoprecipitation (ChIP) was performed as described previously (63). Approximately 4 million BC3 shControl and shLANA cells and BCBL-1 shControl and shLANA cells were fixed with 1% formaldehyde for 10 min at room temperature, followed by the addition of glycine at a final concentration of 125 mM for 5 min to stop cross-linking. The cells were rinsed three times with ice-cold PBS and lysed in chromatin-shearing buffer (Diagenode) supplemented with protease inhibitors for 10 min on ice. Chromatin was sonicated using a Bioruptor (Diagenode) to an average length of 500 to 800 bp, and the lysates were centrifuged for 10 min at 13,000 rpm to remove the cell debris. The resulting supernatant was diluted 4-fold with ChIP dilution buffer containing 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl, and 1.2 mM EDTA with protease inhibitors. The diluted chromatin was rotated, followed by incubation overnight with either control IgG or MCM3/MCM4 and MCM6 antibodies at 4°C. Immune complexes were collected by incubation with protein A/G Sepharose beads for 1 to 2 h at 4°C. The beads were collected and subsequently washed twice with low-salt buffer (0.1% SDS, 1.0% Triton X-100, 2 mM EDTA, 20 mM Tris [pH 8.1], 150 mM NaCl) and once with high-salt buffer (0.1% SDS, 1.0% Triton X-100, 2 mM EDTA, 20 mM Tris [pH 8.1], 500 mM NaCl). The beads were then washed twice with Tris-EDTA buffer, and chromatin was eluted using an elution buffer (1% SDS, 0.1 M NaHCO3) and reverse cross-linked by addition of 0.3 M NaCl and RNase A at 65°C overnight. Eluted DNA was precipitated, treated with proteinase K at 45°C for 2 h, and purified using phenol-chloroform and isoamyl alcohol. Purified DNA of the ChIP fraction and the inputs was subjected to amplification of TRs with primers (forward, 5′-GGGGGACCCCGGGCAGCGAG-3′; reverse, 5′-GGCTCCCCCAAACAGGCTCA-3′) flanking TR nucleotides 677 to 766 on an ABI StepOne plus real-time PCR machine (Applied Biosystems).

Two-step isolation of proteins on nascent DNA (iPOND).

KSHV-positive cells (1.0 × 108 cells per sample) were incubated for 30 min with 30 μM EdU (5-ethynyl-2′-deoxyuridine), a thymidine analogue. The cells were washed with PBS, cross-linked with 1% formaldehyde for 15 min at room temperature (RT), quenched with 0.125 M glycine for 5 min at RT, and washed three times in PBS. Cell pellets were then resuspended in 0.25% Triton-X–PBS for permeabilization and incubated for 30 min at RT. The cells were dounced 10 times in the permeabilization buffer and centrifuged at 900 × g for 5 min. Pellets were washed once with 0.5% bovine serum albumin (BSA)-PBS and once with PBS using the same volume used for permeabilization prior to the Click reaction.

Click reactions were performed to conjugate biotin to the EdU-labeled DNA. Cells were then subjected to the click reaction for 2 h by incubating the cells in 10 mM sodium ascorbate, 2 mM CuSO4, and photocleavable biotin-azide (Life Technologies, Inc.) at a density of 1.0 × 108 cells/5 ml of click cocktail. DMSO was added instead of biotin-azide to the negative-control samples. After centrifugation at 900 × g for 5 min, the cell pellets were washed once with 0.5% BSA-PBS and once with PBS. Cells were then resuspended in lysis buffer containing 1% SDS, 50 mM Tris, pH 8.0 (1.5 × 107 per 100 μl lysis buffer), 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml pepstatin, 10 μg/ml leupeptin, and 10 μg/ml aprotinin and incubated on ice for 15 min. Samples were sonicated using a microtip sonicator for 8 min at 15 W with 20-s on and 40-s off pulses. Cell debris was removed by centrifugation at 16,100 × g for 10 min at RT and diluted 1:1 (vol/vol) with cold PBS containing 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml pepstatin, 10 μg/ml leupeptin, and 10 μg/ml aprotinin. The cell lysates were incubated overnight with 10 μg of LANA antibody, and the immune complexes were captured with 40 μl of magnetic protein A/G beads (preblocked in single-stranded DNA [ssDNA]) for 2 h. The beads were washed three times in PBS-ssDNA, and the LANA-bound proteins were eluted using 25 μg of LANA peptide in 1× Tris-buffered saline (TBS) at room temperature. Elution was performed twice, and the eluted proteins were then incubated with 100 μl of Pierce streptavidin agarose Beads (ThermoFisher) overnight for 12 to 16 h in dark. The beads were washed twice in PBS, once in 150 mM NaCl, and a final time in 1× PBS. Captured DNA-protein complexes were eluted under reducing conditions by boiling them in 2 × SDS sample buffer for 30 min at 95°C. Protein samples were resolved on 4 to 20% gradient gels (Bio-Rad Laboratories) and immunoblotted with specific antibodies using an Odyssey infrared imaging system (LiCor Biosciences, Lincoln, NE).

