Abstract
Background
Mycoplasma gallisepticum (MG) is a major pathogen that causes respiratory diseases 14in poultry, resulting in reduced production and severe economic losses. Current MG detection methods are time-consuming, labor-intensive, and expensive. Hence, the rapid and accurate detection of MG is critical for effective disease control. Therefore, this study aimed to develop a dual-mode diagnostic assay for sensitive and specific detection of MG by combining recombinase-aided amplification (RAA) with CRISPR/Cas12a technology. Conserved regions of the mgc2 gene were used for primer and CRISPR RNA design, and the reaction conditions were optimized to maximize detection efficiency.
Results
The assay achieved a detection limit of 2 copies/µL and demonstrated high specificity against seven other common avian pathogens. Detection was visualized within 1 h using either fluorescence or lateral flow dipstick. Moreover, clinical validation of chicken samples showed complete concordance with quantitative real-time polymerase chain reaction results. Furthermore, an epidemiological investigation revealed that chickens had the highest positivity rate for MG among chickens, ducks, and pigeons in Hubei Province.
Conclusions
This simple, rapid, field-deployable method is valuable for timely MG surveillance and effective disease management in poultry production.
Keywords: Mycoplasma gallisepticum, Recombinant enzyme-assisted amplification, Dual readout, CRISPR/Cas12a, Detection
Background
Mycoplasma gallisepticum(MG) is the primary pathogen responsible for avian mycoplasmosis and predisposes infected birds to secondary infections that can develop into chronic respiratory diseases. Such infections compromise respiratory function and also result in substantial economic losses owing to decreased egg production, reduced hatchability, and lower carcass quality (Mugunthan et al. 2023).
Traditional MG detection relies on culture isolation, which is considered the gold standard for diagnosis. However, this approach is labor-intensive, time consuming, and requires specialized laboratory facilities. Serological methods, including enzyme-linked immunosorbent assays (ELISA), hemagglutination inhibition (HI), and serum plate agglutination (SPA) offer rapid alternatives. However, the sensitivities of HI and SPA are limited, and the antigenic variability among MG strains may reduce their accuracy (Ewing et al. 1996). Suitably, ELISA provides improved specificity; however, its sensitivity is slightly lower; hence, complementary diagnostic strategies are needed (Avakian et al. 1988; Luciano et al. 2011). Accordingly, molecular methods, such as polymerase chain reaction (PCR) and quantitative real-time PCR (qPCR), achieve high sensitivity and specificity. However, these methods depend on costly instrumentation and technical expertise, thus restricting their application in field settings (Hong et al. 2005; Wang et al. 2025).
Recombinant enzyme-assisted amplification (RAA) is an isothermal amplification method that operates at 37–42 °C and relies on a recombinase–primer complex to scan double-stranded DNA and facilitate strand invasion. Single-stranded DNA binding proteins stabilize the displaced strand, while a strand-displacing polymerase extends the primer, enabling rapid nucleic acid amplification without the need for thermal cycling (Xue et al. 2019). Correspondingly, recent developments in isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP) and recombinase-aided amplification (RAA), have facilitated rapid on-site detection of pathogens (Ehtisham-Ul-Haque et al. 2017; Jiang et al. 2022). LAMP typically requires 4–6 primers and incubation at ~ 65 °C for 30–60 min, whereas RAA utilizes only two primers, operates at ~ 39 °C, and completes amplification in less than 30 min (Wang et al. 2024; Zhang et al. 2025). Although these approaches accelerate detection, their specificity is limited and may generate false-positive results (Srivastava and Prasad 2023).
CRISPR/Cas12a detection is based on target-specific recognition by a crRNA-guided Cas12a nuclease. Upon binding to its target sequence, Cas12a becomes activated and exhibits robust collateral cleavage activity toward nearby single-stranded DNA reporters, generating a fluorescent or lateral-flow readout (Chen et al. 2018). This study aimed to develop a rapid, sensitive, and accurate MG detection assay by combining RAA with CRISPR-Cas12a technology.
The dual-mode platform allowed for visualization within 1 h via fluorescence or lateral flow strips, with results observable under blue light or using lateral flow dipstick (LFD) (Fig. 1). Furthermore, clinical validation demonstrated full concordance with qPCR, thereby indicating the potential of this method for timely, field-deployable surveillance of MG in poultry populations.
Fig. 1.
Schematic of the CRISPR/Cas12a diagnostic platform for detection of MG. The CRISPR/Cas12a diagnostic platform consists of four steps. First, the tissue nucleic acids were extracted using a FastPure Bacteria DNA Isolation Mini Kit. Second, nucleic acids are amplified with RAA primers at 39 °C for 10 min. Third, the CRISPR/Cas12a system is used to detect RAA amplicons. Finally, the results are visualized using LFD and a blue light transilluminator. Abbreviations: RAA, Recombinant enzyme-assisted amplification; LbaCas12a, CRISPR-associated protein 12a; ssDNA, single-stranded DNA
Methods
Bacterial strains and nucleic acid extraction
MG, Mycoplasma synoviae (MS), Escherichia coli (EC), Avibacterium paragallinarum (AP), Salmonella Pullorum (SP), Salmonella enterica (SE), Clostridium perfringens (CP), and Staphylococcus aureus (SA) were preserved in the laboratory and used in this study. Clinical samples were collected from diseased chicken throat swabs and stored in PBS. Genomic DNA was isolated from the cultured strains and clinical specimens using FastPure Bacteria DNA Isolation Mini Kit (Vazyme, Nanjing, China; Cat. No. DC102).
Sequence analysis and plasmid construction
Representative mgc2 gene sequences of MG strains were retrieved from GenBank (accession numbers: AY556301.1, MW617973.1, JQ770175.1, AY556296.1, AY556294.1, KX268621.1, AY556288.1, AY556272.1, AY556234.1, AY556232.1, AY556233.1, AY556231.1, AY556228.1, AY556229.1, AY556227.1, AY556251.1, AY556298.1, MW617974.1, AY556293.1, and MW617977.1). Conserved regions were identified using MegAlign software. The target fragment encompassing these conserved sites was amplified and inserted into the pMD-18T vector according to the manufacturer’s instructions (Takara, Dalian, China). The copy number of the recombinant plasmid pMD-18T_mgc2 was determined using the following formula: Copy number = (6.02 × 1023 × plasmid concentration [ng/µL])/(660 Da/base pair × plasmid length × 109).
RAA primers, CRISPR RNA (crRNA), and reporter molecules
The mgc2gene is a conserved gene commonly used for the pathogenic diagnosis of MG (Chen et al. 2025). As shown in Table1, Three pairs of RAA primers and one crRNAs were designed based on the mgc2 gene. A single-stranded DNA reporter (labeled with FAM-BHQ1 or FAM-biotin) and all oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). RAA reactions were performed with a commercial kit (Ezassay Biotechnology Co., Ltd., Guangdong, China, Cat. No. BA-RT-LYO-FW-96) in a final volume of 20 µL (10 µL rehydration buffer, 1 µL of each primer [10 mΜ], 1 µL of template DNA(contain 37 ng), 2 µL of starter buffer, and 5 µL nuclease-free water). The mixtures were incubated at 39 °C for 10 min. Specificity and amplification efficiency were evaluated using a Qsep100 nucleic acid analyzer.
Table 1.