ACKNOWLEDGMENTS

We thank Alan Diehl (Medical University of South Carolina) and John Schimenti (Cornell University) for MCM constructs. We also thank Paul Liebermann (Wistar Institute) for carboxyl-terminal point mutants of LANA.

This work was supported by the National Institutes of Health (CA174459 and AI105000).

REFERENCES

  • 1.Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865–1869. [DOI] [PubMed] [Google Scholar]
  • 2.Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332:1186–1191. doi: 10.1056/NEJM199505043321802. [DOI] [PubMed] [Google Scholar]
  • 3.Zhong W, Ganem D. 1997. Characterization of ribonucleoprotein complexes containing an abundant polyadenylated nuclear RNA encoded by Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8). J Virol 71:1207–1212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cai Q, Verma SC, Lu J, Robertson ES. 2010. Molecular biology of Kaposi's sarcoma-associated herpesvirus and related oncogenesis. Adv Virus Res 78:87–142. doi: 10.1016/B978-0-12-385032-4.00003-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Toth Z, Brulois K, Jung JU. 2013. The chromatin landscape of Kaposi's sarcoma-associated herpesvirus. Viruses 5:1346–1373. doi: 10.3390/v5051346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Uppal T, Banerjee S, Sun Z, Verma SC, Robertson ES. 2014. KSHV LANA—the master regulator of KSHV latency. Viruses 6:4961–4998. doi: 10.3390/v6124961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rainbow L, Platt GM, Simpson GR, Sarid R, Gao SJ, Stoiber H, Herrington CS, Moore PS, Schulz TF. 1997. The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J Virol 71:5915–5921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kedes DH, Lagunoff M, Renne R, Ganem D. 1997. Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus. J Clin Invest 100:2606–2610. doi: 10.1172/JCI119804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kellam P, Boshoff C, Whitby D, Matthews S, Weiss RA, Talbot SJ. 1997. Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. J Hum Virol 1:19–29. [PubMed] [Google Scholar]
  • 10.Verma SC, Lan K, Robertson E. 2007. Structure and function of latency-associated nuclear antigen. Curr Top Microbiol Immunol 312:101–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ballestas ME, Kaye KM. 2001. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J Virol 75:3250–3258. doi: 10.1128/JVI.75.7.3250-3258.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Barbera AJ, Chodaparambil JV, Kelley CB, Joukov V, Walter JC, Luger K, Kaye KM. 2006. The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science 311:856–861. doi: 10.1126/science.1120541. [DOI] [PubMed] [Google Scholar]
  • 13.Cotter MA, Robertson ES. 1999. The latency-associated nuclear antigen tethers the Kaposi's sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology 264:254–264. doi: 10.1006/viro.1999.9999. [DOI] [PubMed] [Google Scholar]
  • 14.Garber AC, Shu MA, Hu J, Renne R. 2001. DNA binding and modulation of gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J Virol 75:7882–7892. doi: 10.1128/JVI.75.17.7882-7892.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Matsumura S, Persson LM, Wong L, Wilson AC. 2010. The latency-associated nuclear antigen interacts with MeCP2 and nucleosomes through separate domains. J Virol 84:2318–2330. doi: 10.1128/JVI.01097-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hu J, Garber AC, Renne R. 2002. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus supports latent DNA replication in dividing cells. J Virol 76:11677–11687. doi: 10.1128/JVI.76.22.11677-11687.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Grundhoff A, Ganem D. 2003. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus permits replication of terminal repeat-containing plasmids. J Virol 77:2779–2783. doi: 10.1128/JVI.77.4.2779-2783.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ohsaki E, Ueda K. 2012. Kaposi's sarcoma-associated herpesvirus genome replication, partitioning, and maintenance in latency. Front Microbiol 3:7. doi: 10.3389/fmicb.2012.00007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lim C, Sohn H, Lee D, Gwack Y, Choe J. 2002. Functional dissection of latency-associated nuclear antigen 1 of Kaposi's sarcoma-associated herpesvirus involved in latent DNA replication and transcription of terminal repeats of the viral genome. J Virol 76:10320–10331. doi: 10.1128/JVI.76.20.10320-10331.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Garber AC, Hu J, Renne R. 2002. Latency-associated nuclear antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and to facilitate DNA replication. J Biol Chem 277:27401–27411. doi: 10.1074/jbc.M203489200. [DOI] [PubMed] [Google Scholar]
  • 21.Si H, Verma SC, Lampson MA, Cai Q, Robertson ES. 2008. Kaposi's sarcoma-associated herpesvirus-encoded LANA can interact with the nuclear mitotic apparatus protein to regulate genome maintenance and segregation. J Virol 82:6734–6746. doi: 10.1128/JVI.00342-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Purushothaman P, McDowell ME, McGuinness J, Salas R, Rumjahn SM, Verma SC. 2012. Kaposi's sarcoma-associated herpesvirus-encoded LANA recruits topoisomerase IIβ for latent DNA replication of the terminal repeats. J Virol 86:9983–9994. doi: 10.1128/JVI.00839-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Stedman W, Deng Z, Lu F, Lieberman PM. 2004. ORC, MCM, and histone hyperacetylation at the Kaposi's sarcoma-associated herpesvirus latent replication origin. J Virol 78:12566–12575. doi: 10.1128/JVI.78.22.12566-12575.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Verma SC, Choudhuri T, Kaul R, Robertson ES. 2006. Latency-associated nuclear antigen (LANA) of Kaposi's sarcoma-associated herpesvirus interacts with origin recognition complexes at the LANA binding sequence within the terminal repeats. J Virol 80:2243–2256. doi: 10.1128/JVI.80.5.2243-2256.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Verma SC, Lu J, Cai Q, Kosiyatrakul S, McDowell ME, Schildkraut CL, Robertson ES. 2011. Single molecule analysis of replicated DNA reveals the usage of multiple KSHV genome regions for latent replication. PLoS Pathog 7:e1002365. doi: 10.1371/journal.ppat.1002365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sun Q, Tsurimoto T, Juillard F, Li L, Li S, De Leon Vazquez E, Chen S, Kaye K. 2014. Kaposi's sarcoma-associated herpesvirus LANA recruits the DNA polymerase clamp loader to mediate efficient replication and virus persistence. Proc Natl Acad Sci U S A 111:11816–11821. doi: 10.1073/pnas.1404219111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Thakker S, Purushothaman P, Gupta N, Challa S, Cai Q, Verma SC. 2015. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen inhibits major histocompatibility complex class II expression by disrupting enhanceosome assembly through binding with the regulatory factor X complex. J Virol 89:5536–5556. doi: 10.1128/JVI.03713-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Friedman PN, Wang EH, Meerovitch K, Sonenberg N, Prives C. 1992. Murine p53 inhibits the function but not the formation of SV40 T antigen hexamers and stimulates T antigen RNA helicase activity. Chromosoma 102:S60–S66. [DOI] [PubMed] [Google Scholar]
  • 29.Waga S, Stillman B. 1994. Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro. Nature 369:207. doi: 10.1038/369207a0. [DOI] [PubMed] [Google Scholar]
  • 30.Joo WS, Kim HY, Purviance JD, Sreekumar KR, Bullock PA. 1998. Assembly of T-antigen double hexamers on the simian virus 40 core origin requires only a subset of the available binding sites. Mol Cell Biol 18:2677–2687. doi: 10.1128/MCB.18.5.2677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Stahl H, Droge P, Knippers R. 1986. DNA helicase activity of SV40 large tumor antigen. EMBO J 5:1939–1944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yan H, Merchant AM, Tye BK. 1993. Cell cycle-regulated nuclear localization of MCM2 and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast. Genes Dev 7:2149–2160. [DOI] [PubMed] [Google Scholar]