Primers, CrRNA and probes
| Primers | Sequences (5′–3′) |
|---|---|
| F1 | GCAGGTGCTGGGTTGATTGTTGTTTCTTTAC |
| R1 | ACGTTCTTGGATCATCATTCTTTCTTTTTTC |
| F2 | GCTGGGTTGATTGTTGTTTCTTTACTCTTGG |
| R2 | ATCTTTTGGTGTTCTTCACGTTCTTGGATCA |
| F3 | GTTGATTGTTGTTTCTTTACTCTTGGGTTTA |
| R3 | AAGGGATTCAACCATCTTTTGGTGTTCTTCA |
| crRNA | uaauuucuacuaaguguagauGGGATTGGGATTCCGATCGCTAA |
| FQ-ssDNA | FAM-TTATT-BHQ1 |
| FB-ssDNA | FAM-TTTTTTTTATT-Biotin |
Fluorescence-based RAA-CRISPR/Cas12a assay
For fluorescence detection, RAA products served as templates in the CRISPR/Cas12a-based cleavage reaction. The mixture (20 µL) contained 200 nM LbaCas12a (Ezassay Biotechnology Co., Ltd., Guangdong, China, Cat. No. CAS-12B-001), 200 nM crRNA, 400 nM fluorescence quenching-single-stranded DNA (ssDNA) reporter, 1× NEB buffer 2.1 (New England Biolabs, Ipswich, MA), 1 µL of RAA product and and nuclease-free water up to 20 µL. Fluorescence signals were recorded every minute for 30 min using a VICTOR Nivo microplate reader (excitation, 480 nm; emission, 530 nm) and visualized under blue light. Reaction conditions, including the concentrations of Cas12a, crRNA, and ssDNA reporter, were optimized to maximize the signal-to-background (S/B) ratios.
RAA-CRISPR/Cas12a assay with lateral flow readout
The RAA-CRISPR/Cas12a assay with lateral flow readout was performed in three steps. First, RAA amplification was performed as described previously. Thereafter, Cas12a-mediated cleavage was carried out in a 30-µL reaction containing 300 nM LbaCas12a, 200 nM crRNA, 300 nM fuchsin basic-ssDNA reporter, 1× NEB buffer, and 1 µL of RAA product, followed by incubation at 37 °C for 12 min. Finally, 10 µL of the reaction mixture was diluted with 40 µL of nuclease-free water and applied to an LFD (Ezassay Biotechnology Co., Ltd., Guangdong, China, Cat. No. PS-FMBO-96). After 5 min incubation at room temperature, positive signals were observed for both the test (T) and control (C) lines, whereas a negative signal was observed only for line C.
Sensitivity and specificity evaluation
Analytical sensitivity was determined using ten-fold serial dilutions of plasmid pMD-18T_mgc2 ranging from 2 × 102 to 2 × 10− 1 copies/µL. The specificity was assessed using genomic DNA from the following seven pathogens: MS, EC, AP, SP, SE, CP, and SA.
Epidemiological investigation of MG in poultry of Hubei Province using RAA-CRISPR/Cas12a platform
To assess the diagnostic performance, pharyngeal swab samples were collected from chicken flocks in Hubei Province that were suspected of MG infection. DNA was extracted using a FastPure Bacteria DNA Isolation Mini Kit. The established RAA-CRISPR/Cas12a-fluorescenceassay was applied, and qPCR results were used as the reference standard (Wang et al. 2025). The concordance between the two methods was calculated to evaluate the sensitivity, specificity, and overall diagnostic accuracy.
Results
Sequence analysis and screening of RAA primers
Multiple sequence alignments of the mgc2 gene were performed to identify conserved motifs suitable for primer design (Fig. 2A). Candidate primer pairs were assessed using the Qsep100 nucleic acid analysis platform, which enabled evaluation of both fragment size and amplification efficiency. Among all the primer combinations tested, the MG_mgc2_F2/R3 set generated a clear 114-bp product with the highest yield and sharpest peak profile (Table 2; Fig. 2B–D). Therefore, this primer pair was chosen for downstream assay development owing to its superior amplification performance.
Fig. 2.