  • 33.Hennessy KM, Clark CD, Botstein D. 1990. Subcellular localization of yeast CDC46 varies with the cell cycle. Genes Dev 4:2252–2263. [DOI] [PubMed] [Google Scholar]
  • 34.Thommes P, Fett R, Schray B, Burkhart R, Barnes M, Kennedy C, Brown NC, Knippers R. 1992. Properties of the nuclear P1 protein, a mammalian homologue of the yeast Mcm3 replication protein. Nucleic Acids Res 20:1069–1074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kearsey SE, Labib K. 1998. MCM proteins: evolution, properties, and role in DNA replication. Biochim Biophys Acta 1398:113–136. [DOI] [PubMed] [Google Scholar]
  • 36.Bell SP, Dutta A. 2002. DNA replication in eukaryotic cells. Annu Rev Biochem 71:333–374. doi: 10.1146/annurev.biochem.71.110601.135425. [DOI] [PubMed] [Google Scholar]
  • 37.Randell JC, Bowers JL, Rodriguez HK, Bell SP. 2006. Sequential ATP hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase. Mol Cell 21:29–39. doi: 10.1016/j.molcel.2005.11.023. [DOI] [PubMed] [Google Scholar]
  • 38.Bowers JL, Randell JC, Chen S, Bell SP. 2004. ATP hydrolysis by ORC catalyzes reiterative Mcm2-7 assembly at a defined origin of replication. Mol Cell 16:967–978. doi: 10.1016/j.molcel.2004.11.038. [DOI] [PubMed] [Google Scholar]
  • 39.Tanaka T, Knapp D, Nasmyth K. 1997. Loading of an Mcm protein onto DNA replication origins is regulated by Cdc6p and CDKs. Cell 90:649–660. [DOI] [PubMed] [Google Scholar]
  • 40.Romanowski P, Madine MA, Rowles A, Blow JJ, Laskey RA. 1996. The Xenopus origin recognition complex is essential for DNA replication and MCM binding to chromatin. Curr Biol 6:1416–1425. [DOI] [PubMed] [Google Scholar]
  • 41.Nishitani H, Lygerou Z, Nishimoto T, Nurse P. 2000. The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404:625–628. doi: 10.1038/35007110. [DOI] [PubMed] [Google Scholar]
  • 42.Maiorano D, Moreau J, Mechali M. 2000. XCDT1 is required for the assembly of pre-replicative complexes in Xenopus laevis. Nature 404:622–625. doi: 10.1038/35007104. [DOI] [PubMed] [Google Scholar]
  • 43.Kearsey SE, Montgomery S, Labib K, Lindner K. 2000. Chromatin binding of the fission yeast replication factor mcm4 occurs during anaphase and requires ORC and cdc18. EMBO j 19:1681–1690. doi: 10.1093/emboj/19.7.1681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Donovan S, Harwood J, Drury LS, Diffley JF. 1997. Cdc6p-dependent loading of Mcm proteins onto pre-replicative chromatin in budding yeast. Proc Natl Acad Sci U S A 94:5611–5616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gupta N, Thakker S, Verma SC. 2016. KSHV encoded LANA recruits nucleosome assembly protein NAP1L1 for regulating viral DNA replication and transcription. Sci Rep 6:32633. doi: 10.1038/srep32633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Purushothaman P, Dabral P, Gupta N, Sarkar R, Verma SC. 2016. KSHV genome replication and maintenance. Front Microbiol 7:54. doi: 10.3389/fmicb.2016.00054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Xiao B, Verma SC, Cai Q, Kaul R, Lu J, Saha A, Robertson ES. 2010. Bub1 and CENP-F can contribute to Kaposi's sarcoma-associated herpesvirus genome persistence by targeting LANA to kinetochores. J Virol 84:9718–9732. doi: 10.1128/JVI.00713-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Sirbu BM, Couch FB, Cortez D. 2012. Monitoring the spatiotemporal dynamics of proteins at replication forks and in assembled chromatin using isolation of proteins on nascent DNA. Nat Protoc 7:594–605. doi: 10.1038/nprot.2012.