Sequence analysis and RAA primer screening. A Highly conserved regions of the mgc2 gene in MG were analyzed, and crRNA and RAA primers were designed. B–C RAA primers were screened using a Qsep100 automatic nucleic acid analysis system. D MG_mgc2_F2/R3 produced a distinct 114 bp amplicon with the highest concentration and cleanest peak profile
Table 2.
Amplification efficiency test of RAA primers using Qsep100
| Primers | Peak fragment size (bp) | Product concentration (ng/µL) | Peake area |
|---|---|---|---|
| F1/R1 | 92 | 0.47 | 83,645 |
| F1/R2 | 108 | 0.15 | 32,654 |
| F1/R3 | 120 | 0.48 | 106,322 |
| F2/R1 | 86 | 0.55 | 95,955 |
| F2/R2 | 102 | 0.50 | 101,944 |
| F2/R3 | 114 | 0.69 | 153,155 |
| F3/R1 | 80 | 0.51 | 91,163 |
| F3/R2 | 97 | 0.54 | 104,662 |
| F3/R3 | 109 | 0.67 | 147,369 |
Establishment and validation of the RAA-CRISPR/Cas12a system
To verify the feasibility of the system, the complete RAA-CRISPR/Cas12a reaction was compared with four control groups, each lacking one key component (LbaCas12a, crRNA, target DNA, or the ssDNA reporter). As illustrated in Fig. 3A–B, only the complete system produced a robust fluorescence signal, whereas all controls showed a negligible background. These results confirm that each component is indispensable for signal generation. Kinetic analysis further demonstrated that the fluorescence intensity plateaued at approximately 12 min, which was the optimal detection window.
Fig. 3.
Evaluation of RAA–CRISPR/Cas12a assay performance. A Detection results of five different reaction mixtures under 480 nm blue light. The “+” and “−” indicators represent the inclusion or exclusion, respectively, of specific elements in each test condition. B Kinetic fluorescence monitoring of identical reaction setups. The assay used 200 nM Cas12a protein, 200 nM crRNA, and 200 nM fluorescent-quenched ssDNA reporters. The detection template consisted of a mgc2 gene-containing plasmid from MG, where RAA amplification products act as the detection substrate for the combined RAA–CRISPR/Cas12a system
Optimization of reaction conditions
The key parameters of the CRISPR/Cas12a reaction, including the LbaCas12a, crRNA, and ssDNA reporter concentrations, were optimized to maximize the S/B ratio. Increasing the LbaCas12a concentration from 100 to 300 nM markedly enhanced the fluorescence intensity (Fig. 4A, B). Similarly, crRNA exhibited concentration-dependent activity, with the highest S/B ratio obtained at 200 nM (Fig. 4C, D). For the ssDNA reporter, the optimal signal was achieved at 300 nM; however, further increases resulted in plateaued responses (Fig. 4E, F). Based on these findings, the optimal conditions were established as 300 nM LbaCas12a, 200 nM crRNA, and 300 nM reporter probe.
Fig. 4.
Parameter optimization of the RAA–CRISPR/Cas12a detection system. Optimized concentrations of LbaCas12a (A, B), crRNA (C, D), and FQ-ssDNA reporter (E, F) were detected via fluorescence visualization and monitored through fluorescence intensity measurements. S/B represents the ratio between the fluorescence signal and background. Data are reported as mean ± SD (n = 3)
Sensitivity and specificity of the dual-mode detection system
To determine assay sensitivity, ten-fold serial dilutions of the recombinant pMD-18T_mgc2 plasmid (2 × 102 to 2 × 10− 1 copies/µL) were tested. The fluorescence-based platform achieved a detection limit of 2 copies/µL, a result that was also visually confirmed under blue light (Fig. 5A). The lateral-flow format demonstrated comparable sensitivity while reducing instrument dependency, thus supporting its suitability for field applications (Fig. 5B).
Fig. 5.
Evaluation of the sensitivity and specificity of the RAA–CRISPR/Cas12a assay. Sensitivity evaluation of the RAA–CRISPR/Cas12a assay was performed via fluorescence imaging (A) and LFD (B). Specificity evaluation of the RAA–CRISPR/Cas12a assay were visualized through fluorescence imaging (C), and LFD (D). Three times repeat of the assay
Specificity was evaluated against seven common avian pathogens (MS, EC, AP, SP, SE, SA, and CP). As shown in Fig. 5C–D, only the MG samples produced positive signals, whereas all other pathogens yielded negative results, underscoring the high specificity of the assay.
Detection of MG in clinical samples using RAA-CRISPR/Cas12a assay
To assess the diagnostic utility of the assay, 14 pharyngeal swabs collected from chickens were analyzed using the dual-mode system, with qPCR serving as the gold standard for assay validation. The qPCR identified four positive and 10 negative samples (Fig. 6A), which was consistent with the fluorescence readout and LFD visualization (Fig. 6B–D). These findings indicated that the developed assay is both accurate and reliable for MG detection in clinical settings.
Fig. 6.
Application of the RAA–CRISPR assay for testing MG in clinical samples. A The Venn diagram showed the detection of MG in clinical samples by qPCR and RAA/Cas12a methods. The results of the RAA/Cas12a assay for the clinical samples were obtained with visualization via fluorescence imaging (B) and LFD (C). D Results of the qPCR assay and RAA/Cas12a method for clinical samples 1–14. qPCR results are shown as ct values. RAA/Cas12a results were shown with fluorescence intensity
Epidemiological investigation of MG in poultry in Hubei Province
A total of 150 pharyngeal swab samples were collected from chickens, ducks, and pigeons in Hubei Province, China. The RAA-CRISPR/Cas12a assay developed in this study was used to determine the prevalence of MG. The overall detection rate was 25.33%, with 38 of 85 samples from chickens testing positive and no detection in samples from ducks or pigeons (Table 3).
Table 3.
MG positive rates via RAA–CRISPR/Cas12a
| Background | Chickens | Ducks | Pigeons | Total |
|---|---|---|---|---|
| MG positive rate | 44.71% | 0% | 0% | 25.33% |
| 38/85 | 0/30 | 0/35 | 38/150 |
Discussion
MG remains one of the most economically important pathogens in the poultry industry, causing respiratory disease, reduced feed conversion, and substantial declines in egg yield (Miller et al. 2024). Accordingly, rapid and precise detection methods are essential to mitigate flock-level outbreaks and improve biosecurity.
The mgc2gene has long been recognized as a reliable diagnostic marker of MG infection (Marouf et al. 2022). An automated nucleic acid analysis system (Qsep100) was used to screen the disease diagnostic primer pairs (Wei et al. 2023). In this study, the conserved regions ofmgc2 were selected for primer design, and the MG_F2/R3 primer set was identified as the most effective based on amplification efficiency and specificity. Furthermore, systematic dissection of the RAA-CRISPR/Cas12a reaction demonstrated that all four core components were indispensable for generating a detectable signal, with fluorescence reaching maximum levels at approximately 12 min.
The following two complementary detection modes were established: a fluorescence assay that enabled rapid visual detection via blue light, and a lateral flow assay that enabled rapid visual readout. The reaction efficiency was strongly influenced by LbaCas12a, crRNA, and ssDNA reporter concentrations, with the optimal conditions determined to be 300 nM LbaCas12a, 200 nM crRNA, and 300 nM ssDNA reporter. Under optimal conditions, the assay achieved a detection limit of 2 copies/µL, thereby exhibiting sensitivity comparable with that of advanced qPCR assays (Xu et al. 2025), while maintaining simplicity and speed (< 1 h). Importantly, specificity testing against eight avian pathogens revealed excellent selectivity for MG. The field applicability was further confirmed via clinical validation. Fourteen poultry swab samples were tested, and the RAA-CRISPR/Cas12a system produced results consistent with the qPCR results (Fig.6). These findings demonstrate that this assay can serve as a rapid, sensitive, and low-resource alternative for MG detection, renderings it particularly valuable for on-site diagnostics and surveillance. Despite the promising specificity and sensitivity, the clinical evaluation was limited to 14 field samples. A larger and more geographically diverse set of clinical specimens is needed to further substantiate the diagnostic performance and field applicability of the assay.
Epidemiological studies have reported the positivity rate for MG exceeding 75% in chickens, which have rarely been reported in ducks and pigeons (Wei et al. 2023). The study findings align with these reports and further highlight the importance of early diagnosis and timely intervention in chickens. Furthermore, the assay established in this study provides a promising platform for routine MG surveillance and facilitates improved disease control in poultry production systems.
Conventional PCR and qPCR assays remain the gold standards for MG detection; however, their reliance on thermocyclers and laboratory infrastructure limits field deployment. Although LAMP has been explored for MG, they typically require higher temperatures (60℃) and with the sensitivity of 10 fg/µL (Ehtisham-Ul-Haque et al. 2017).To our knowledge, CRISPR-based detection methods for MG remain limited, and no previously reported assay has integrated a fully optimized RAA–Cas12a workflowwith dual detection modes targeting mgc2. These features collectively highlight the novelty and practical value of our diagnostic platform.
Conclusion
This study established a rapid, sensitive, and specific detection method for MG that combined RAA with CRISPR/Cas12a. The dual-mode assay allows detection within 1 h using either fluorescence or lateral flow strip visualization, with a detection limit as low as 2 copies/µL. This simple and field-deployable platform provides a valuable tool for timely detection and surveillance of MG, thereby supporting effective disease management and biosecurity in poultry production.
Acknowledgements
Not applicable.
Abbreviations
- MG
Mycoplasma gallisepticum
- MS
Mycoplasma synoviae
- EC
Escherichia coli
- AP
Avibacterium paragallinarum
- SP
Salmonella Pullorum
- SE
Salmonella enterica
- CP
Clostridium perfringens
- SA
Staphylococcus aureus
- ELISA
Enzyme-linked immunosorbent assay
- HI
Hemagglutination inhibition
- SPA
Serum plate agglutination
- PCR
Polymerase chain reaction
- qPCR
Quantitative real-time PCR
- LAMP
Loop-mediated isothermal amplification
- RAA
Recombinase-aided amplification
- crRNA
CRISPR RNA
- ssDNA
Single-stranded DNA
- S/B
Signal-to-background
- LFD
Lateral flow dipstick
Authors’ contributions
Q.H. and R.R.Z. wrote the main manuscript text, W.T.Z. and X.L. prepared Figs. 1, 2 and 3 and J.Y.L. prepared Figs. 4, 5 and 6 and Y.Q.G. and Q.L. prepared Figs. 4, 5 and 6 and B.K.Y. prepared Table 3, T.F.Z. investigated the technical of the manuscript, X.G.Z. and Q.P.L administrated the project and writing-review & editing.
Funding
This work was supported by the Hubei Province Technology Innovation Plan Project “Disclosure System” Science and Technology Project (2025BEB053), the Hubei Province Technology Innovation Plan Project (2024BBA004 and 2024BBB074), the Major Special Project for the Development of Agricultural Microbial Industry in Hubei Province (NYWSWZX2025-3432027-04), the Hubei Province Modern Agricultural Industry Technology System (2023HBSTX4-04), and the China Agriculture Research System (CARS-41).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
Informed consent for the use of all experimental animals was obtained from the owner of the farm where they were kept.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Authors’ information
Qiao Hu and Rongrong Zhang contributed equally to this work.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Qiao Hu and Rongrong Zhang are contributed equally to this work.
Contributor Information
Xinguo Zhai, Email: zhaixg1966@163.com.
Qingping Luo, Email: qingping0523@163.com.
References
- Avakian AP, Kleven SH, Glisson JR. Evaluation of the specificity and sensitivity of two commercial enzyme-linked immunosorbent assay kits, the serum plate agglutination test, and the hemagglutination-inhibition test for antibodies formed in response to Mycoplasma gallisepticum. Avian Dis. 1988;32:262–72. [PubMed] [Google Scholar]
- Chen JS, Ma E, Harrington LB. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360:436–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen X, Zhang S, Lin S. From lab to field: innovative RPA‒CRISPR/Cas12a platform for early short-beak and dwarfism syndrome virus nucleic acids detection. Poult Sci. 2025;104:105191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ehtisham-Ul-Haque S, Kiran M, Waheed U. Real-time loop-mediated isothermal amplification (LAMP) of mgc2 gene of Mycoplasma gallisepticum. J Vet Res. 2017;61:439–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ewing ML, Lauerman LH, Kleven SH. Evaluation of diagnostic procedures to detect Mycoplasma synoviae in commercial multiplier-breeder farms and commercial hatcheries in Florida. Avian Dis. 1996;40:798–806. [PubMed] [Google Scholar]
- Hong Y, Garcia M, Levisohn S. Differentiation of Mycoplasma gallisepticum strains using amplified fragment length polymorphism and other DNA-based typing methods. Avian Dis. 2005;49:43–9. [DOI] [PubMed] [Google Scholar]
- Jiang T, Wang Y, Jiao W. Recombinase polymerase amplification combined with real-time fluorescent probe for Mycoplasma pneumoniae detection. J Clin Med. 2022. 10.3390/jcm11071780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luciano RL, Cardoso AL, Stoppa GF. Comparative study of serological tests for Mycoplasma synoviae diagnosis in commercial poultry breeders. Vet Med Int. 2011;2011:304349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marouf S, Khalf MA, Alorabi M. Mycoplasma gallisepticum: a devastating organism for the poultry industry in Egypt. Poult Sci. 2022;101:101658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miller JM, Ozyck RG, Pagano PL. Rationally designed Mycoplasma gallisepticum vaccine using a recombinant subunit approach. NPJ Vaccines. 2024;9:178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mugunthan SP, Kannan G, Chandra HM. Infection, transmission, pathogenesis and vaccine development against Mycoplasma gallisepticum. Vaccines (Basel). 2023. 10.3390/vaccines11020469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Srivastava P, Prasad D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech. 2023;13:200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Xue L, Wang L. The quadruplex fluorescent quantitative PCR method for the simultaneous detection of respiratory diseases in quail: Pasteurella multocida, Avibacterium paragallinarum, Mycoplasma gallisepticum, and Mycoplasma synoviae. Front Microbiol. 2025;16:1605356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z, Chen H, Hu A. Establishment of LAMP-CRISPR/Cas12a for rapid detection of Escherichia coli O157:H7 and one-pot detection. Food Microbiol. 2024;124:104622. [DOI] [PubMed] [Google Scholar]
- Wei X, Zhong Q, Wang D. Epidemiological investigations and multilocus sequence typing of Mycoplasma gallisepticum collected in China. Poult Sci. 2023;102:102930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu B, Wang S, Yao W. New molecular diagnostic targets for Avibacterium paragallinarum and a set of single-plex and multiplex qPCR methods for the rapid differential diagnosis of Mycoplasma gallisepticum, Mycoplasma synoviae, and Avibacterium paragallinarum. Poult Sci. 2025;104:105665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xue G, Li S, Zhang W. Reverse-transcription recombinase-aided amplification assay for rapid detection of the 2019 novel coronavirus (SARS-CoV-2). Anal Chem. 2020;92:9699–705. [DOI] [PubMed] [Google Scholar]
- Zhang X, Chen S, Li J. One-step RAA and CRISPR-Cas13a method for detecting influenza B virus. Microb Biotechnol. 2025;18:e70144. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analysed during the current study.