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Aranda S, Rutishauser D, Ernfors P. 2014. Identification of a large protein network involved in epigenetic transmission in replicating DNA of embryonic stem cells. Nucleic Acids Res 42:6972–6986. doi: 10.1093/nar/gku374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kellam P, Bourboulia D, Dupin N, Shotton C, Fisher C, Talbot S, Boshoff C, Weiss RA. 1999. Characterization of monoclonal antibodies raised against the latent nuclear antigen of human herpesvirus 8. J Virol 73:5149–5155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dupin N, Fisher C, Kellam P, Ariad S, Tulliez M, Franck N, van Marck E, Salmon D, Gorin I, Escande J-P, Weiss RA, Alitalo K, Boshoff C. 1999. Distribution of human herpesvirus-8 latently infected cells in Kaposi’s sarcoma, multicentric Castleman’s disease, and primary effusion lymphoma. Proc Natl Acad Sci U S A 96:4546–4551. doi: 10.1073/pnas.96.8.4546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Parravicini C, Chandran B, Corbellino M, Berti E, Paulli M, Moore PS, Chang Y. 2000. Differential viral protein expression in Kaposi's sarcoma-associated herpesvirus-infected diseases: Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Am J Pathol 156:743–749. doi: 10.1016/S0002-9440(10)64940-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Bochman ML, Schwacha A. 2009. The Mcm complex: unwinding the mechanism of a replicative helicase. Microbiol Mol Biol Rev 73:652–683. doi: 10.1128/MMBR.00019-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Maiorano D, Lemaitre JM, Mechali M. 2000. Stepwise regulated chromatin assembly of MCM2-7 proteins. J Biol Chem 275:8426–8431. [DOI] [PubMed] [Google Scholar]
  • 55.Seki T, Diffley JF. 2000. Stepwise assembly of initiation proteins at budding yeast replication origins in vitro. Proc Natl Acad Sci U S A 97:14115–14120. doi: 10.1073/pnas.97.26.14115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Schwam DR, Luciano RL, Mahajan SS, Wong L, Wilson AC. 2000. Carboxy terminus of human herpesvirus 8 latency-associated nuclear antigen mediates dimerization, transcriptional repression, and targeting to nuclear bodies. J Virol 74:8532–8540. doi: 10.1128/JVI.74.18.8532-8540.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Barbera AJ, Ballestas ME, Kaye KM. 2004. The Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 N terminus is essential for chromosome association, DNA replication, and episome persistence. J Virol 78:294–301. doi: 10.1128/JVI.78.1.294-301.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Domsic JF, Chen HS, Lu F, Marmorstein R, Lieberman PM. 2013. Molecular basis for oligomeric-DNA binding and episome maintenance by KSHV LANA. PLoS Pathog 9:e1003672. doi: 10.1371/journal.ppat.1003672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kati S, Tsao EH, Günther T, Weidner-Glunde M, Rothämel T, Grundhoff A, Kellam P, Schulz TF. 2013. Activation of the B cell antigen receptor triggers reactivation of latent Kaposi’s sarcoma-associated herpesvirus in B cells. J Virol 87:8004. doi: 10.1128/JVI.00506-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Verma SC, Cai Q, Kreider E, Lu J, Robertson ES. 2013. Comprehensive analysis of LANA interacting proteins essential for viral genome tethering and persistence. PLoS One 8:e74662. doi: 10.1371/journal.pone.0074662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hirt B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 26:365–369. [DOI] [PubMed] [Google Scholar]
  • 62.McDowell ME, Purushothaman P, Rossetto CC, Pari GS, Verma SC. 2013. Phosphorylation of Kaposi’s sarcoma-associated herpesvirus processivity factor ORF59 by a viral kinase modulates its ability to associate with RTA and oriLyt. J Virol 87:8038. doi: 10.1128/JVI.03460-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Strahan RC, McDowell-Sargent M, Uppal T, Purushothaman P, Verma SC. 2017. KSHV encoded ORF59 modulates histone arginine methylation of the viral genome to promote viral reactivation. PLoS Pathog 13:e1006482. doi: 10.1371/journal.ppat.1006482. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES