Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Oct 14.
Published in final edited form as: EcoSal Plus. 2008 Jul 25;2008:10.1128/ecosalplus.5.4.3. doi: 10.1128/ecosalplus.5.4.3

The SOS Regulatory Network

Lyle A Simmons 1,†, James J Foti 1,†, Susan E Cohen 1, Graham C Walker 1,*
PMCID: PMC4196698  NIHMSID: NIHMS573354  PMID: 25325076

Abstract

All organisms possess a diverse set of genetic programs that are used to alter cellular physiology in response to environmental cues. The gram-negative bacterium, Escherichia coli, mounts what is known as the “SOS response” following DNA damage, replication fork arrest, and a myriad of other environmental stresses. For over 50 years, E. coli has served as the paradigm for our understanding of the transcriptional, and physiological changes that occur following DNA damage (400). In this chapter, we summarize the current view of the SOS response and discuss how this genetic circuit is regulated. In addition to examining the E. coli SOS response, we also include a discussion of the SOS regulatory networks in other bacteria to provide a broader perspective on how prokaryotes respond to DNA damage.

OVERVIEW OF THE SOS RESPONSE

In E. coli, DNA damage and replication perturbations results in the SOS response, a genetic program that transcriptionally up-regulates over 50 unlinked genes (Table 1). The term “SOS” was coined by Miroslav Radman in 1974 when he postulated the existence of the pathway on the basis of a set of physiological responses induced by DNA damage whose regulation was controlled by the lexA+ and recA+ gene products (300). Radman defined “SOS” as a distress signal used to sense DNA damage or replication fork blockages.

Table 1.

SOS regulated genes

LexA-dependent genes Function Identification as LexA dependent LexA Box(es)a
polB (dinA) −2 Frameshifts and replication restart after UV
treatment (29, 126, 304, 305)
Mud1(Ap lac)
(182)
−71 (75, 113)
dinB (dinP) Translesion synthesis of N2-dG adducts and −1
frameshifts (169, 188)
Mud1(Ap lac)
(182)
−32 (75, 113)
hokE
(ybdY)
Killing protein (113) Northern Analysis (113) −97 (75, 113)
uvrB Involved in nucleotide excision repair (159) UV resistance during Hfr mating;
Mud1 (Ap lac) (115, 159, 182)
−92 (75, 113)
dinG 5´–3´ ssDNA helicase (195, 385, 387) Galactokinase gene fusion (207) −105/−34 (75, 113)
ftsK (dinH) Chromosome segregation at cell division plane
(96)
Galactokinase gene fusion (207) −96 (75, 113, 207)
sulA Inhibitor of cell division (132) SOS chromtest; Mud1(Ap lac) (160, 295) −42 (75, 113)
dinI Stabilizes RecA/ssDNA filaments (386, 413) Mud1(Ap lac);
Suppressor dinD68;
lacZ fusion (182, 413, 415)
−37 (75, 113)
umuCD DNA pol V involved in SOS mutagenesis and
translesion DNA synthesis (266, 286, 354)
LexA inhibition of in vitro
transcription; MudI (17, 190)
−331,−351/−57,−37 (75, 113, 190)
yebG Unknown Operon Fusion (225) −35 (75, 113, 225)
ruvAB Holliday junction branch migration (RuvA DNA binding/RuvB helicase motor) (370, 371) LexA repression of in vitro RNA
pol. Assay; LacZ fusion (343, 344)
−67 (75, 113)
sbmC DNA gyrase inhibitor (19, 63, 264) Microcin resistance (19) −32 (75, 113)
ssb Single stranded binding protein (6, 245, 346) S1 mapping;
Galactokinase gene fusion (44)
−170 (113)
molR (dinOsosF) Molybdate transport (205) Northern Analysis (113) −27 (75, 113)
recN Involved in recombinational repair (222, 242, 290, 330, 396) 2D–gel electrophoresis;
Mu (Ap lac) fusion (114, 222, 291)
−28, −46, −66 (75, 113)
recA SOS regulation and mutagenesis/homologous
recombination (36, 52, 77, 109, 148, 157, 198, 211, 213, 216, 218)
Dnase I protection assay; LacZ
fusion (60, 218)
−77 (75, 113)
pcsA (dinD) Unknown Mud1(Ap lac) (182) −61 (75, 113)
uvrD DNA helicase II (272) Complementation UVs and MMSs
(234)
−74 (75, 113)
dinF Unknown down stream of LexA Mud1(Ap lac) (182) −24,−45 (75, 113)
LexA Transcriptional repressor of SOS genes (45, 46, 128, 157, 214, 218) Dnase I protection assay (218) −24,−45 (75, 113)
uvrA (dinE) Involved in nucleotide excision repair (159) UV resistance during Hfr mating;
Mud1 (Ap lac) (159, 183)
−101/−168 (75, 113)
dinQ Unknown Northern Analysis (113) −139 (113)
ydjQ Putative UvrC homolog, function unknown
(254)
Northern Analysis (113) −33 (75, 113)
ysdAB (tisAB) Toxic protein expressed under stress conditions
(384)
Northern Analysis (113) −142 (113)
ydjM Inner membrane protein (83) Northern Analysis (113) −52 (113)
dinS Putative transposase (113) Northern Analysis (113) −74 (113)
yigN Unknown Microarray (75) −55 (75, 113)
ybfE Unknown Northern Analysis (113) −136 (113)
yjiW (dinLsosC) Unkown Northern Analysis (113) −95 (75, 113)
borD Homolog of prophage protein expressed during
lysogeny (21, 22)
Microarray (75) ND
ybiN Unknown Microarray (75) ND
grxA Glutoredoxin; Hydrogen donor for
ribonucleotide reductase (293)
Microarray (75) ND
yccF Unknown Microarray (75) ND
ymfD Unknown Microarray (75) ND
ymfE Unknown Microarray (75) −280
Lit Protease for EF-Tu (134) Microarray (75) −193
intE Predicted phage integrase Microarray (75) 84, −192, −195
(75)
ymfG Unknown Microarray (75) ND
ymfH Unknown Microarray (75) ND
ymfI Unknown Microarray (75) 84
ymfJ Unknown Microarray (75) ND
ycgH Unknown Microarray (75) ND
ydeO Unknown Microarray (75) −272
ydeS Unknown Microarray (75) −43
ydeT Unknown Microarray (75) ND
ydeR Unknown Microarray (75) ND
arpB Unknown Microarray (75) ND
yoaB Unknown Microarray (75) −123
ogrK Regulate gene transcription of phage P2 (145, 410) Microarray (75) −193, 8
yqgC Unknown Microarray (75) −41, −193
yqgD Unknown Microarray (75) ND
yhiJ Unknown Microarray (75) ND
yhiL Unknown Microarray (75) −63, −187
glvB Unknown Microarray (75) −174
ibpB Heat inducible chaperone (199) Microarray (75) ND
ibpA Heat inducible chaperone (199) Microarray (75) −249
yifL Unknown Microarray (75) ND

LexA-independent genes Function Identification as SOS induced

dinY Mutant defective in Weigle reactivation of UV-irradiated bacteriophage λ (288) Mu d1(Ap lac) (288)
dnaA Initiation protein for chromosomal replication
(399)
Transcriptional fusions; S1 nuclease mapping,
immunoblot analysis (297)
dnaB Replicative DNA helicase (204) lacZ fusion (191)
dnaN Pol III processivity factor; β-subunit (171) lacZ fusion (171)
dnaQ Pol III proofreading factor; ε-subunit (171) lacZ fusion (171)
hga 2-Keto-4-hydroxyglutarate adolase; respiration
recovery after UV exposure (106, 281)
2D–Gel Electrophoresis, Peptide Sequencing, and O2
consumption (62)
ihfA (himA) Site-specific recombination (248, 249, 251) lacZ fusion; Radiolabled 2D–Gele electrophoresis
(250)
nrdAB Ribonucleotide reductase (121–125) lacZ fusion (135)
phr DNA photolyase (327) lacZ fusion (163, 283)
hslVU Protease of SulA (310, 337, 416, 417) Microarray (75)
cvpA Colicin production (111) Microarray (75)
purF Purine biosynthesis (313) Microarray (75, 314)
upp Pyrimidine scavaging (8) Microarray (75)
rpoD RNA polymerase sigma factor (263) Microarray (75)
dnaG DNA primase (31, 349) Microarray (31, 75)
rpsU Ribosomal subunit (82) Microarray (75)
yfaE Unknown Microarray (75)
recX Inhibitor of RecA (357) Microarray (75)
recQ DNA helicase (378) Suppression dnaE486; in vitro helicase assays (165)
sfiC Inhibition of cell division (81) Cell Filamentation in recAsfiA99::Mu d(Ap lac)
strain (81)
a

Distance from ATG start codon.

Since the original hypothesis, the distress signal has been shown to be the accumulation of single stranded DNA (ssDNA). As described in greater detail below, LexA protein is a negative regulator of the SOS response by acting as a transcriptional repressor. RecA is a positive regulator of this response, and the interaction between LexA and RecA polymerized on ssDNA is required to relieve LexA-dependent transcriptional repression of SOS genes. Of the >50 unlinked genes that comprise the SOS response, several are directly involved DNA repair, DNA damage tolerance or inducing a DNA damage checkpoint by blocking cell division.

The SOS response is wired to allow for high fidelity repair to take place before giving way to a more mutagenic mode that allows for cell survival. When the SOS response is induced the first set of genes to be expressed are gene products involved in high fidelity DNA repair. Further into SOS induction, sulA gene expression is induced and this protein causes a DNA damage checkpoint by inhibiting cell division. The SulA-dependent checkpoint allows cells time to repair their DNA before damaged chromosomes are segregated into daughter cells. Late in the SOS response, umuC and umuD genes are expressed and these gene products assemble into a translesion polymerase that has mutagenic potential, as high fidelity repair gives way to lower fidelity damage toleraence. This lower fidelity DNA damage tolerance pathway, is so named because the damage is not removed, but instead tolerated.

Below, we review and discuss the experiments leading toward our current understanding of the SOS response. We also provide a comprehensive summary (Table 1) of all the genes known to be LexA regulated bringing the total number 57. Moreover, we include a table of genes that are potentially LexA regulated, but have yet to be verified (Table 2).

>Table 2.

Potential SOS regulated genesa

Genes with potential SOS boxes LexA Box(es) relative to
promoter +1 start site
ydiM −34
ilbL −330
minC −277
ycgJ −262
yafL −193
dinJ (sosA) −32
ybiA −105
tyrS (dinNsosE) 275
ORF within yeeI −55, 118
ORF within ycgM −57
mug (tngygjF) −69
ORF within ydbK −122
ygiS −157
ORF within ygiT −45
xylE −23
ydbH 1
creA −145
rob −81
brnQ −87
yiaO −92
hofQ −100
metE −205
metR −51
ORF within ydcL −101
yhiX −47
pshM −89
ycgL −57
rfaJ −39
yjgN −55
ybiT −3
ilvD −19
yecS −73
ecpD −79
ydeJ −62
ycbU −100
yfiK −30
ymfM −122, −222, −173
ymfN −152, −312
ymgF −105
ymgH 6
yoaA −24
yneL −57
glvG 0, 211
glvC 214, 578
yfiE −92
a

Location of potential SOS box from Woodgate 2000 (113) and Courcelle 2001 (75)

THE GENETICS OF SOS REGULATION

The SOS response is a genetic circuit that is regulated by the LexA and RecA proteins (4, 46, 47, 56, 91, 194, 211–214) (Fig. 1). LexA is a transcriptional repressor that occupies its cognate operator binding site (SOS box) as a homodimer thereby blocking RNA polymerase (RNAP) binding and transcription (1, 33, 34, 161, 218). LexA has a cryptic autocleavage activity that is activated when LexA interacts with a RecA/ssDNA nucleoprotein filament. Expression of recA+ and lexA+ gene products are regulated in an SOS dependent fashion, and RecA is rather abundant in the non-induced state (331). Considerable in vitro and in vivo evidence has shown that when bacterial DNA is damaged, ssDNA is generated (See Section: Mechanisms Generating ssDNA). RecA binds ssDNA forming a nucleoprotein filament (104, 147, 347, 419). Interaction between the RecA/ssDNA nucleoprotein filament and LexA activates LexA auto-digestion, thereby inactivating LexA as a repressor and leading to the transcription of LexA repressed genes (46, 47, 91, 162, 215). Below, we review the sophisticated network of proteins that influence the magnitude and timing of SOS induction.

Fig. 1. A model for SOS induction.

Fig. 1

A. In the uninduced state, replication proceeds unperturbed and the limited amount of ssDNA present at the replication fork is not available for RecA binding. Transcription of lexA+ (green), recA+ (purple), sulA+ (orange) and other SOS regulated genes is largely repressed. After DNA damage (red circle), RecA binds to the increasing amount of ssDNA in the cell creating the RecA/ssDNA nucleoprotein filament (purple and yellow). The RecA/ssDNA nucleoprotein filament acts as a co-protease to cleave LexA resulting in the expression of the SOS regulon. As the gene products of the SOS regulon repair the DNA damage, the cell will return to the uninduced state as normal replication proceeds and the switch is reset. B. Generation and stabilization of a RecA nucleoprotein filament is regulated by a number of cellular factors. RecBCD and RecFOR can act at a stalled replication fork (left) to generate ssDNA for RecA binding. RecA binding and filamentation can be aided by RecFOR or prevented by RecX (center). Once formed, the RecA filament can be stabilized by DinI binding (right).

The recA+ gene product

RecA, a key player in DNA repair, is required for homologous recombination, SOS induction, and translesion synthesis (TLS). Many of the original recA mutant allele studies suggested that RecA is a positive regulator of SOS because these alleles were defective in recombination and SOS induction (257, 408). It is now known that RecA is required to facilitate LexA autocleavage and thus is a coprotease. The role of RecA in SOS induction was genetically defined when alleles of recA were isolated that result in constitutive SOS induction in the absence of exogenous DNA damage (192, 409). These coprotease constitutive recA alleles [recA(Cptc)] induced SOS during normal growth conditions, or in the case of recA441 a temperature shift to 42°C to induce SOS (61, 409). Biochemical examination of the proteins encoded by recA441 and recA730 showed that these proteins displayed an exceptionally high affinity for ssDNA and are able to displace single-strand binding protein (SSB), an activity that is not observed with wild-type RecA protein (192, 201). It is hypothesized that recA coprotease constitutive mutants are able to compete with SSB for the low levels of ssDNA present at the replication fork during normal replication. It should be noted that RecA803 is capable of SSB displacment under specific in vitro conditions, but does not result in consitutive SOS in vivo (201, 229, 230). These results can be explained by the idea that more than ssDNA binding is important for SOS induction or by the observation that RecA803 displaces SSB in vitro only under certain conditions that are not mimicked in vivo (201, 229, 230). Taken together, RecA binding to ssDNA is a critical step towards SOS induction, but more than ssDNA binding is involved including proper protein-protein interaction between RecA/ssDNA and LexA.

Other classes of recA point mutants that interfere with the ability of RecA to regulate SOS have also been described (90). For example, RecA430 is proficient for homologous recombination, but inefficient as a LexA coprotease (90, 244). To date several hundred recA alleles have been isolated and examined for repair and SOS defects [for review (239)].

The lexA+ gene product

Alleles of the lexA gene have been identified that are defective in SOS induction [lexA(Ind−)] (146, 210, 258), as well as alleles that encode variants of the LexA protein that fail to act as a repressor thereby resulting in constitutive SOS induction [lexA(Def)] (55). The lexA(Ind−) class are dominant alleles so named for their lack of SOS induction. These alleles encode mutations that prevent autocleavage by altering the LexA cleavage site, or by altering the interaction between LexA and the RecA/ssDNA nucleoprotein filament. lexA(Def) alleles are lethal in an otherwise wild-type E. coli genetic background, a factor that complicated their original isolation (259). LexA protein represses sulA+ (also called sfiA+) (70), which inhibits cell division by blocking FtsZ ring assembly (35) . Therefore, lexA(Def) mutations must be propagated in a sulA deficient background to prevent a SulA-dependent block to cell division. The lexA(Def) mutation alone results in excessive SulA-dependent filamentation and cell death. SulA homologs are not as wide-spread as LexA homologs. For example, in Bacillus subtilis, SOS dependent cell filamentation is mediated by YneA a protein that interferes with FtsZ ring polymerization, but does not share sequence similarity to E. coli SulA (179).

These genetic studies established that RecA/ssDNA nucleoprotein filament formation activates the cryptic protease activity of LexA resulting in cleavage, and derepression of LexA-regulated genes. Although recA+ and lexA+ are the two key regulatory elements of the SOS regulon, a growing list of other proteins are involved in modulating SOS induction through positive or negative regulation of RecA/ssDNA nucleoprotein filament formation, LexA cleavage or both (for an overview of the SOS response see Fig. 1).

LexA binds to SOS boxes and inhibits transcription

In addition to genetic studies, which indicated that LexA is a negative regulator of SOS, in vitro studies have demonstrated that purified LexA protein can bind to operator sites resulting in inhibition of transcription (45, 47, 120, 218, 325, 326, 335). Comparisons of these sequences led to the discovery of a LexA binding site known as an SOS box, with a consensus sequence of TACTGTATATATATACAGTA in E. coli (120). All known SOS operators contain a 5´ CTGT consensus sequence with some preference for alternating (AT)4 sequence. Within the 5´ CTGT consensus sequence, the central T and G bases are absolutely required for LexA binding. Mutations that lead to an operator-constitutive phenotype have also been isolated, resulting in increased expression of the affected LexA controlled gene (69, 241, 402, 403). Diversity within SOS boxes contributes to temporal activation of gene expression as well as final induced levels. Induction ranges from about 100 fold in the case of sulA+, one of the most tightly repressed SOS genes, to 4–5 fold in the case of uvrA+, uvrB+ and uvrD+, ruvAB+, and lexA+ (335). Many parameters may be attributed to the differences in expression besides operator strength, such as location of operator relative to the promoter, promoter strength, and existence of additional, constitutive promoters. SOS boxes have been mapped to many locations, including overlapping with the −35 promoter region (uvrA+), between the −10 and −35 regions (recA+, uvrB+), overlapping with the −10 region (sulA+, umuDC+) as well as downstream of the transcriptional start site (uvrD+, cea+, and caa+) (120, 335) thus, allowing for a multivariable coordination of expression throughout the SOS response (for SOS box locations throughout the genome see Tables 1 and 2).

In vitro studies have shown that LexA binds to DNA as a dimer. Dimerization has proven critical for the repression of the SOS response. LexA consists of two structurally defined domains joined by a relatively flexible hinge region (227). The N-terminal domain, amino acids 1–84, specifically recognizes SOS boxes, although at a lower affinity than the intact protein (34, 161, 162, 186). The C-terminal domain is necessary for dimerization, with both intact and C-terminal fragments forming dimers in solution, with a dissociation constant <20 pM (253, 334). LexA cleavage of the Ala84-Gly85 bond located within the hinge region during SOS induction separates the two domains, inactivating LexA as a transcriptional repressor. This cleavage not only regulates LexA activity, lowering LexA’s affinity for DNA, but also LexA’s stability by exposing residues that target LexA for degradation by ClpXP protease (268) (see below: Post-Translational Regulation of SOS Induced Proteins).

VARIOUS MECHANISMS OF SOS INDUCTION

Extensive analyses have shown that several seemingly unrelated stresses result in DNA lesions that impede replication, ultimately resulting in SOS induction. Experimental evidence suggests that these lesions are processed to ssDNA leading to SOS induction through RecA/ssDNA nucleoprotein filament-mediated cleavage of the transcriptional repressor LexA. The mechanisms ultimately leading to the formation of ssDNA is not well understood for all the SOS inducing stresses. Furthermore, it is becoming more apparent that many bacterial species utilize the SOS response to promote cell survival in a variety of stressful environmental conditions.

DNA damaging agents

A myriad of DNA altering or damaging agents have been shown to induce the SOS response in E. coli including: nalidixic acid, 3’-azido-3’-deoxythymidine (AZT), nitrofurazone, mitomycin C, benzo[a]pyrene diol epoxide, hydrogen peroxide, and 4-nitroquinoline among many others (20, 131, 140, 141, 164, 270, 295, 339, 361). The lesions created by these agents (altered nucleotides, ssDNA nicks, gaps, dsDNA breaks etc.) can impede DNA replication and must be removed by DNA repair mechanisms or tolerated by using DNA damage tolerance pathways, which are integrated into the SOS circuit. However, over 1000 E. coli genes are regulated in response to mitomycin C exposure suggesting that SOS induced genes may not be sufficient for recovery after treatment (184).

High Pressure

Hydrostatic pressure was recently shown to induce a recA+, recB+, and lexA+-dependent SOS response in E. coli (3). The requirements for RecB suggests that ssDNA is formed through the processing of a double-strand break intermediate. Subsequent experiments revealed that an endogenous restriction endonuclease Mrr generates a double strand break after high pressure stress (2). The mechanism responsible for high pressure stress activation of Mrr is unknown, but represents an example of self targeted DNA restriction, a rather unusual method to manage stress. Although E. coli is not naturally subjected to high pressure environments, foods are often subjected to a combination of bacterial stresses, such as high pressure, to inactivate food-borne pathogens such as E. coli O157:H7, Salmonella, and Listeria monocytogenes (7, 66, 129, 261, 282, 412).

Antibiotics

Cell wall stress induced by treatment with β-lactam antibiotics or by compromising penicillin-binding protein 3 (ftsI+) activity induces the DpiBA two component signal transduction system in E. coli (246, 247). DpiA binds A+T rich sequences thereby preventing DnaA and DnaB activity at the origin of replication resulting in SOS induction (246). Induction of SOS leads to the transcriptional up regulation of the sulA+ gene. SulA binds to FtsZ thereby blocking FtsZ ring formation which temporarily prevents cell division and provides protection against cell death (260, 369, 401). Many recent studies suggest that the pathogens Staphylococcus aureus and Pseudomonas aeruginosa utilize the SOS response as a mechanism to promote antibiotic resistance (37, 67, 68, 232). For example, SOS induction by antibiotics not only results in increased TLS-dependent mutagenesis, but can also lead to transfer of pathogenicity islands (232, 374).

Starvation

Under starvation conditions in late stationary phase, the mechanistically controversial phenomenon known as adaptive mutagenesis is observed. An increase in-1-bp frameshift of lacZ revertants is used to measure adaptive mutagenesis. This is measured when cells are starved for lactose using a genetic system harboring F´ plasmids with an inactive lactose gene (lac) that can revert to lac+ by a specific mutation (116, 117, 315, 316, 318). The −1 frameshift reversion is dependent on DNA Pol IV encoded by the dinB gene. Several studies suggest that the SOS response is required for the increase in point mutations by DinB (54, 240). It is possible that DinB maybe induced by the production of ssDNA during F´ amplification segregation (318). However, it has also been shown that the stress regulator RpoS may result in DinB induction (226). In addition to carbon limitation, amino acid starvation also triggers the SOS response upon resumption of growth on glycerol (167).

Intracellular pH

E. coli cells regulate their intracellular pH through redox and proton pumps (276, 277). However, improper regulation can lead to SOS induction (336). The mechanism for pH induced expression of SOS regulated genes might be explained by the result that pH alters the structure of the transcriptional repressor LexA (100, 355). It has been proposed that the structurally altered LexA leads to aggregates, degradation, and ultimately a derepression of LexA regulated genes (355).

MECHANISMS GENERATING ssDNA

The major SOS inducing signal is the accumulation of ssDNA which is generated by a number of different mechanisms that ultimately result in SOS induction. During normal growth, the limited amount of ssDNA generated during DNA replication is tolerated in vivo. However, an increase in the amount of ssDNA provides a sensitive signal that requires a very low threshold for SOS induction. The most common situation that results in an increase in ssDNA occurs when the cell attempts to replicate damaged DNA (see below). However, generation of the SOS response by conversion of dsDNA to ssDNA can occur by a number of other mechanisms.

Replication of damaged DNA

Replication is required to induce the SOS response following UV irradiation. Evidence that DNA lesions were not sufficient to induce the SOS response was obtained in experiments in which a dnaC28TS derivative in a nucleotide excision repair defective genetic background was exposed to UV light (324). The dnaC28TS strain has impaired DNA replication at 42° due to its temperature sensitive helicase loader allele. When shifted to 42° after UV exposure, the uvrB dnaC28TS double mutant fails to induce SOS, implying a role for DNA replication in the induction of the SOS response (324). Furthermore, following a 70 minute shift to 42°, UV irradiated dnaC28TS cells fail to cleave LexA protein, in comparison to 70% cleavage of LexA in a wild-type strain within 10 minutes at the permissive temperature of 30° (331). These results indicate that the presence of UV lesions is not sufficient to induce SOS in cells lacking nucleotide excision repair, and that an active replication fork must attempt to replicate over DNA lesions for SOS induction to occur. A slight SOS induction does occur in dnaC28TS strains at high UV doses at the restrictive temperature, implying either that removal of lesions results in gaps that are sufficient for SOS induction (324) or that a low level of replication is supported by the dnaC28TS allele at the restrictive temperature.

Double-strand breaks are processed by RecBCD

The rate of formation of double-strand breaks under normal growth conditions is very low with 0.01 breaks detected per genome for E. coli (285). Several stresses, however, including nalidixic acid, high pressure, and gamma irradiation, result in SOS induction as the result of a dsDNA break intermediate processed to ssDNA (101, 131, 353, 361). Experimental evidence suggests that the RecBCD helicase/exonuclease degrades and unwinds dsDNA creating a 3´ ssDNA tail that induces SOS (Fig. 1) (149, 177). A crystal structure of the RecBCD enzyme suggests that, once the enzyme complex binds blunt-ended DNA, unwinding is initiated by the two helicases RecB and RecD and splits the two strands around the pin of RecC (350). RecB, a helicase and nuclease, initially degrades the 5´ tail less efficiently than the 3´ tail, which is channeled into the nuclease active site. As the 3´ tail is moved toward the nuclease active site, RecC scans the DNA and binds when it recognizes a chi (5´ – GCTGGTGG) sequence. Binding to a chi sequence prevents further degradation of the 3´ tail and allows the 5´ tail to be degraded, thus creating a 3´ ssDNA tail for RecA binding. An in vitro reconstitution assay consisting of RecA, RecBCD, SSB, and LexA recapitulated the LexA derepression of an SOS promoter in the presence of a double-stranded break on DNA containing a chi site (10).

RecFOR-mediated processing of arrested replication forks generates ssDNA

Replication forks frequently stall because of physical blocks. The formation of an activated RecA/ssDNA nucleoprotein filament in response to a replication fork encountering a physical block, such as a UV photoproduct, requires processing by the RecFOR complex (Fig.1 )(described in detail below). recF, recO, and recR are sensitive to DNA damaging agents, and exhibit delayed SOS induction (73, 305, 372). Several studies suggest that these proteins form a complex that enhance and stabilize RecA binding to ssDNA, in part through clearing SSB from ssDNA to nucleate RecA/ssDNA binding (43, 73, 256)

Furthermore, RecFOR function is required to prevent inappropriate RecQ and RecJ dependent degradation of the nascent strand at stalled replication forks. However, some RecQ and RecJ dependent processing of nascent DNA is required for replication restart following UV irradiation (73, 74). A current model, based on in vitro data, for nascent strand processing suggests that RecQ, a 3´ to 5´ helicase, unwinds template dsDNA ahead of the fork to remove impeding structures. RecQ then switches to the lagging strand and begins to unwind creating a ssDNA substrate for RecJ. Limited RecJ degradation of nascent DNA provides an area of ssDNA for RecA filament formation (154) which in turn prevents extensive DNA degradation (73).

Foreign DNA

Indirect SOS induction occurs when UV irradiated foreign DNA such as F or F´plasmids, P1, M13, bacteriophage λ, and Hfr DNA is introduced into cells (41, 42, 80, 89, 133, 317). The kinetics of SOS induction by plasmid P1 and λ are similar as measured by sulA::lac fusion expression. However, induction of SOS is markedly reduced without bacteriophage λ DNA replication, suggesting that replication of damaged DNA and subsequent processing of the lesion are necessary at least for bacteriophage λ (80).

DNA metabolism mutants

Mutations in genes encoding proteins that participate in DNA metabolism can result in SOS induction; these include dam (223, 287), dnaQ (208, 351), polA (23), priA (271, 329), and uvrD (275). Point mutants in essential genes encoding components of the replicative polymerase DNA Pol III and those necessary for chromosome segregation can also induce the SOS response. Mutants of Pol III subunits, including dnaN159 (the β processivity clamp), display a partial chronic induction of SOS due to an impaired ability to interact with the catalytic subunit (363). xerCD, div, and ftsK mutants suffer from a more acute induction after the dividing septum shears chromosomes that fail to properly segregate (152, 219). Single cell studies of mutants expressing SulA::GFP suggests that in the case of DNA metabolism mutants, SOS induction only occurs in a subpopulation. In contrast, SOS induction in lexA(Def) mutants occurs uniformly in all cells within the culture (238), an issue that is discussed below in more detail (please see Single Cell Analysis of the SOS Response). It was suggested that SOS induction occurs in a subpopulation of the DNA metabolism mutants because the cell has several pathways to process DNA intermediates. The non-induced cells may not have experienced enough DNA damage or the cell utilized a pathway that does not require the mutated gene product for repair (238).

Decreased nucleotide pools result in SOS induction

Exposing E. coli cells to hydroxyurea, a specific inhibitor of ribonucleotide reductase, decreases the intracellular concentration of dNTPs resulting in replication fork pausing and SOS induction (20). RecA, SulA, and λ prophage induction as a result of hydroxyurea exposure is RecBC-independent. Although RecA requires ATP for LexA cleavage, intracellular ATP pools are not a limiting factor for SOS induction (20, 213, 383). Survival during nucleotide starvation is enhanced by the SOS regulated Y-family polymerases UmuC and DinB (138), possibly due to their higher affinity for dNTPs as compared with Pol III. Interestingly, in the opportunistic pathogen Serratia marcescens, hydroxyurea treatment results in the LexA-dependent induction of an exocellular nuclease scavenging pathway (166).

STRUCTURAL INSIGHTS INTO RECA/DNA NUCLEOPROTEIN FILAMENT

Structural data is available for both the E. coli (Fig. 2) and an inactive compact M. smegmatis complex with a bound nucleotide between RecA monomers (84–86, 358–360) showing 6 RecA monomers per turn (Fig. 2). Furthermore, conserved residues in all bacterial RecA proteins lie along the RecA monomer interface, highlighting their importance for filament formation. The recent advances in optical techniques have allowed for the real time visualization of RecA or Rad51 polymerization on ssDNA and suggest that nucleation is the rate limiting step (127, 170, 292). A reconstruction of electron micrographs with RecA bound to dsDNA in the presence of LexA has also been generated (418). These results show that LexA is bound to a deep groove of the RecA/dsDNA (418). LexA contacts two adjacent RecA monomers within the 61 helical structure composed of 6 RecA monomers. These studies have collectively provided a picture of how RecA and RecA-like proteins form filaments on DNA in vivo.

Fig. 2. Model of the RecA filament.

Fig. 2

Using electron microscopy, a model of the RecA filament was generated that positions the ATP between RecA subunits. A. The RecA filament is shown to display the DNA binding channel (left) and then subsequently turned 90º (right). B. An ATP molecule (shown) binds at the interface of two RecA subunits, positioning it to explain the cooperative nature of ATP hydrolysis observed for RecA-DNA filaments. Conserved residues in bacterial RecA proteins (green) are positioned along the subunit interface near the ATP binding pocket. The figure was generated using PyMOL and PDB file 1N03 (379, 380)

RecA MODULATING PROTEINS

Proteins RecX, DinI, PsiB, RdgC, RecFOR, SSB, RecBCD, HU and UvrD affect the formation or disassembly of RecA/ssDNA nucleoprotein filaments, thereby modulating the magnitude of the SOS response (Fig. 1). In this section we will discuss the current view of how these proteins affect SOS and direct readers to reviews that provide an in-depth view of how these proteins regulate RecA-mediated repair.

Antagonistic functions of RecX and DinI modulate the stability of RecA filaments

RecX prevents RecA/ssDNA nucleoprotein filament extension, thereby decreasing SOS induction (357). In contrast, DinI stabilizes the filament, increasing SOS induction (413–415). RecX is an SOS induced gene product that caps the RecA filament, preventing polymerization (98, 99, 379). In vivo, RecX overexpression decreases SOS induction in some bacteria (362, 381) and in Mycobacterium smegmatis, overexpression of MsRecA is toxic in the absence of MsRecX (279, 280). However, recX E. coli strains fail to show an observable phenotype, suggesting that any RecX effect in E. coli is subtle (278, 357). It should be noted here that RecF has an inhibitory affect on RecX (228). RecF interacts with RecX and prevents RecX from exerting a negative affect on RecA (228).

The SOS-regulated DinI protein binds to and stabilizes RecA/ssDNA nucleoprotein filaments (206, 413, 414). In addition to this function, DinI interferes with UmuD cleavage to UmuD´ (269, 366, 367, 386). As discussed previously, the differential affinity of LexA for SOS boxes allows for genes to be turned on early or late in the SOS response. DinI is expressed early in SOS to stabilize RecA/ssDNA nucleoprotein filaments and may thus inhibit UmuD cleavage, thereby delaying mutagenic TLS and allowing for higher fidelity repair to take place prior to lower fidelity TLS (182, 413, 415). The affect of DinI on RecA and UmuD is an excellent example of how many different layers of regulation help make the E. coli SOS response a sophisticated physiological response to genotoxic stress.

Recently, RecA has been fused to green fluorescent protein (GFP) to visualize localization during normal growth and following challenge with DNA damaging agents. These experiments have revealed that the appearance and longevity of RecA-GFP foci (185, 307, 348) are altered by the absence of both dinI and recX (308). These experiments show that although the phenotype of dinI and recX strains is subtle, the absence of these proteins affects RecA-GFP focus formation in vivo.

PsiB limits SOS induction during plasmid conjugation

PsiB protein, expressed from conjugative plasmids including F and IncN, is a potent inhibitor of the SOS response (15, 16, 18, 103, 142). During conjugation the psiB gene is located in the leading region of DNA that is transferred allowing for early expression in the recipient cell (15). The transferred ssDNA in principle could be considered “excess” and results in RecA binding and SOS induction. The early expression of PsiB protein prevents induction of the SOS response. Although the mechanistic details of this inhibition remain to be elucidated, the current model postulates that PsiB interferes with RecA function [for review (76)].

RdgC competes with RecA for binding and inhibits LexA cleavage in vitro

Recombination-dependent growth (RdgC) is a DNA binding protein that binds both single and double stranded DNA, prevents RecA function by competing for binding sites on DNA (97, 323). The crystal structure of the RdgC dimer suggests dsDNA binding takes place in the central hole of the ring-shaped dimer (50). Binding of RdgC has been shown in vitro to inhibit RecA-dependent cleavage of LexA (97). Genetic experiments have demonstrated that the rdgC+ gene product is required for viability in priA mutant strains, which are deficient for replication fork restart (255). recF, recO, or recR mutants alleviate the growth phenotype of a rdgC strain, suggesting that RdgC might function in blocking aberrant RecA loading in certain genetic backgrounds (255).

RecFOR, SSB, RecBCD and HU influence RecA’s access to ssDNA

An underlying theme in this section is that SOS induction is mediated by RecA filament formation. The RecFOR, SSB and RecBCD proteins all influence SOS by affecting the accumulation of ssDNA in vivo. As mentioned above, the RecFOR proteins stimulate the loading of RecA onto ssDNA generated during replication of damaged templates (150, 151, 158, 320, 321, 328). E. coli strains that lack RecFOR function are delayed for SOS induction (231, 404). Genetic experiments have demonstrated that these proteins are in the same epistasis group, (328) and biochemical studies have shown that RecO and RecR, or RecFOR load RecA onto SSB covered ssDNA in purified enzyme assays (43, 338, 376, 377).

In undamaged cells, single strand binding protein (SSB) affects SOS induction by outcompeting RecA for ssDNA at the replication fork, thereby preventing SOS induction (43, 197, 202). There are approximately 7500–15,000 RecA monomers in E. coli when the SOS response is repressed (331, 357). In log phase cultures there are approximately 7000 SSB monomers (∼1750 tetramers), an in vivo observation suggesting that SSB must have a stronger affinity for ssDNA to allow for normal replication to proceed in undamaged cells (382). Indeed, SSB has a strong affinity for ssDNA and SSB prevents RecA binding to ssDNA in vitro (43, 338, 376, 377). It has also been shown in vitro that RecA will only displace prebound SSB from ssDNA if RecO and RecR are added to the reaction (43, 155, 338, 376, 377). In limited circumstances, SSB can aid in RecA filamentation by removing hairpins (or other secondary structures) from ssDNA (197).

As previously discussed, the RecBCD helicase/nuclease enzyme can have a positive affect on SOS induction. E. coli RecBCD and B. subtilis AddAB are enzymes that process double-strand breaks to yield a 3´ ssDNA segment that is required for RecA filament formation (9, 11, 64, 65, 92, 350).

Many bacteria, including E. coli, contain the histone-like protein HU. HU is a heterodimer composed of Hupα and Hupβ (172–175). HU is important for maintenance of DNA topology involved in several aspects of DNA metabolism, including replication initiation (38, 39). Although HU binds DNA non-specifically, HU binds to both recombination and replication intermediates with a higher affinity than it has for B-form DNA. Strains deficient for both the hupA and hupB genes show sensitivity to both UV and ionizing radiation. There are two possible reasons for this. One report shows that HU is important for SOS induction (252). A second report has shown the possibility of a direct role for HU in DNA repair. This report describes that HU binds preferentially to AP sites and contains AP lyase activity (196). However, more experiments are required to understand mechanistically how HU contributes to SOS.

POST-TRANSLATIONAL REGULATION OF SOS INDUCED PROTEINS

The SOS response is also regulated by post-translational protein modification. Interestingly, some of the first insights into regulation of the SOS response by post-translational modifications came from studies on λ prophage, which can induce its lytic cycle upon sensing ssDNA. Early work by Roberts and colleagues demonstrated that exposure of λ lysogens to UV-irradiation or mitomycin C results in a RecA-dependent cleavage of λcI, a repressor of phage lytic genes, resulting in induction of the lytic cycle. Experiments using recA(Def) and λcI(Ind−) strains suggested that λcI cleavage activates expression of phage genes and that RecA acts as a regulator of the protease or was the protease itself (309). Subsequent studies established that λcI is cleaved between the Ala111-Gly112 bond generating two nearly equal proteolytic fragments in an ATP/ssDNA dependent reaction (78, 79, 157, 332). This cleavage prevents the formation of a λcI homodimers that bind to λ operator sequences because the cleavage separates the operator binding domain and the dimer interface domain (217). These results led to the conclusion that RecA is activated for an ATP-dependent role in λ repressor cleavage when bound to ssDNA in a ternary complex. The ternary complex, the RecA/ssDNA nucleoprotein filament, is now understood to be a co-protease required to induce and stabilize a conformational change in λcI that brings the self-cleavage site in close proximity to the serine protease active site (187, 267).

As described earlier in this chapter, SOS controlled genes are induced when the LexA repressor undergoes an autoproteolytic cleavage event similar to that of λ repressor. Like λ repressor, the cleavage of LexA is facilitated by the RecA nucleoprotein filament on ssDNA (46, 157, 213, 214, 217, 218). Experiments using extracts from cells containing radiolabeled LexA demonstrated that the protein is cleaved nearly in half. The cleavage of the 22.7 kDa protein occurs between the Ala84-Gly85 bond, and the kinetics suggest a more rapid cleavage event than λ phage (157, 218). In vivo, the half-life of LexA is approximately 1 hour in uninduced cells, however, cleavage begins one minute after UV exposure and is complete within 5 minutes. The in vitro kinetics of LexA cleavage are first order and are independent of protein concentration suggesting an intramolecular reaction with respect to the homodimer (331).

The domains necessary for RecA-mediated cleavage and autodigestion are located in the C-terminal domain of LexA (Fig. 3). Indeed, crystal structure analysis of the LexA C-terminus suggests that the protein exists in two states, non-cleavable and cleavable (227, 393). In the non-cleavable form, the cleavage site is positioned 20 Å away from the Ser-Lys dyad cleavage active site. In the cleavable conformation, the Ala84-Gly85 bond is positioned to participate in the autoproteolytic cleavage reaction catalyzed by the Ser-Lys dyad. In the Ser-Lys dyad model of LexA cleavage, the uncharged Lys156 removes a proton from Ser119 creating a nucleophile to attack the Ala84-Gly85 bond (209, 210, 306, 311). Isolation of lexA(IndS) mutants that increase the rate of LexA cleavage support the existence of two LexA structural conformations in vivo (312, 352). These results suggest that the RecA nucleoprotein filament does not participate directly in the proteolysis reaction, but instead induces a conformational change favoring LexA cleavage. For this reason RecA is termed a co-protease. In addition to the co-protease activity of RecA, full induction of the SOS response is ensured by ClpXP mediated degradation of LexA fragments preventing repressor activity mediated by the LexA N-terminal fragment (268).

Fig. 3. Structural analysis of post-translationally modified SOS proteins reveals catalytically competent and non-competent protein conformations.

Fig. 3

LexA (A) and UmuD (B) proteins undergo a large rearrangement from a non-cleavable conformation (NC) to a cleavable conformation (C). A. LexA crystal structures indicate that the Ala84-Gly85 residues (purple) can be positioned 20 Å away from Lys156 (green) and Ser119 (orange) in the NC form (left) to a position allowing for an autoproteolytic cleavage event in the cleavable form (right) (227). B. Full length models of the non-cleavable (left) and cleavable (middle) UmuD2 dimer. The N-terminal arms of UmuD2 (purple) fold to present the cleavage site (C24 purple spheres) to Ser60 (orange) and Lys97 (blue) (compare left and middle). NMR data suggest that after the cleavage event forming UmuD’2 (right), the dimer undergoes a significant conformational change that consequently alters cellular activity (112, 284, 365).

UmuD also undergoes a similar Ser-Lys dyad catalyzed proteolysis event (Fig. 3) that regulates TLS and a DNA damage prokaryotic checkpoint (see Bacterial Cell Cycle Checkpoints). The catalytic core of UmuD shares structural homology to LexA and forms homodimers in solution (112, 284, 365). Like LexA, the proteolysis event is catalyzed by a Ser60-Lys97 dyad that is within hydrogen bonding distance with the cleavage site, Cys24-Gly25, in the presence of the RecA co-protease (53, 284, 341). Unlike LexA, UmuD structural studies support an intermolecular reaction due to the N-terminal arms folding in such a way as to then cleave sites in close proximity to the Ser-Lys dyad of the partner in the homodimer (365). The UmuD2 proteolysis event, removes the unstructured N terminal 24 amino acids generating UmuD′2. After cleavage the new N-terminus is able to move more freely and a large conformational change occurs presumably activating the protein for TLS (168, 284).

IDENTIFICATION OF GENES IN SOS NETWORK

To understand the breadth of E. coli responses to DNA damage, a genetic approach was used in a systematic search for genes induced as part of the SOS network. The Mu d1 bacteriophage (59), which generates chromosomal operon fusions to lacZ, was used to create a set of random transcriptional fusions. These fusion strains were screened for genes that expressed a higher level of β-galactosidase when treated with UV or mitomycin C (MMC). From this experiment a set of din (damage inducible) genes were isolated (182), whose expression was not detected in genetic backgrounds containing recA (Def) and lexA (Ind−) alleles. Later genetic and biochemical studies showed that LexA was the direct repressor of the din genes (181). This technique was also used in a more directed experiment to generate fusions to genes suspected to be controlled by the SOS regulon. Such genes include uvrA+ (183), uvrB+ (115, 183), sulA+ (160), umuDC+ (17), uvrD+ (12, 345), himA+ (250), ruvA+ and ruvB+ (344), recA+ (60) and recN+ (222). At the time this chapter was written, 57 genes have been shown to be repressed by LexA (Table 1).

A computational search for LexA regulated genes was enabled by identifying a consensus sequence for the LexA box and the complete genome sequence of E. coli (113). In this study, LexA regulated genes were identified by searching the E. coli genome for potential LexA binding sites. These LexA regulated genes were then verified to be damage inducible, and LexA regulated in vivo. This work also showed that LexA bound several of these promoter regions in vitro (113).

While lacZ transcriptional fusions, and computational analysis were important breakthroughs in understanding the genes that comprise the SOS response, microarrays and chromatin immunoprecipitation followed by microarray analysis (ChIP-on-chip) now serve as a high-throughput method for monitoring changes in gene expression, and promoter occupation by LexA (75, 388). One microarray analysis (75) examined changes in gene expression following UV irradiation in wild-type and lexA(Ind−) genetic backgrounds. These results confirmed the induction of known lexA+ regulated genes, and also identified 17 previously unidentified lexA+ regulated genes. In addition, genes up-regulated by a lexA+-independent mechanism and genes down regulated in response to SOS induction were also identified. Transcripts expressed independently of LexA can be explained by downstream or secondary affects of genes regulated directly by LexA. For example, LexA may repress a gene that is required to regulate expression of a second gene. It is still unknown if transcripts downregulated by UV irradiation occur through a lexA+- dependent or independent mechanism. Other microarray studies have examined the transcriptional response to UV and mitomycin C (184, 296).

While it has been known for many years that LexA acts as a transcriptional repressor of the SOS response, recent studies suggest that sole repression of the SOS response by LexA may be an over-simplification. The SOS regulatory system has been used to construct synthetic gene networks, and in E. coli some lexA+ regulated genes have been shown to have another regulatory component (130, 193). For example, the dinB+ gene is a member of the SOS regulon, which is repressed by lexA+, but its expression is also regulated by the stress response sigma factor RpoS, thereby inducing dinB+ transcript levels in stationary phase independently of LexA (203).

Similar efforts have been made to characterize the SOS response in a variety of other bacteria [for review (110)]. Microarray data show that B. subtilis contains a recA+/lexA+-dependent SOS system, although only 8 genes out of 62 induced by the SOS have analogous counterparts in E. coli (13). Interestingly, studies in Mycobacterium tuberculosis and Myxococcus xanthus imply both a lexA+-dependent and an uncharacterized lexA+- independent mechanism for induction of the DNA damage response (57, 302).

SINGLE CELL ANALYSIS OF THE SOS RESPONSE

The application of fluorescent microscopy to SOS studies has demonstrated the limitations of measuring SOS induction at the population level in cultures (51, 238). For example, when β-galactosidase activity is measured in cell culture using a lacZ transcriptional fusion to an SOS regulated promoter, the results represent a population average. In such experiments, it had not been clear if a given promoter’s activity is similar in every cell or differentially expressed in subpopulations of cells (182, 324, 331). These models have been described as the “uniform expression model” or the “two population model,” respectively (238). To determine SOS induction at the single cell level, gfp+ was fused to the SOS regulated sulA+ promoter. GFP fluorescence was measured in a comprehensive set of genetic backgrounds that have previously been shown to result in chronic SOS induction. Analysis of these results led to the conclusion that the “two population model” can explain most strains deficient or conditional for genes involved in DNA metabolism. The exception to this conclusion are strains deficient for lexA+ or recA+ because these cells are either never induced or induced constitutively giving a uniform gene expression pattern (238).

SOS MUTAGENESIS

Mutagenesis, induced by UV as well as a variety of chemical agents, is an active process (105, 120, 221, 262, 390–392, 408). This active cellular process involves specialized DNA polymerases, which are capable of inserting nucleotides opposite a misinstructional or noninstructional lesion, allowing continuation of replicative DNA synthesis. These polymerases, termed translesion DNA polymerases are the main contributors to the process referred to as SOS mutagenesis, error-prone repair, SOS repair, misrepair, and SOS processing. UV induced mutagenesis can be blocked by certain lexA and recA alleles, implying a role for SOS induced gene products in SOS mutagenesis (49, 258, 395, 405, 406).

UmuD´2C (Pol V)-dependent mutagenesis

A screen for non-mutable E. coli strains lead to the discovery of the umuD+ and umuC+ genes. umuD+ and umuC+ are located in an operon, within the SOS regulon, and encode proteins with molecular weights of 15,000 and 45,000 Da respectively (107, 342). UmuD protein is present at ∼180 copies per uninduced lexA+ cell and ∼2,400 copies per lexA(Def) cell (411). The levels of UmuC protein in a lexA(Def) background is ∼200 molecules per cell and was too low to be measured under non-SOS induced conditions (411). UmuD forms dimers, which undergo RecA mediated autocleavage, to form UmuD'2 homodimers. It is these UmuD'2 homodimers that function together with UmuC to form the active version of E. coli TLS polymerase Pol V (UmuD´2C). Deletion of either the umuD+ or umuC+ genes abolishes the mutagenic affect of a wide-variety of agents including: UV, 4-nitroquinoline-1-oxide, and methyl methanesulfonate (88, 107, 120, 178, 342, 356, 391, 400, 407, 408). Strains defective in umuC or umuD, however, retain the ability to be mutated by certain agents including the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). MNNG generates O6-methylguanine which has the potential to result in direct mispairing during replication because O6-methylguanine can pair with either C or T. Although umuD or umuC strains are UV sensitive, it is a modest phenotype, and not nearly as sensitive as uvr mutants. In addition, Pol V dependent mutagenesis requires RecA to regulate the cleavage of UmuD to UmuD´ (24, 53, 269, 341, 368). Recent results have shown that two RecA molecules are important for mediating Pol V lesion bypass (289, 333). Taken together, RecA and Pol V collaborate to form a complex capable of lesion bypass. Finally, the molecular chaperones GroES and GroEL are required for Pol V dependent UV induced mutagenesis possibly functioning to help stabilize UmuC by facilitating correct folding (94, 95, 220). Consistent with this conclusion, the half-life of UmuC decreases in groE strains (95).

DinB (Pol IV)-dependent mutagenesis

Another E. coli TLS polymerase, Pol IV, encoded by dinB+, was identified among a series of damage inducible (din) genes and plays a role in SOS mutagenesis (182). DinB has a molecular weight of ca. 40,000 Da, and is present at ∼250 molecules per lexA+ cell and ∼2500 molecules per lexA(Def) cell (189). While dinB phenotypes have been more elusive than those of umuDC, dinB+ is required for λ untargeted mutagenesis. Untargeted mutagenesis of bacteriophage λ DNA is observed when UV irradiated E. coli are transfected with unirradiated λ phage (52). DinB is also important for adaptive mutagenesis. Adaptive mutagenesis has been measured using reversion of a −1 frameshift in a lacI lacZ fusion. In this assay, cells are plated on minimal lactose medium, under non-lethal selection, resulting in the appearance of lac+ revertants over several days (153). Although the mechanism by which adaptive mutations occur is controversial, it is clearly DinB-dependent, because dinB strains result in a 5–10 fold reduction in adaptive mutants (153). DinB activity is modulated by a host of other proteins in vivo (389). In particular, RecA, UmuD and UmuD´ have been shown to regulate the −1 frameshift activity of Pol IV in vivo and in vitro (137). These results demonstrate that RecA, UmuD and UmuD´ act as accessory factors for Pol IV, modulating the mutagenic capability of this polymerase. Furthermore, DinB allows for resistance to N2-dG adducts including N2-furfuryl-dG (169). It was shown that DinB preferentially bypassed N2-furfuryl-dG with higher proficiency than an undamaged dG, suggesting that DinB homologs are specialized for bypass of bulky N2-dG adducts in vivo (169).

Pol II-dependent mutagenesis

DNA Pol II is encoded by the polB+ (or dinA) gene, which is damage inducible (40, 294). Pol II translesion synthesis is often accurate across from 3, N(4) ethenocytosine adducts (5) and Pol II efficiently bypasses abasic as well as interstrand crosslinks (32, 176). Pol II contains the 3´–5´ proofreading exonuclease activity present in high fidelity polymerases, yet Pol II can be mutagenic. A rather striking observation is that Pol II is more mutagenic at AT rich sites rather than in GC rich sites which is unexpected for a proofreading polymerase (398). It was reasoned that Pol II has a preference for extension in AT-rich sequences owing to the higher mutation frequency (398).

Also, challenge of E. coli with N2-acetylaminofluorene (AAF) results in −1 and −2 frameshift mutagenesis by both Pol II and Pol V (265). Although this review does not cover the topic of replication fork restart, it should be noted that Pol II has an established role in this process. The action of Pol II is coordinated with primosomal protein PriA and the RecFOR proteins (303–305).

BACTERIAL CELL CYCLE CHECKPOINTS

Cell cycle checkpoints have been well studied in eukaryotic organisms because of their importance in understanding cell cycle regulation and the clear links between the bypass of checkpoints and the development of cancer (14, 224, 301, 397). E. coli spatially regulates the cell cycle, i.e. DNA replication can occur at the ¼ and ¾ positions in the cell while cell division mechanisms occur at mid-cell (136, 200, 235, 319, 322, 340). This spatial separation of cell cycle events allows for initiation of a new round of replication before the previous round has completed (71, 93). The spatial regulation also allows arrest of certain cell cycle processes, but not necessarily arrest of all cell cycle processes (118). The lack of temporal cell cycle stringency has resulted in qualifying prokaryotic checkpoints as: ‘primitive checkpoints’ and ‘checkpoint-like’(48, 119, 273, 367).

The purpose of checkpoints, in both eukaryotes and prokaryotes, is to maintain genomic integrity and avoid cell death by preventing the overlap of cell cycle events. The cell is particularly vulnerable to loss of genomic integrity at ssDNA regions near stalled replication forks. Furthermore, formation of the RecA/ssDNA nucleoprotein filament results in the induction of prokaryotic checkpoints that prevent overlap of cell cycle events. The DNA damage, and cell division checkpoints are regulated by the SOS response specifically by inducing the umuDC+ and sulA+ (273, 369) gene products. Like their eukaryotic counterparts, these gene products are not necessary for the cell cycle events themselves but enforce proper execution, which is especially important following DNA damage.

The SulA-dependent DNA damage prokaryotic checkpoint

Expression of the cell division inhibitor SulA (also sfiA+) is controlled by LexA and is up regulated following DNA damage. SulA directly prevents cell division by binding to FtsZ (35, 72, 369). FtsZ, a tubulin homolog, forms a ring at midcell (Z-ring) providing a scaffold for other cell division proteins to bind and promote cytokinesis (401). X-ray crystallography data shows that SulA binds to FtsZ as a dimer (72). This direct interaction presumably prevents FtsZ polymerization into a Z-ring, thereby acting as a prokaryotic cell division checkpoint. The block to septation results in the formation of cellular filaments, cells that continue to grow but fail to divide, and was one of the first phenotypes observed in SOS induced cells.

The presumed purpose of the SulA-dependent checkpoint is to prevent distribution of damaged chromosomes to daughter cells. This allows sister chromosomes to be used for homologous recombination pathways that can be used to repair double-strand breaks and to tolerate DNA lesions. In addition, SulA helps temporally coordinate repair functions and cell division. Without proper coordination, nucleoids can be guillotined, meaning that the cell division plane closes on unsegregated chromosomes resulting in a double-strand break. This phenotype is observed in xerCD, div, ftsK and sulA mutants (30, 219, 394, 401). As mentioned above, FtsK is an SOS inducible ATP-dependent DNA pump that is required for cell division and chromosome localization under normal growth conditions. However, increased resistance to UV radiation and mitomycin C exposure have been observed after over-expression of FtsK (394). The mechanism for FtsK mediated increase in survival is not known.

The UmuDC-dependent DNA damage prokaryotic checkpoint

A model for a umuDC+-dependent prokaryotic checkpoint was proposed on the basis of studies demonstrating cold sensitivity caused by UmuDC+ overexpression (236, 237). UmuDC’s role in this cold-sensitive growth phenotype is distinct from UmuDC’s role in SOS mutagenesis (237, 274). A umuD missense mutation (S60A) results in a noncleavable UmuD that prevents SOS mutagenesis, but has no adverse effect on UmuDC+-mediated cold sensitivity (274). Subsequent experiments with umuD (S60A) revealed that expression of the noncleavable UmuD protein resulted in increased survival following UV irradiation and a modest decrease in DNA replication in a uvr+-dependent manner (273). The increase in UV resistance and a decrease in DNA replication occurred despite the inability of a noncleavable UmuD to participate in translesion synthesis. In addition, kinetics of UmuD cleavage to UmuD´ was comparable to the kinetics of UV-induced lesion removal by UvrA, and the kinetics of cleavage was UV dose dependent.

These observations led to the umuDC+-dependent, DNA damage prokaryotic checkpoint model in which UmuD has two distinct roles. First, the UmuD2 dimer in complex with UmuC delays the recovery of DNA replication and cell growth after DNA damage possibly by inhibiting Pol III at replication forks. This DNA damage checkpoint allows accurate repair of DNA damage before replication is attempted. If accurate repair mechanisms are insufficient, the eventual RecA-mediated cleavage of UmuD2 to UmuD´2 then permits UmuD´2C (DNA Pol V) to carryout TLS over any remaining damage (273).

The umuDC+ DNA damage checkpoint model suggests that both UmuD2C and UmuD2´C have access to the replication fork and slow or arrest Pol III. Indeed, UmuD and UmuD´ have been shown to interact with various subunits of the Pol III holoenzyme (364). Affinity chromatography has shown that UmuD2 has a greater affinity for the β processivity clamp than does UmuD´2. In contrast, UmuD´2 interacts more strongly than UmuD2 with the catalytic subunit, while both proteins interact equally with the epsilon proofreading subunit. Subsequent genetic analysis demonstrated that co-overexpression of β or epsilon with UmuDC abrogated the cold-sensitive phenotype (366).

INDUCIBLE GENE EXPRESSION INDEPENDENT OF THE CLASSICAL SOS REGULON

It has become increasingly clear that many bacteria mount a robust transcriptional response to DNA damage independently of recA+ and lexA+. Although a large proportion of the DNA damage-inducible genes in E. coli and B. subtilis are regulated by recA+ and lexA+ others are not, Table 1 (75, 144, 184). In both of these organisms, many genes that lack an identifiable SOS box are expressed following challenge with DNA damaging agents in lexA (Ind−) or recA strains. In E. coli, transcription of approximately one third of the open reading frames in the genome is altered following mitomycin C challenge (184). This could be explained by the fact that mitomycin C is not specific for DNA and it reacts with other cellular components including proteins contributing to alterations in gene expression. Other DNA damaging agents such as UV irradiation are much more specific for DNA (102) and it is this difference that likley accounts for the gene expression data that was observed following challenge with MMC. In B. subtilis, the expression of 668 genes is altered following replication fork arrest with HPUra, 500 of which are regulated by recA+ and/or lexA+ (144). Most of these 500 genes are thought to be regulated indirectly since SOS boxes are located upstream of only a subset of these genes.

DnaA protein is required for the initiation of DNA replication and it acts as a transcription factor. DnaA is an example of a transcription factor that affects gene expression in response to DNA damage and replication fork arrest independent of the lexA and recA genes. In B. subtilis, DnaA regulates 12 genes following treatment with mitomycin C and 57 genes following replication fork arrest with the selective replicative polymerase inhibitor HPUra (13, 143, 144).

Microarrays have been used to characterize the DNA damage response in several bacteria including: Mycobacterium tuberculosis, Myxococcus xanthus and Bdellovibrio bacteriovarus. These studies have shown that damage-inducible gene expression, in these species can also occur independently of the recA+ or lexA+genes (57, 58, 87, 302). Taken together, the transcriptional response to DNA damage encompasses more than just lexA+ recA+ regulated genes.

THE DNA DAMAGE RESPONSE REGULATES VIRULENCE FACTORS

In several pathogenic bacteria, mobile genetic elements encode virulence factors. In addition, many of these elements are regulated by the DNA damage response [for review (180)]. In Staphylococcus aureus, bacteriophage φ11 and 80α are under control of SOS (139, 232, 233, 373–375). Replication and transfer of these phages results in horizontal gene transfer of virulence factors (373). Vibrio cholerae contains SXT, an integrative conjugative element (ICE) that contains several genes encoding antibiotic resistance to chloramphenicol, trimethoprim, streptomycin and sulphamethoxazole. Transfer of SXT is regulated by the DNA damage response (25–28, 156). The element encodes SetR which interacts with the RecA/ssDNA nucleoprotein filament resulting in cleavage of SetR. SetR normally represses the expression of several activators that are required for SXT transfer. RecA/ssDNA cleavage of SetR thereby alleviates repression of the activators necessary for transfer of the element (27, 28). V. cholerae also encodes CTXφ, a temperate filamentous phage that encodes cholera toxin (298, 299). LexA cleavage through interaction with RecA/ssDNA nucleoprotein filament is required for CTXφ induction. The LexA binding site overlaps with the promoter region recognized by the alpha C-terminal domain of RNA polymerase preventing gene activation (298).

In enteropathogenic E. coli, the locus of enterocyte effacement (LEE) is SOS regulated and responds to positive regulation by Ler and negative regulation by LexA (243). The LEE locus also encodes the type III secretion system responsible for secretion of virulence-associated factors into host cells. The components of the type III secretion are encoded by the divergently transcribed LEE2 and LEE3 operons contained within LEE (108). LexA occupies the divergent promoter region repressing transcription of LEE2/3 (243). Furthermore, the expression of LEE2/3 requires a cleavable LexA. These examples demonstrate that the DNA damage response regulates the dissemination of antibiotic resistance genes, genes encoding the cholera toxin, and the type III secretion system in some bacteria.

CONCLUSIONS

The SOS response in E. coli is a complex genetic circuit that allows cells to sense damage to their genetic material and respond with both high and low fidelity repair. This chapter highlights many experiments that have shaped our understanding of the SOS response in E. coli and other organisms. We hope that readers have gained not only an appreciation for what is known about the response, but also an appreciation for the complexity of this response and the work that has yet to be done. Two of the major challenges will be to understand how cells coordinate DNA damage recognition with DNA replication, and the second will be to provide a structural basis for how protein-protein interactions contribute to regulation of the pathway. Other challenges in understanding the SOS response in E. coli will be to determine how the SOS response is coordinated with other physiological responses.

The analysis of SOS in other bacteria has opened an entirely new area of investigation. We think it is clear that many gram-positive and gram-negative bacteria respond to DNA damage by affecting gene expression, but the specific genes affected vary considerably from organism to organism. Detailed examination of SOS in a variety of bacterial species will considerably add to our knowledge of the mechanisms regulating SOS and the genes under SOS control. These studies will help determine how the SOS circuitry is plugged into other gene networks that allow for a given bacterium to thrive within it’s niche.

ACKNOWLEDGEMENTS

We would like to acknowledge and recognize the tireless efforts of all the laboratories around the world that have studied the SOS response over the last 50 years. We would like to thank Dr. John W. Foster and two anonymous reviewers for their comments that have strengthened this chapter. We also apologize to our colleagues for not being able to cite all of the papers that have contributed to our understanding of the SOS response. This work was supported by a NCI grant CA21615 to G.C.W, National Institute of Environmental Health Sciences grant P30 ES002109 and an American Cancer Society Research Professorship to G.C.W. A postdoctoral fellowship from NCI supported L.A.S.

REFERENCES

  • 1.Adams RL, Burdon RH, MacKinnon K, Rinaldi A. Stimulation of de novo methylation following limited proteolysis of mouse ascites DNA methylase. FEBS Lett. 1983;163:194–198. doi: 10.1016/0014-5793(83)80817-5. [DOI] [PubMed] [Google Scholar]
  • 2.Aertsen A, Michiels CW. Mrr instigates the SOS response after high pressure stress in Escherichia coli. Mol Microbiol. 2005;58:1381–1391. doi: 10.1111/j.1365-2958.2005.04903.x. [DOI] [PubMed] [Google Scholar]
  • 3.Aertsen A, Houdt RVan, Vanoirbeek K, Michiels CW. An SOS response induced by high pressure in Escherichia coli. J Bacteriol. 2004;186:6133–6141. doi: 10.1128/JB.186.18.6133-6141.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Aksenov SV. Dynamics of the inducing signal for the SOS regulatory system in Escherichia coli after ultraviolet irradiation. Math Biosci. 1999;157:269–286. doi: 10.1016/s0025-5564(98)10086-x. [DOI] [PubMed] [Google Scholar]
  • 5.Al Mamun AA, Humayun MZ. Escherichia coli DNA polymerase II can efficiently bypass 3,N(4)-ethenocytosine lesions in vitro and in vivo. Mutat Res. 2006;593:164–176. doi: 10.1016/j.mrfmmm.2005.07.016. [DOI] [PubMed] [Google Scholar]
  • 6.Alberts BM, Amodio FJ, Jenkins M, Gutmann ED, Ferris FL. Studies with DNA-cellulose chromatography. I. DNA-binding proteins from Escherichia coli. Cold Spring Harb Symp Quant Biol. 1968;33:289–305. doi: 10.1101/sqb.1968.033.01.033. [DOI] [PubMed] [Google Scholar]
  • 7.Alpa H, Kalchayanand N, Bozoglu F, Ray B. Interactions of high hydrostatic pressure, pressurization temperature and pH on death and injury of pressure-resistant and pressure-sensitive strains of foodborne pathogens. Int J Food Microbiol. 2000;60:33–42. doi: 10.1016/s0168-1605(00)00324-x. [DOI] [PubMed] [Google Scholar]
  • 8.Andersen PS, Smith JM, Mygind B. Characterization of the upp gene encoding uracil phosphoribosyltransferase of Escherichia coli K12. Eur J Biochem. 1992;204:51–56. doi: 10.1111/j.1432-1033.1992.tb16604.x. [DOI] [PubMed] [Google Scholar]
  • 9.Anderson DG, Kowalczykowski SC. The recombination hot spot chi is a regulatory element that switches the polarity of DNA degradation by the RecBCD enzyme. Genes Dev. 1997;11:571–581. doi: 10.1101/gad.11.5.571. [DOI] [PubMed] [Google Scholar]
  • 10.Anderson DG, Kowalczykowski SC. Reconstitution of an SOS response pathway derepression of transcription in response to DNA breaks. Cell. 1998;95:975–979. doi: 10.1016/s0092-8674(00)81721-3. [DOI] [PubMed] [Google Scholar]
  • 11.Anderson DG, Kowalczykowski SC. The translocating RecBCD enzyme stimulates recombination by directing RecA protein onto ssDNA in a chi-regulated manner. Cell. 1997;90:77–86. doi: 10.1016/s0092-8674(00)80315-3. [DOI] [PubMed] [Google Scholar]
  • 12.Arthur HM, Eastlake PB. Transcriptional control of the uvrD gene of Escherichia coli. Gene. 1983;25:309–316. doi: 10.1016/0378-1119(83)90235-4. [DOI] [PubMed] [Google Scholar]
  • 13.Au N, Kuester-Schoeck E, Mandava V, Bothwell LE, Canny SP, Chachu K, Colavito SA, Fuller SN, Groban ES, Hensley LA, O'Brien TC, Shah A, Tierney JT, Tomm LL, O'Gara TM, Goranov AI, Grossman AD, Lovett CM. Genetic composition of the Bacillus subtilis SOS system. J Bacteriol. 2005;187:7655–7666. doi: 10.1128/JB.187.22.7655-7666.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Aylon Y, Oren M. Living with p53, dying of p53. Cell. 2007;130:597–600. doi: 10.1016/j.cell.2007.08.005. [DOI] [PubMed] [Google Scholar]
  • 15.Bagdasarian M, Bailone A, Angulo JF, Scholz P, Devoret R. PsiB, and anti-SOS protein, is transiently expressed by the F sex factor during its transmission to an Escherichia coli K-12 recipient. Mol Microbiol. 1992;6:885–893. doi: 10.1111/j.1365-2958.1992.tb01539.x. [DOI] [PubMed] [Google Scholar]
  • 16.Bagdasarian M, Bailone A, Bagdasarian MM, Manning PA, Lurz R, Timmis KN, Devoret R. An inhibitor of SOS induction, specified by a plasmid locus in Escherichia coli. Proc Natl Acad Sci U S A. 1986;83:5723–5726. doi: 10.1073/pnas.83.15.5723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bagg A, Kenyon CJ, Walker GC. Inducibility of a gene product required for UV and chemical mutagenesis in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1981;78:5749–5753. doi: 10.1073/pnas.78.9.5749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bailone A, Backman A, Sommer S, Celerier J, Bagdasarian MM, Bagdasarian M, Devoret R. PsiB polypeptide prevents activation of RecA protein in Escherichia coli. Mol Gen Genet. 1988;214:389–395. doi: 10.1007/BF00330471. [DOI] [PubMed] [Google Scholar]
  • 19.Baquero MR, Bouzon M, Varea J, Moreno F. sbmC, a stationary-phase induced SOS Escherichia coli gene, whose product protects cells from the DNA replication inhibitor microcin B17. Mol Microbiol. 1995;18:301–311. doi: 10.1111/j.1365-2958.1995.mmi_18020301.x. [DOI] [PubMed] [Google Scholar]
  • 20.Barbe J, Villaverde A, Guerrero R. Induction of the SOS response by hydroxyurea in Escherichia coli K12. Mutat Res. 1987;192:105–108. doi: 10.1016/0165-7992(87)90105-9. [DOI] [PubMed] [Google Scholar]
  • 21.Barondess JJ, Beckwith J. A bacterial virulence determinant encoded by lysogenic coliphage lambda. Nature. 1990;346:871–874. doi: 10.1038/346871a0. [DOI] [PubMed] [Google Scholar]
  • 22.Barondess JJ, Beckwith J. bor gene of phage lambda, involved in serum resistance, encodes a widely conserved outer membrane lipoprotein. J Bacteriol. 1995;177:1247–1253. doi: 10.1128/jb.177.5.1247-1253.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bates H, Randall SK, Rayssiguier C, Bridges BA, Goodman MF, Radman M. Spontaneous and UV-induced mutations in Escherichia coli K-12 strains with altered or absent DNA polymerase I. J. Bacteriol. 1989;171:2480–2484. doi: 10.1128/jb.171.5.2480-2484.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Battista JR, Ohta T, Nohmi T, Sun W, Walker GC. Dominant negative umuD mutations decreasing RecA-mediated cleavage suggest roles for intact UmuD in modulation of SOS mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 1990;87:7190–7194. doi: 10.1073/pnas.87.18.7190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Beaber JW, Burrus V, Hochhut B, Waldor MK. Comparison of SXT and R391, two conjugative integrating elements: definition of a genetic backbone for the mobilization of resistance determinants. Cell Mol Life Sci. 2002;59:2065–2070. doi: 10.1007/s000180200006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Beaber JW, Hochhut B, Waldor MK. Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. J Bacteriol. 2002;184:4259–4269. doi: 10.1128/JB.184.15.4259-4269.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Beaber JW, Hochhut B, Waldor MK. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature. 2004;427:72–74. doi: 10.1038/nature02241. [DOI] [PubMed] [Google Scholar]
  • 28.Beaber JW, Waldor MK. Identification of operators and promoters that control SXT conjugative transfer. J Bacteriol. 2004;186:5945–5949. doi: 10.1128/JB.186.17.5945-5949.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Becherel OJ, Fuchs RP. Mechanism of DNA polymerase II-mediated frameshift mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 2001;98:8566–8571. doi: 10.1073/pnas.141113398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Begg KJ, Dewar SJ, Donachie WD. A new Escherichia coli cell division gene, ftsK. J Bacteriol. 1995;177:6211–6222. doi: 10.1128/jb.177.21.6211-6222.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Benz EW, Jr, Reinberg D, Vicuna R, Hurwitz J. Initiation of DNA replication by the dnaG protein. J Biol Chem. 1980;255:1096–1106. [PubMed] [Google Scholar]
  • 32.Berardini M, Foster PL, Loechler EL. DNA polymerase II (polB) is involved in a new DNA repair pathway for DNA interstrand cross-links in Escherichia coli. J Bacteriol. 1999;181:2878–2882. doi: 10.1093/gao/9781884446054.article.t031385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Berg O. Selection of DNA binding sites by regulatory proteins: the LexA protein and the arginine repressor use different strategies for functional specificity. Nucl. Acids. Res. 1988;16:5089–5105. doi: 10.1093/nar/16.11.5089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bertrand-Burggraf E, Hurstel S, Daune M, Schnarr M. Promoter properties and negative regulation of the uvrA gene by the LexA repressor and its amino-terminal DNA binding domain. J. Mol. Biol. 1987;193:293–302. doi: 10.1016/0022-2836(87)90220-8. [DOI] [PubMed] [Google Scholar]
  • 35.Bi E, Lutkenhaus J. Cell division inhibitors SulA and MinCD prevent formation of the FtsZ ring. J Bacteriol. 1993;175:1118–1125. doi: 10.1128/jb.175.4.1118-1125.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Blanco M, Herrera G, Collado P, Rebollo JE, Botella LM. Influence of RecA protein on induced mutagenesis. Biochimie. 1982;64:633–636. doi: 10.1016/s0300-9084(82)80102-8. [DOI] [PubMed] [Google Scholar]
  • 37.Blazquez J, Gomez-Gomez JM, Oliver A, Juan C, Kapur V, Martin S. PBP3 inhibition elicits adaptive responses in Pseudomonas aeruginosa. Mol Microbiol. 2006;62:84–99. doi: 10.1111/j.1365-2958.2006.05366.x. [DOI] [PubMed] [Google Scholar]
  • 38.Bonnefoy E, Rouviere-Yaniv J. HU and IHF, two homologous histone-like proteins of Escherichia coli, form different protein-DNA complexes with short DNA fragments. Embo J. 1991;10:687–696. doi: 10.1002/j.1460-2075.1991.tb07998.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bonnefoy E, Rouviere-Yaniv J. HU, the major histone-like protein of E. coli, modulates the binding of IHF to oriC. Embo J. 1992;11:4489–4496. doi: 10.1002/j.1460-2075.1992.tb05550.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bonner CA, Hays S, McEntee K, Goodman MF. DNA polymerase II is encoded by the DNA damage-inducible dinA gene of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1990;87:7663–7667. doi: 10.1073/pnas.87.19.7663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Borek E, Ryan A. Lysogenic induction. Prog. Nucleic Acid Res. Mol. Biol. 1973;13:249–300. doi: 10.1016/s0079-6603(08)60105-1. [DOI] [PubMed] [Google Scholar]
  • 42.Borek E, Ryan A. The transfer of irradiation-elicited induction in a lysogenic organism. Proc. Natl. Acad. Sci. U.S.A. 1958;44:374–377. doi: 10.1073/pnas.44.5.374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Bork JM, Cox MM, Inman RB. The RecOR proteins modulate RecA protein function at 5' ends of single-stranded DNA. Embo J. 2001;20:7313–7322. doi: 10.1093/emboj/20.24.7313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Brandsma JA, Bosch D, de Ruyter M, van de Putte P. Analysis of the regulatory region of the ssb gene of Escherichia coli. Nucleic Acids Res. 1985;13:5095–5109. doi: 10.1093/nar/13.14.5095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Brent R. Regulation and autoregulation by lexA protein. Biochimie. 1982;64:565–569. doi: 10.1016/s0300-9084(82)80088-6. [DOI] [PubMed] [Google Scholar]
  • 46.Brent R, Ptashne M. The lexA gene product represses its own promoter. Proc. Natl. Acad. Sci. U.S.A. 1980;77:1932–1936. doi: 10.1073/pnas.77.4.1932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Brent R, Ptashne M. Mechanism of action of the lexA gene product. Proc. Natl. Acad. Sci. U.S.A. 1981;78:4204–4208. doi: 10.1073/pnas.78.7.4204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Bridges BA. Are there DNA damage checkpoints in E. coli? Bioessays. 1995;17:63–70. doi: 10.1002/bies.950170112. [DOI] [PubMed] [Google Scholar]
  • 49.Bridges BA, Dennis RE, Munson RJ. Differential induction and repair of ultraviolet damage leading to true reversions and external suppressor mutations of an ochre codon in Escherichia coli B/r WP2. Genetics. 1967;57:897–908. doi: 10.1093/genetics/57.4.897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Briggs GS, McEwan PA, Yu J, Moore T, Emsley J, Lloyd RG. Ring structure of the Escherichia coli DNA-binding protein RdgC associated with recombination and replication fork repair. J Biol Chem. 2007;282:12353–12357. doi: 10.1074/jbc.C700023200. [DOI] [PubMed] [Google Scholar]
  • 51.Britton RA, Kuster-Schock E, Auchtung TA, Grossman AD. SOS induction in a subpopulation of structural maintenance of chromosome (Smc) mutant cells in Bacillus subtilis. J Bacteriol. 2007;189:4359–4366. doi: 10.1128/JB.00132-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Brotcorne-Lannoye A, Maenhaut-Michel G. Role of RecA protein in untargeted UV mutagenesis of bacteriophage λ: Evidence for the requirement for the dinB gene. Proc. Natl. Acad. Sci. U.S.A. 1986;83:3904–3908. doi: 10.1073/pnas.83.11.3904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Burckhardt SE, Woodgate R, Scheuermann RH, Echols H. UmuD mutagenesis protein of Escherichia coli: Overproduction, purification, and cleavage by RecA. Proc. Natl. Acad. Sci. U.S.A. 1988;85:1811–1815. doi: 10.1073/pnas.85.6.1811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Cairns J, Foster PL. Adaptive reversion of a frameshift mutation in Escherichia coli. Genetics. 1991;128:695–701. doi: 10.1093/genetics/128.4.695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Calsou P, Defais M. Weigle reactivation and mutagenesis of bacteriophage λ in lexA (Def) mutants of E. coli K12. Mol. Gen. Genet. 1985;201:329–333. doi: 10.1007/BF00425679. [DOI] [PubMed] [Google Scholar]
  • 56.Calsou P, Villaverde A, Defais M. Activated RecA protein may induce expression of a gene that is not controlled by the LexA repressor and whose function is required for mutagenesis and repair of UV-irradiated bacteriophage lambda. Journal of Bacteriology. 1987;169:4816–4821. doi: 10.1128/jb.169.10.4816-4821.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Campoy S, Fontes M, Padmanabhan S, Cortes P, Llagostera M, Barbe J. LexA-independent DNA damage-mediated induction of gene expression in Myxococcus xanthus. Mol Microbiol. 2003;49:769–781. doi: 10.1046/j.1365-2958.2003.03592.x. [DOI] [PubMed] [Google Scholar]
  • 58.Campoy S, Salvador N, Cortes P, Erill I, Barbe J. Expression of canonical SOS genes is not under LexA repression in Bdellovibrio bacteriovorus. J Bacteriol. 2005;187:5367–5375. doi: 10.1128/JB.187.15.5367-5375.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Casadaban MJ, Cohen SN. Lactose genes fused to exogenous promoters in one step using a Mu-lac bacteriophage: in vivo probe for transcriptional control sequences. Proc. Natl. Acad. Sci. U.S.A. 1980;76:4530–4533. doi: 10.1073/pnas.76.9.4530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Casaregola S, D'Ari R, Huisman O. Quantitative evaluation of recA gene expression in Escherichia coli. Mol. Gen. Genet. 1982;185:430–439. doi: 10.1007/BF00334135. [DOI] [PubMed] [Google Scholar]
  • 61.Castellazzi M, George J, Buttin G. Prophage induction and cell division in E. coli. I. Further characterization of the thermosensitive mutation tif-1 whose expression mimics the effects of UV irradiation. Mol. Gen. Genet. 1972;119:139–152. doi: 10.1007/BF00269133. [DOI] [PubMed] [Google Scholar]
  • 62.Cayrol C, Petit C, Raynaud B, Capdevielle J, Guillemot JC, Defais M. Recovery of respiration following the SOS response of Escherichia coli requires RecA-mediated induction of 2-keto-4-hydroxyglutarate aldolase. Proc Natl Acad Sci U S A. 1995;92:11806–11809. doi: 10.1073/pnas.92.25.11806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Chatterji M, Sengupta S, Nagaraja V. Chromosomally encoded gyrase inhibitor GyrI protects Escherichia coli against DNA-damaging agents. Arch Microbiol. 2003;180:339–346. doi: 10.1007/s00203-003-0598-4. [DOI] [PubMed] [Google Scholar]
  • 64.Chedin F, Ehrlich SD, Kowalczykowski SC. The Bacillus subtilis AddAB helicase/nuclease is regulated by its cognate Chi sequence in vitro. J Mol Biol. 2000;298:7–20. doi: 10.1006/jmbi.2000.3556. [DOI] [PubMed] [Google Scholar]
  • 65.Chedin F, Handa N, Dillingham MS, Kowalczykowski SC. The AddAB helicase/nuclease forms a stable complex with its cognate chi sequence during translocation. J Biol Chem. 2006;281:18610–18617. doi: 10.1074/jbc.M600882200. [DOI] [PubMed] [Google Scholar]
  • 66.Cheftel JC. Review : High-pressure, microbial inactivation and food preservation / Revision: Alta-presion, inactivacion microbiologica y conservacion de alimentos. 1995;1:75–90. [Google Scholar]
  • 67.Cirz RT, Jones MB, Gingles NA, Minogue TD, Jarrahi B, Peterson SN, Romesberg FE. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J Bacteriol. 2007;189:531–539. doi: 10.1128/JB.01464-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Cirz RT, O'Neill BM, Hammond JA, Head SR, Romesberg FE. Defining the Pseudomonas aeruginosa SOS response and its role in the global response to the antibiotic ciprofloxacin. J Bacteriol. 2006;188:7101–7110. doi: 10.1128/JB.00807-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Clark AJ. RecA operator mutations and their usefulness. Biochimie. 1982;64:669–675. doi: 10.1016/s0300-9084(82)80108-9. [DOI] [PubMed] [Google Scholar]
  • 70.Cole ST. Characterization of the promoter for the LexA regulated sulA gene of Escherichia coli. Mol. Gen. Genet. 1983;189:400–404. doi: 10.1007/BF00325901. [DOI] [PubMed] [Google Scholar]
  • 71.Cooper S, Helmstetter CE. Chromosome replication and the division cycle of Escherichia coli B/r. J Mol Biol. 1968;31:519–540. doi: 10.1016/0022-2836(68)90425-7. [DOI] [PubMed] [Google Scholar]
  • 72.Cordell SC, Robinson EJ, Lowe J. Crystal structure of the SOS cell division inhibitor SulA and in complex with FtsZ. Proc Natl Acad Sci U S A. 2003;100:7889–7894. doi: 10.1073/pnas.1330742100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Courcelle J, Donaldson JR, Chow KH, Courcelle CT. DNA damage-induced replication fork regression and processing in Escherichia coli. Science. 2003;299:1064–1067. doi: 10.1126/science.1081328. [DOI] [PubMed] [Google Scholar]
  • 74.Courcelle J, Hanawalt PC. RecQ and RecJ process blocked replication forks prior to the resumption of replication in UV-irradiated Escherichia coli. Mol. Gen. Genet. 1999;262:543–551. doi: 10.1007/s004380051116. [DOI] [PubMed] [Google Scholar]
  • 75.Courcelle J, Khodursky A, Peter B, Brown PO, Hanawalt PC. Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics. 2001;158:41–64. doi: 10.1093/genetics/158.1.41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Cox MM. Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol. 2007;42:41–63. doi: 10.1080/10409230701260258. [DOI] [PubMed] [Google Scholar]
  • 77.Cox MM, Lehman IR. RecA protein-promoted DNA strand exchange. Stable complexes of RecA protein and single-stranded DNA formed in the presence of ATP and single-stranded DNA binding protein. J. Biol. Chem. 1982;257:8523–8532. [PubMed] [Google Scholar]
  • 78.Craig NL, Roberts JW. E. coli recA protein-directed cleavage of phage lambda repressor requires polynucleotide. Nature (London) 1980;283:26–30. doi: 10.1038/283026a0. [DOI] [PubMed] [Google Scholar]
  • 79.Craig NL, Roberts JW. Function of nucleoside triphosphate and polynucleotide in Escherichia coli recA protein-directed cleavage of phage lambda repressor. J. Biol. Chem. 1981;256:8039–8044. [PubMed] [Google Scholar]
  • 80.D'Ari R, Huisman O. DNA replication and indirect induction of the SOS response in Escherichia coli. Biochimie. 1982;64:623–627. doi: 10.1016/s0300-9084(82)80100-4. [DOI] [PubMed] [Google Scholar]
  • 81.D'Ari R, Huisman O. Novel mechanism of cell division inhibition associated with the SOS response in Escherichia coli. J. Bacteriol. 1983;156:243–250. doi: 10.1128/jb.156.1.243-250.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Dabbs ER. The gene for ribosomal protein S21, rpsU, maps close to dnaG at 66.5 min on the Escherichia coli chromosomal linkage map. J Bacteriol. 1980;144:603–607. doi: 10.1128/jb.144.2.603-607.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Daley DO, Rapp M, Granseth E, Melen K, Drew D, Heijne Gvon. Global topology analysis of the Escherichia coli inner membrane proteome. Science. 2005;308:1321–1323. doi: 10.1126/science.1109730. [DOI] [PubMed] [Google Scholar]
  • 84.Datta S, Ganesh N, Chandra NR, Muniyappa K, Vijayan M. Structural studies on MtRecA-nucleotide complexes: insights into DNA and nucleotide binding and the structural signature of NTP recognition. Proteins. 2003;50:474–485. doi: 10.1002/prot.10315. [DOI] [PubMed] [Google Scholar]
  • 85.Datta S, Krishna R, Ganesh N, Chandra NR, Muniyappa K, Vijayan M. Crystal structures of Mycobacterium smegmatis RecA and its nucleotide complexes. J. Bacteriol. 2003;185:4280–4284. doi: 10.1128/JB.185.14.4280-4284.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Datta S, Prabu MM, Vaze MB, Ganesh N, Chandra NR, Muniyappa K, Vijayan M. Crystal structures of Mycobacterium tuberculosis RecA and its complex with ADP-AlF(4): implications for decreased ATPase activity and molecular aggregation. Nucleic Acids Res. 2000;28:4964–4973. doi: 10.1093/nar/28.24.4964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Davis EO, Springer B, Gopaul KK, Papavinasasundaram KG, Sander P, Bottger EC. DNA damage induction of recA in Mycobacterium tuberculosis independently of RecA and LexA. Mol Microbiol. 2002;46:791–800. doi: 10.1046/j.1365-2958.2002.03199.x. [DOI] [PubMed] [Google Scholar]
  • 88.Defais M, Fauquet P, Radman M, Errera M. Ultraviolet reactivation and ultraviolet mutagenesis of lambda in different genetic systems. Virology. 1971;43:495–503. doi: 10.1016/0042-6822(71)90321-7. [DOI] [PubMed] [Google Scholar]
  • 89.Devoret R, George J. Induction indirecte du prophage lambda par le rayonnement ultraviolet. Mutat. Res. 1967;4:713–714. doi: 10.1016/0027-5107(67)90081-4. [DOI] [PubMed] [Google Scholar]
  • 90.Devoret R, Pierre M, Moreau PL. Prophage φ80 is induced in Escherichia coli K12 recA430. Mol. Gen. Genet. 1983;189:199–206. doi: 10.1007/BF00337804. [DOI] [PubMed] [Google Scholar]
  • 91.DiCapua E, Cuillel M, Hewat E, Schnarr M, Timmins PA, Ruigrok RW. Activation of recA protein. The open helix model for LexA cleavage. J Mol Biol. 1992;226:707–719. doi: 10.1016/0022-2836(92)90627-v. [DOI] [PubMed] [Google Scholar]
  • 92.Dillingham MS, Spies M, Kowalczykowski SC. RecBCD enzyme is a bipolar DNA helicase. Nature. 2003;423:893–897. doi: 10.1038/nature01673. [DOI] [PubMed] [Google Scholar]
  • 93.Donachie WD. The cell cycle of Escherichia coli. Ann. Rev. Microbiol. 1993;47:199–230. doi: 10.1146/annurev.mi.47.100193.001215. [DOI] [PubMed] [Google Scholar]
  • 94.Donnelly CE, Walker GC. Coexpression of UmuD' with UmuC suppresses the UV mutagenesis deficiency of groE mutants. J. Bacteriol. 1992;174:3133–3139. doi: 10.1128/jb.174.10.3133-3139.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Donnelly CE, Walker GC. groE mutants of Escherichia coli are defective in umuDC-dependent UV mutagenesis. J. Bacteriol. 1989;171:6117–6125. doi: 10.1128/jb.171.11.6117-6125.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Dorazi R, Dewar SJ. The SOS promoter dinH is essential for ftsK transcription during cell division. Microbiology. 2000;146(Pt 11):2891–2899. doi: 10.1099/00221287-146-11-2891. [DOI] [PubMed] [Google Scholar]
  • 97.Drees JC, Chitteni-Pattu S, McCaslin DR, Inman RB, Cox MM. Inhibition of RecA protein function by the RdgC protein from Escherichia coli. J Biol Chem. 2006;281:4708–4717. doi: 10.1074/jbc.M513592200. [DOI] [PubMed] [Google Scholar]
  • 98.Drees JC, Lusetti SL, Chitteni-Pattu S, Inman RB, Cox MM. A RecA filament capping mechanism for RecX protein. Mol Cell. 2004;15:789–798. doi: 10.1016/j.molcel.2004.08.026. [DOI] [PubMed] [Google Scholar]
  • 99.Drees JC, Lusetti SL, Cox MM. Inhibition of RecA protein by the Escherichia coli RecX protein: Modulation by the RecA C-terminus and filament functional state. J Biol Chem. 2004 doi: 10.1074/jbc.M409050200. [DOI] [PubMed] [Google Scholar]
  • 100.Dri A-M, Moreau PL. Control of the LexA regulon by pH: evidence for a reversible inactivation of the LexA repressor during the growth cycle of Escherichia coli. Mol. Microbiol. 1994;12:621–629. doi: 10.1111/j.1365-2958.1994.tb01049.x. [DOI] [PubMed] [Google Scholar]
  • 101.Drlica K, Engle EC, Manes SH. DNA gyrase on the bacterial chromosome: Possibility of two levels of action. Proc. Natl. Acad. Sci. U.S.A. 1980;77:6879–6883. doi: 10.1073/pnas.77.11.6879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Dronkert ML, Kanaar R. Repair of DNA interstrand cross-links. Mutat Res. 2001;486:217–247. doi: 10.1016/s0921-8777(01)00092-1. [DOI] [PubMed] [Google Scholar]
  • 103.Dutreix M, Backman A, Celerier J, Bagdasarian MM, Sommer S, Bailone A, Devoret R, Bagdasarian M. Identification of psiB genes of plasmids F and R6-5. Molecular basis for psiB enhanced expression in plasmid R6-5. Nucleic Acids Res. 1988;16:10669–10679. doi: 10.1093/nar/16.22.10669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Dutreix M, Burnett B, Bailone A, Radding CM, Devoret R. A partially deficient mutant, recA1730, that fails to form normal nucleoprotein filaments. Mol. Gen. Genet. 1992;232:489–497. doi: 10.1007/BF00266254. [DOI] [PubMed] [Google Scholar]
  • 105.Echols H, Goodman MF. Fidelity mechanisms in DNA replication. Annu. Rev. Biochem. 1991;60:477–511. doi: 10.1146/annurev.bi.60.070191.002401. [DOI] [PubMed] [Google Scholar]
  • 106.Egan SE, Fliege R, Tong S, Shibata A, Wolf RE, Jr, Conway T. Molecular characterization of the Entner-Doudoroff pathway in Escherichia coli: sequence analysis and localization of promoters for the edd-eda operon. J Bacteriol. 1992;174:4638–4646. doi: 10.1128/jb.174.14.4638-4646.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Elledge SJ, Walker GC. Proteins required for ultraviolet light and chemical mutagenesis: Identification of the products of the umuC locus of Escherichia coli. J. Mol. Biol. 1983;164:175–192. doi: 10.1016/0022-2836(83)90074-8. [DOI] [PubMed] [Google Scholar]
  • 108.Elliott SJ, Sperandio V, Giron JA, Shin S, Mellies JL, Wainwright L, Hutcheson SW, McDaniel TK, Kaper JB. The locus of enterocyte effacement (LEE)-encoded regulator controls expression of both LEE- and non-LEE-encoded virulence factors in enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 2000;68:6115–6126. doi: 10.1128/iai.68.11.6115-6126.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Ennis DG, Fisher B, Edmiston S, Mount DW. Dual role for Escherichia coli RecA protein in SOS mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 1985;82:3325–3329. doi: 10.1073/pnas.82.10.3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Erill I, Campoy S, Barbe J. Aeons of distress: an evolutionary perspective on the bacterial SOS response. FEMS Microbiol Rev. 2007;31:637–656. doi: 10.1111/j.1574-6976.2007.00082.x. [DOI] [PubMed] [Google Scholar]
  • 111.Fath MJ, Mahanty HK, Kolter R. Characterization of a purF operon mutation which affects colicin V production. J Bacteriol. 1989;171:3158–3161. doi: 10.1128/jb.171.6.3158-3161.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Ferentz AE, Opperman T, Walker GC, Wagner G. Dimerization of the UmuD' protein in solution and its implications for regulation of SOS mutagenesis. Nature Struct. Biol. 1997;4:979–983. doi: 10.1038/nsb1297-979. [DOI] [PubMed] [Google Scholar]
  • 113.Fernandez De, Henestrosa AR, Ogi T, Aoyagi S, Chafin D, Hayes JJ, Ohmori H, Woodgate R. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol. 2000;35:1560–1572. doi: 10.1046/j.1365-2958.2000.01826.x. [DOI] [PubMed] [Google Scholar]
  • 114.Finch PW, Chambers P, Emmerson PT. Identification of the E. coli recN gene product as a major SOS protein. J. Bacteriol. 1985;164:653–658. doi: 10.1128/jb.164.2.653-658.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Fogliano M, Schendel PF. Evidence for the inducibility of the uvrB operon. Nature (London) 1981;289:196–198. doi: 10.1038/289196a0. [DOI] [PubMed] [Google Scholar]
  • 116.Foster PL. Adaptive mutation in Escherichia coli. J. Bacteriol. 2004;186:4846–4852. doi: 10.1128/JB.186.15.4846-4852.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Foster PL. Rebuttal: adaptive point mutation (Rosenberg and Hastings) J Bacteriol. 2004;186:4845. doi: 10.1128/JB.186.15.4845.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Foti JJ, Persky NS, Ferullo DJ, Lovett ST. Chromosome segregation control by Escherichia coli ObgE GTPase. Mol Microbiol. 2007;65:569–581. doi: 10.1111/j.1365-2958.2007.05811.x. [DOI] [PubMed] [Google Scholar]
  • 119.Foti JJ, Schienda J, Sutera VA, Jr, Lovett ST. A bacterial G protein-mediated response to replication arrest. Mol Cell. 2005;17:549–560. doi: 10.1016/j.molcel.2005.01.012. [DOI] [PubMed] [Google Scholar]
  • 120.Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, Ellenberger T. DNA Repair and Mutagenesis: Second Edition. Washington, DC: American Society for Microbiology; 2005. [Google Scholar]
  • 121.Fuchs JA. Coordinate control of the synthesis of ribonucleoside diphosphate reductase components in Escherichia coli. J Bacteriol. 1977;130:957–959. doi: 10.1128/jb.130.2.957-959.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Fuchs JA, Karlstrom HO. Mapping of nrdA and nrdB in Escherichia coli K-12. J Bacteriol. 1976;128:810–814. doi: 10.1128/jb.128.3.810-814.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123.Fuchs JA, Karlstrom HO. A mutant of Escherichia coli defective in ribonucleosidediphosphate reductase. 2. Characterization of the enzymatic defect. Eur J Biochem. 1973;32:457–462. [PubMed] [Google Scholar]
  • 124.Fuchs JA, Karlstrom HO, Warner HR, Reichard P. Defective gene product in dnaF mutant of Escherichia coli. Nat New Biol. 1972;238:69–71. doi: 10.1038/newbio238069a0. [DOI] [PubMed] [Google Scholar]
  • 125.Fuchs JA, Neuhard J. A mutant of Escherichia coli defective in ribonucleosidediphosphate reductase. 1. Isolation of the mutant as a deoxyuridine auxotroph. Eur J Biochem. 1973;32:451–456. doi: 10.1111/j.1432-1033.1973.tb02627.x. [DOI] [PubMed] [Google Scholar]
  • 126.Fuchs RP, Koffel-Schwartz N, Pelet S, Janel-Bintz R, Napolitano R, Becherel OJ, Broschard TH, Burnouf DY, Wagner J. DNA polymerases II and V mediate respectively mutagenic (−2 frameshift) and error-free bypass of a single N-2-acetylaminofluorene adduct. Biochem. Soc. Trans. 2001;29:191–195. doi: 10.1042/0300-5127:0290191. [DOI] [PubMed] [Google Scholar]
  • 127.Galletto R, Amitani I, Baskin RJ, Kowalczykowski SC. Direct observation of individual RecA filaments assembling on single DNA molecules. Nature. 2006;443:875–878. doi: 10.1038/nature05197. [DOI] [PubMed] [Google Scholar]
  • 128.Ganesan AK, Seawell PC. The effect of lexA and recF mutations on post-replication repair and DNA synthesis in Escherichia coli K-12. Molec. Gen. Genet. 1975;141:189–205. doi: 10.1007/BF00341799. [DOI] [PubMed] [Google Scholar]
  • 129.Garcia-Graells C, Valckx C, Michiels CW. Inactivation of Escherichia coli and Listeria innocua in milk by combined treatment with high hydrostatic pressure and the lactoperoxidase system. Appl Environ Microbiol. 2000;66:4173–4179. doi: 10.1128/aem.66.10.4173-4179.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130.Gardner TS, Bernardo Ddi, Lorenz D, Collins JJ. Inferring genetic networks and identifying compound mode of action via expression profiling. Science. 2003;301:102–105. doi: 10.1126/science.1081900. [DOI] [PubMed] [Google Scholar]
  • 131.Gellert M, Mizuuchi K, O'Dea M, Itoh T, Tomizawa J-I. Nalidixic acid resistance: A second genetic character involved in DNA gyrase activity. Proc. Natl. Acad. Sci. U.S.A. 1977;74:4772–4776. doi: 10.1073/pnas.74.11.4772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 132.George J, Castellazzi M, Buttin G. Prophage induction and cell division in E.coli. III. Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif. Mol. Gen. Genet. 1975;140:309–332. [PubMed] [Google Scholar]
  • 133.George J, Devoret R, Radman M. Indirect ultraviolet-reactivation of phage lambda. Proc. Natl. Acad. Sci. U.S.A. 1974;71:144–147. doi: 10.1073/pnas.71.1.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134.Georgiou T, Yu YN, Ekunwe S, Buttner MJ, Zuurmond A, Kraal B, Kleanthous C, Snyder L. Specific peptide-activated proteolytic cleavage of Escherichia coli elongation factor Tu. Proc Natl Acad Sci U S A. 1998;95:2891–2895. doi: 10.1073/pnas.95.6.2891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135.Gibert I, Calero S, Barbe J. Measurement of in vivo expression of nrdA and nrdB genes of Escherichia coli by using lacZ gene fusions. Mol Gen Genet. 1990;220:400–408. doi: 10.1007/BF00391745. [DOI] [PubMed] [Google Scholar]
  • 136.Gitai Z, Thanbichler M, Shapiro L. The choreographed dynamics of bacterial chromosomes. Trends Microbiol. 2005;13:221–228. doi: 10.1016/j.tim.2005.03.006. [DOI] [PubMed] [Google Scholar]
  • 137.Godoy VG, Jarosz DF, Simon SM, Abyzov A, Ilyin V, Walker GC. UmuD and RecA Directly Modulate the Mutagenic Potential of the Y Family DNA Polymerase DinB. Mol Cell. 2007;28:1058–1070. doi: 10.1016/j.molcel.2007.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 138.Godoy VG, Jarosz DF, Walker FL, Simmons LA, Walker GC. Y-family DNA polymerases respond to DNA damage-independent inhibition of replication fork progression. Embo J. 2006;25:868–879. doi: 10.1038/sj.emboj.7600986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139.Goerke C, Koller J, Wolz C. Ciprofloxacin and trimethoprim cause phage induction and virulence modulation in Staphylococcus aureus. Antimicrob Agents Chemother. 2006;50:171–177. doi: 10.1128/AAC.50.1.171-177.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140.Goerlich O, Quillardet P, Hofnung M. Induction of the SOS response by hydrogen peroxide in various Escherichia coli mutants with altered protection against oxidative DNA damage. J Bacteriol. 1989;171:6141–6147. doi: 10.1128/jb.171.11.6141-6147.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 141.Goldfless SJ, Morag AS, Belisle KA, Sutera VA, Jr, Lovett ST. DNA repeat rearrangements mediated by DnaK-dependent replication fork repair. Mol Cell. 2006;21:595–604. doi: 10.1016/j.molcel.2006.01.025. [DOI] [PubMed] [Google Scholar]
  • 142.Golub E, Bailone A, Devoret R. A gene encoding an SOS inhibitor is present in different conjugative plasmids. J Bacteriol. 1988;170:4392–4394. doi: 10.1128/jb.170.9.4392-4394.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 143.Goranov AI, Katz L, Breier AM, Burge CB, Grossman AD. A transcriptional response to replication status mediated by the conserved bacterial replication protein DnaA. Proc Natl Acad Sci U S A. 2005;102:12932–12937. doi: 10.1073/pnas.0506174102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144.Goranov AI, Kuester-Schoeck E, Wang JD, Grossman AD. Characterization of the global transcriptional responses to different types of DNA damage and disruption of replication in Bacillus subtilis. J Bacteriol. 2006;188:5595–5605. doi: 10.1128/JB.00342-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 145.Grambow NJ, Birkeland NK, Anders DL, Christie GE. Deletion analysis of a bacteriophage P2 late promoter. Gene. 1990;95:9–15. doi: 10.1016/0378-1119(90)90407-i. [DOI] [PubMed] [Google Scholar]
  • 146.Greenberg J, Donch J, Berends L. The dominance of exrB over exrB+ Genet. Res. 1975;25:39–44. doi: 10.1017/s001667230001541x. [DOI] [PubMed] [Google Scholar]
  • 147.Griffith JD, Harris LD, Register J., 3rd Visualization of SSB-ssDNA complexes active in the assembly of stable RecA-DNA filaments. Cold Spring Harb Symp Quant Biol. 1984;49:553–559. doi: 10.1101/sqb.1984.049.01.062. [DOI] [PubMed] [Google Scholar]
  • 148.Gudas LJ, Mount DW. Identification of the recA(tif) gene product of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1977;74:5280–5284. doi: 10.1073/pnas.74.12.5280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 149.Gudas LJ, Pardee AB. Model for regulation of Escherichia coli DNA repair functions. Proc. Natl. Acad. Sci. U.S.A. 1975;72:2330–2334. doi: 10.1073/pnas.72.6.2330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150.Hegde S, Sandler SJ, Clark AJ, Madiraju MV. recO and recR mutations delay induction of the SOS response in Escherichia coli. Mol. Gen. Genet. 1995;246:254–258. doi: 10.1007/BF00294689. [DOI] [PubMed] [Google Scholar]
  • 151.Hegde SP, Qin MH, Li XH, Atkinson MA, Clark AJ, Rajagopalan M, Madiraju MV. Interactions of RecF protein with RecO, RecR, and single-stranded DNA binding proteins reveal roles for the RecF-RecO-RecR complex in DNA repair and recombination. Proc. Natl. Acad. Sci. U.S.A. 1996;93:14468–14473. doi: 10.1073/pnas.93.25.14468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152.Hendricks EC, Szerlong H, Hill T, Kuempel P. Cell division, guillotining of dimer chromosomes and SOS induction in resolution mutants (difxerC and xerD) of Escherichia coli. Mol Microbiol. 2000;36:973–981. doi: 10.1046/j.1365-2958.2000.01920.x. [DOI] [PubMed] [Google Scholar]
  • 153.Hersh MN, Ponder RG, Hastings PJ, Rosenberg SM. Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress. Res Microbiol. 2004;155:352–359. doi: 10.1016/j.resmic.2004.01.020. [DOI] [PubMed] [Google Scholar]
  • 154.Hishida T, Han YW, Shibata T, Kubota Y, Ishino Y, Iwasaki H, Shinagawa H. Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004;18:1886–1897. doi: 10.1101/gad.1223804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 155.Hobbs MD, Sakai A, Cox MM. SSB protein limits RecOR binding onto single-stranded DNA. J Biol Chem. 2007;282:11058–11067. doi: 10.1074/jbc.M611007200. [DOI] [PubMed] [Google Scholar]
  • 156.Hochhut B, Beaber JW, Woodgate R, Waldor MK. Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 2001;183:1124–1132. doi: 10.1128/JB.183.4.1124-1132.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157.Horii T, Ogawa T, Nakatani T, Hase T, Matsubara H, Ogawa H. Regulation of SOS functions: Purification of E. coli LexA protein and determination of its specific site cleaved by the RecA protein. Cell. 1981;27:515–522. doi: 10.1016/0092-8674(81)90393-7. [DOI] [PubMed] [Google Scholar]
  • 158.Horii Z, Clark AJ. Genetic analysis of the recF pathway to genetic recombination in Escherichia coli K12: isolation and characterization of mutants. J Mol Biol. 1973;80:327–344. doi: 10.1016/0022-2836(73)90176-9. [DOI] [PubMed] [Google Scholar]
  • 159.Howard-Flanders P, Boyce RP, Theriot L. Three loci in Escherichia coli that control the excision of pyrrimidne dimers and certain mutagenic products from DNA. Genetics. 1964;53:1119–1136. doi: 10.1093/genetics/53.6.1119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 160.Huisman O, D'Ari R. An inducible DNA replication-cell division coupling mechanism in E. coli. Nature (London) 1981;290:797–799. doi: 10.1038/290797a0. [DOI] [PubMed] [Google Scholar]
  • 161.Hurstel S, Granger-Schnarr M, Daune M, Schnarr M. In vitro binding of LexA repressor to DNA: Evidence for the involvement of the amino-terminal domain. Embo J. 1986;5:793–798. doi: 10.1002/j.1460-2075.1986.tb04283.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 162.Hurstel S, Granger-Schnarr M, Schnarr M. Contacts between the LexA repressor - or its DNA binding domain - and the backbone of the recA operator. Embo J. 1988;7:269–275. doi: 10.1002/j.1460-2075.1988.tb02809.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 163.Ihara M, Yamamato K, Ohnishi T. Induction of phr gene expression by irradiation of ultraviolet light in Escherichia coli. Mol. Gen. Genet. 1987;209:200–202. doi: 10.1007/BF00329860. [DOI] [PubMed] [Google Scholar]
  • 164.Imlay JA, Linn S. Mutagenesis and stress responses induced in Escherichia coli by hydrogen peroxide. J Bacteriol. 1987;169:2967–2976. doi: 10.1128/jb.169.7.2967-2976.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 165.Irino N, Nakayama K, Nakayama H. The recQ gene of Escherichia coli K-12: primary structure and evidence for SOS regulation. Mol. Gen. Genet. 1986;205:298–304. doi: 10.1007/BF00430442. [DOI] [PubMed] [Google Scholar]
  • 166.Iusupova DV, Sokolova RV, Porfir'eva OV, Ponomareva AZ. Induction of intracellular endonuclease synthesis in Serratia marcescens by agents suppressing DNA replication. Mikrobiologiia. 1991;60:279–284. [PubMed] [Google Scholar]
  • 167.Janion C, Sikora A, Nowosielska A, Grzesiuk E. Induction of the SOS response in starved Escherichia coli. Environ. Mol. Mutagen. 2002;40:129–133. doi: 10.1002/em.10094. [DOI] [PubMed] [Google Scholar]
  • 168.Jarosz DF, Beuning PJ, Cohen SE, Walker GC. Y-family DNA polymerases in Escherichia coli. Trends Microbiol. 2007;15:70–77. doi: 10.1016/j.tim.2006.12.004. [DOI] [PubMed] [Google Scholar]
  • 169.Jarosz DF, Godoy VG, Delaney JC, Essigmann JM, Walker GC. A single amino acid governs enhanced activity of DinB DNA polymerases on damaged templates. Nature. 2006;439:225–228. doi: 10.1038/nature04318. [DOI] [PubMed] [Google Scholar]
  • 170.Joo C, McKinney SA, Nakamura M, Rasnik I, Myong S, Ha T. Real-time observation of RecA filament dynamics with single monomer resolution. Cell. 2006;126:515–527. doi: 10.1016/j.cell.2006.06.042. [DOI] [PubMed] [Google Scholar]
  • 171.Kaasch M, Kaasch J, Quinones A. Expression of the dnaN and dnaQ genes of Escherichia coli is inducible by mitomycin. Mol. Gen. Genet. 1989;219:187–192. doi: 10.1007/BF00261175. [DOI] [PubMed] [Google Scholar]
  • 172.Kano Y, Osato K, Wada M, Imamoto F. Cloning and sequencing of the HU-2 gene of Escherichia coli. Mol Gen Genet. 1987;209:408–410. doi: 10.1007/BF00329674. [DOI] [PubMed] [Google Scholar]
  • 173.Kano Y, Wada M, Imamoto F. Genetic characterization of the gene hupA encoding the HU-2 protein of Escherichia coli. Gene. 1988;69:331–335. doi: 10.1016/0378-1119(88)90443-x. [DOI] [PubMed] [Google Scholar]
  • 174.Kano Y, Wada M, Nagase T, Imamoto F. Genetic characterization of the gene hupB encoding the HU-1 protein of Escherichia coli. Gene. 1986;45:37–44. doi: 10.1016/0378-1119(86)90129-0. [DOI] [PubMed] [Google Scholar]
  • 175.Kano Y, Yoshino S, Wada M, Yokoyama K, Nobuhara M, Imamoto F. Molecular cloning and nucleotide sequence of the HU-1 gene of Escherichia coli. Mol Gen Genet. 1985;201:360–362. doi: 10.1007/BF00425687. [DOI] [PubMed] [Google Scholar]
  • 176.Kanuri M, Nechev LV, Kiehna SE, Tamura PJ, Harris CM, Harris TM, Lloyd RS. Evidence for Escherichia coli polymerase II mutagenic bypass of intrastrand DNA crosslinks. DNA Repair (Amst) 2005;4:1374–1380. doi: 10.1016/j.dnarep.2005.08.011. [DOI] [PubMed] [Google Scholar]
  • 177.Karu AE, Belk ED. Induction of E. colirecA protein via recBC and alternate pathways: Quantitation by enzyme-linked immunosorbent assay (ELISA) Mol. Gen. Genet. 1982;185:275–282. doi: 10.1007/BF00330798. [DOI] [PubMed] [Google Scholar]
  • 178.Kato T, Shinoura Y. Isolation and characterization of mutants of Escherichia coli deficient in induction of mutations by ultraviolet light. Mol. Gen. Genet. 1977;156:121–131. doi: 10.1007/BF00283484. [DOI] [PubMed] [Google Scholar]
  • 179.Kawai Y, Moriya S, Ogasawara N. Identification of a protein, YneA, responsible for cell division suppression during the SOS response in Bacillus subtilis. Mol Microbiol. 2003;47:1113–1122. doi: 10.1046/j.1365-2958.2003.03360.x. [DOI] [PubMed] [Google Scholar]
  • 180.Kelley WL. Lex marks the spot: the virulent side of SOS and a closer look at the LexA regulon. Mol Microbiol. 2006;62:1228–1238. doi: 10.1111/j.1365-2958.2006.05444.x. [DOI] [PubMed] [Google Scholar]
  • 181.Kenyon CJ, Brent R, Ptashne M, Walker GC. Regulation of damage-inducible genes in Escherichia coli. J. Mol. Biol. 1982;160:445–457. doi: 10.1016/0022-2836(82)90307-2. [DOI] [PubMed] [Google Scholar]
  • 182.Kenyon CJ, Walker GC. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1980;77:2819–2823. doi: 10.1073/pnas.77.5.2819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 183.Kenyon CJ, Walker GC. Expression of the E. coli uvrA gene is inducible. Nature (London) 1981;289:808–810. doi: 10.1038/289808a0. [DOI] [PubMed] [Google Scholar]
  • 184.Khil PP, Camerini-Otero RD. Over 1000 genes are involved in the DNA damage response of Escherichia coli. Mol Microbiol. 2002;44:89–105. doi: 10.1046/j.1365-2958.2002.02878.x. [DOI] [PubMed] [Google Scholar]
  • 185.Kidane D, Graumann PL. Dynamic formation of RecA filaments at DNA double strand break repair centers in live cells. J Cell Biol. 2005;170:357–366. doi: 10.1083/jcb.200412090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 186.Kim B, Little JW. Dimerization of a specific DNA-binding protein on the DNA. Science. 1992;255:203–206. doi: 10.1126/science.1553548. [DOI] [PubMed] [Google Scholar]
  • 187.Kim B, Little JW. LexA and λ cI repressors as enzymes: Specific cleavage in an intermolecular reaction. J. Bacteriol. 1993;73:1165–1173. doi: 10.1016/0092-8674(93)90645-7. [DOI] [PubMed] [Google Scholar]
  • 188.Kim S-R, Maenhaut-Michel G, Yamada M, Yamamoto Y, Matsui K, Sofuni T, Nohmi T, Ohmori H. Multiple pathways for SOS-mutagenesis in Escherichia coli: an overexpression of dinB/dinP results in strongly enhancing mutagenesis in the absence of any exogenous treatment to damage DNA. Proc. Natl. Acad. Sci. U.S.A. 1997;94:13792–12797. doi: 10.1073/pnas.94.25.13792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 189.Kim SR, Matsui K, Yamada M, Gruz P, Nohmi T. Roles of chromosomal and episomal dinB genes encoding DNA pol IV in targeted and untargeted mutagenesis in Escherichia coli. Mol. Genet. Genomics. 2001;266:207–215. doi: 10.1007/s004380100541. [DOI] [PubMed] [Google Scholar]
  • 190.Kitagawa Y, Akaboshi E, Shinagawa H, Horii T, Ogawa H, Kato T. Structural analysis of the umu operon required for inducible mutagenesis in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1985;82:4336–4340. doi: 10.1073/pnas.82.13.4336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191.Kleinsteuber S, Quinones A. Expression of the dnaB gene of Escherichia coli is inducible by replication-blocking DNA damage in a recA-independent manner. Mol Gen Genet. 1995;248:695–702. doi: 10.1007/BF02191709. [DOI] [PubMed] [Google Scholar]
  • 192.Knight KL, Aoki KH, Ujita EL, McEntee K. Identification of the amino acid substitutions in two mutant forms of the RecA protein from Escherichia coli RecA441 and Rec629. J. Biol. Chem. 1984;259:11279–11283. [PubMed] [Google Scholar]
  • 193.Kobayashi H, Kaern M, Araki M, Chung K, Gardner TS, Cantor CR, Collins JJ. Programmable cells: interfacing natural and engineered gene networks. Proc Natl Acad Sci U S A. 2004;101:8414–8419. doi: 10.1073/pnas.0402940101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194.Koch HK, Woodgate R. The SOS response. In: Nickoloff JA, Hoekstra MF, editors. DNA Damage and Repair., Vol. 1: DNA Repair in Prokaryotes and Lower Eukaryotes. Totowa, N.J: Humana Press; 1998. pp. 107–134. [Google Scholar]
  • 195.Koonin EV. Escherichia coli dinG gene encodes a putative DNA helicase related to a group of eukaryotic helicases including Rad3 protein. Nucleic Acids Res. 1993;21:1497. doi: 10.1093/nar/21.6.1497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 196.Kow YW, Imhoff B, Weiss B, Hung DC, Hindoyan AA, Story RM, Goodman SD. Escherichia coli HU protein has a role in the repair of abasic sites in DNA. Nucleic Acids Res. 2007;35:6672–6680. doi: 10.1093/nar/gkm567. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 197.Kowalczykowski SC, Krupp RA. Effects of Escherichia coli SSB protein on the single-stranded DNA-dependent ATPase activity of Escherichia coli RecA protein. Evidence that SSB protein facilitates the binding of RecA protein to regions of secondary structure within single-stranded DNA. J. Mol. Biol. 1987;193:97–113. doi: 10.1016/0022-2836(87)90630-9. [DOI] [PubMed] [Google Scholar]
  • 198.Krasin F, Hutchinson F. Repair of DNA double-strand breaks in Escherichia coli, which requires RecA function and the presence of a duplicate genome. J. Mol. Biol. 1977;116:81–98. doi: 10.1016/0022-2836(77)90120-6. [DOI] [PubMed] [Google Scholar]
  • 199.Kuczynska-Wisnik D, Kedzierska S, Matuszewska E, Lund P, Taylor A, Lipinska B, Laskowska E. The Escherichia coli small heat-shock proteins IbpA and IbpB prevent the aggregation of endogenous proteins denatured in vivo during extreme heat shock. Microbiology. 2002;148:1757–1765. doi: 10.1099/00221287-148-6-1757. [DOI] [PubMed] [Google Scholar]
  • 200.Lau IF, Filipe SR, Soballe B, Okstad OA, Barre FX, Sherratt DJ. Spatial and temporal organization of replicating Escherichia coli chromosomes. Mol Microbiol. 2003;49:731–743. doi: 10.1046/j.1365-2958.2003.03640.x. [DOI] [PubMed] [Google Scholar]
  • 201.Lavery PE, Kowalczykowski SC. Biochemical basis of the constitutive repressor cleavage activity of recA730 protein. J. Biol. Chem. 1992;29:20648–20658. [PubMed] [Google Scholar]
  • 202.Lavery PE, Kowalczykowski SC. Properties of recA441 protein-catalyzed DNA strand exchange can be attributed to an enhanced ability to compete with SSB protein. J Biol Chem. 1990;265:4004–4010. [PubMed] [Google Scholar]
  • 203.Layton JC, Foster PL. Error-prone DNA polymerase IV is controlled by the stress-response sigma factor, RpoS, in Escherichia coli. Mol. Microbiol. 2003;50:549–561. doi: 10.1046/j.1365-2958.2003.03704.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 204.LeBowitz JH, McMacken R. The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem. 1986;261:4738–4748. [PubMed] [Google Scholar]
  • 205.Lee JH, Wendt JC, Shanmugam KT. Identification of a new gene, molR, essential for utilization of molybdate by Escherichia coli. J Bacteriol. 1990;172:2079–2087. doi: 10.1128/jb.172.4.2079-2087.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 206.Lewis LK, Harlow GR, Gregg-Jolly LA, Mount DW. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 1994;241:507–523. doi: 10.1006/jmbi.1994.1528. [DOI] [PubMed] [Google Scholar]
  • 207.Lewis LK, Jenkins ME, Mount DW. Isolation of DNA-damage inducible promoters in E. coli: Regulation of polB (dinA), dinG, and dinH by LexA repressor. J. Bacteriol. 1992;174:3377–3385. doi: 10.1128/jb.174.10.3377-3385.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 208.Lifsics MR, Lancy ED, Jr, Maurer R. DNA replication defect in Salmonella typhimurium mutants lacking the editing (ɛ) subunit of DNA polymerase III. J. Bacteriol. 1992;174:6965–6973. doi: 10.1128/jb.174.21.6965-6973.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 209.Lin L, Little JW. Autodigestion and RecA-dependent cleavage of Ind- mutant LexA proteins. J. Mol. Biol. 1989;210:439–452. doi: 10.1016/0022-2836(89)90121-6. [DOI] [PubMed] [Google Scholar]
  • 210.Lin LL, Little JW. Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 1988;170:2163–2173. doi: 10.1128/jb.170.5.2163-2173.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 211.Little J. Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie. 1991;73:411–422. doi: 10.1016/0300-9084(91)90108-d. [DOI] [PubMed] [Google Scholar]
  • 212.Little JW. The SOS regulatory system: Control of its state by the level of recA protease. J. Mol. Biol. 1983;167:791–808. doi: 10.1016/s0022-2836(83)80111-9. [DOI] [PubMed] [Google Scholar]
  • 213.Little JW, Edmiston SH, Pacelli Z, Mount DW. Cleavage of the Escherichia coli lexA protein by the recA protease. Proc. Natl. Acad. Sci. U.S.A. 1980;77:3225–3229. doi: 10.1073/pnas.77.6.3225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 214.Little JW, Harper JE. Identification of the lexA gene product of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1979;76:6147–6151. doi: 10.1073/pnas.76.12.6147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 215.Little JW, Kim B, Roland KL, Smith MH, Lin LL, Slilaty SN. Cleavage of LexA repressor. Methods Enzymol. 1994;244:266–284. doi: 10.1016/0076-6879(94)44022-0. [DOI] [PubMed] [Google Scholar]
  • 216.Little JW, Kleid DG. Escherichia coli protein X is the recA gene product. J. Biol. Chem. 1977;252:6251–6252. [PubMed] [Google Scholar]
  • 217.Little JW, Mount DW. The SOS regulatory system of Escherichia coli. Cell. 1982;29:11–22. doi: 10.1016/0092-8674(82)90085-x. [DOI] [PubMed] [Google Scholar]
  • 218.Little JW, Mount DW, Yanisch-Perron CR. Purified lexA protein is a repressor of the recA and lexA genes. Proc. Natl. Acad. Sci. U.S.A. 1981;78:4199–4203. doi: 10.1073/pnas.78.7.4199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 219.Liu G, Draper GC, Donachie WD. FtsK is a bifunctional protein involved in cell division and chromosomal localization. Mol. Microbiol. 1998;29:893–903. doi: 10.1046/j.1365-2958.1998.00986.x. [DOI] [PubMed] [Google Scholar]
  • 220.Liu S-K, Tessman I. Error-prone SOS repair can be error-free. J. Mol. Biol. 1990;216:803–807. doi: 10.1016/S0022-2836(99)80001-1. [DOI] [PubMed] [Google Scholar]
  • 221.Livneh Z, Cohen-Fix O, Skaliter R, Elizur T. Replication of damaged DNA and the molecular mechanism of ultraviolet light mutagenesis. CRC Crit. Rev. Biochem. Mol. Biol. 1993;28:465–513. doi: 10.3109/10409239309085136. [DOI] [PubMed] [Google Scholar]
  • 222.Lloyd RG, Picksley SM, Prescott C. Inducible expression of a gene specific to the recF pathway for recombination in Escherichia coli K12. Mol. Gen. Genet. 1983;190:162–167. doi: 10.1007/BF00330340. [DOI] [PubMed] [Google Scholar]
  • 223.Lobner-Olesen A, Marinus MG, Hansen FG. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc Natl Acad Sci U S A. 2003;100:4672–4677. doi: 10.1073/pnas.0538053100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 224.Lobrich M, Jeggo PA. The impact of a negligent G2/M checkpoint on genomic instability and cancer induction. Nat Rev Cancer. 2007;7:861–869. doi: 10.1038/nrc2248. [DOI] [PubMed] [Google Scholar]
  • 225.Lomba MR, Vasconcelos AT, Pacheco AB, Almeida DFde. Identification of yebG as a DNA damage-inducible Escherichia coli gene. FEMS Microbiol Lett. 1997;156:119–122. doi: 10.1111/j.1574-6968.1997.tb12715.x. [DOI] [PubMed] [Google Scholar]
  • 226.Lombardo MJ, Aponyi I, Rosenberg SM. General stress response regulator RpoS in adaptive mutation and amplification in Escherichia coli. Genetics. 2004;166:669–680. doi: 10.1093/genetics/166.2.669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 227.Luo Y, Pfuetzner RA, Mosimann S, Paetzel M, Frey EA, Cherney M, Kim B, Little JW, Strynadka NCJ. Crystal structure of LexA: A conformational switch for regulation of self-cleavage. Mol. Cell. 2001;106:585–594. doi: 10.1016/s0092-8674(01)00479-2. [DOI] [PubMed] [Google Scholar]
  • 228.Lusetti SL, Hobbs MD, Stohl EA, Chitteni-Pattu S, Inman RB, Seifert HS, Cox MM. The RecF protein antagonizes RecX function via direct interaction. Mol Cell. 2006;21:41–50. doi: 10.1016/j.molcel.2005.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 229.Madiraju MV, Clark AJ. Use of recA803, a partial suppressor of recF, to analyze the effects of the mutant ssb (single-stranded DNA-binding) proteins in vivo and in vitro. Mol Gen Genet. 1990;224:129–135. doi: 10.1007/BF00259459. [DOI] [PubMed] [Google Scholar]
  • 230.Madiraju MV, Lavery PE, Kowalczykowski SC, Clark AJ. Enzymatic properties of the RecA803 protein, a partial suppressor of recF mutations. Biochemistry. 1992;31:10529–10535. doi: 10.1021/bi00158a016. [DOI] [PubMed] [Google Scholar]
  • 231.Madiraju MV, Templin A, Clark AJ. Properties of a mutant recA-encoded protein reveal a possible role for Escherichia colirecF-encoded protein in genetic recombination. Proc. Natl Acad. Sci. U.S.A. 1988;85:6592–6596. doi: 10.1073/pnas.85.18.6592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 232.Maiques E, Ubeda C, Campoy S, Salvador N, Lasa I, Novick RP, Barbe J, Penades JR. beta-lactam antibiotics induce the SOS response and horizontal transfer of virulence factors in Staphylococcus aureus. J Bacteriol. 2006;188:2726–2729. doi: 10.1128/JB.188.7.2726-2729.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 233.Maiques E, Ubeda C, Tormo MA, Ferrer MD, Lasa I, Novick RP, Penades JR. Role of staphylococcal phage and SaPI integrase in intra- and interspecies SaPI transfer. J Bacteriol. 2007;189:5608–5616. doi: 10.1128/JB.00619-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 234.Maples VF, Kushner SR. DNA repair in Escherichia coli: identification of the uvrD gene product. Proc. Natl. Acad. Sci. U.S.A. 1982;79:5616–5620. doi: 10.1073/pnas.79.18.5616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 235.Margolin W. Spatial regulation of cytokinesis in bacteria. Curr Opin Microbiol. 2001;4:647–652. doi: 10.1016/s1369-5274(01)00264-8. [DOI] [PubMed] [Google Scholar]
  • 236.Marsh L, Nohmi T, Hinton S, Walker GC. New mutations in cloned Escherichia coli umuDC genes: Novel phenotypes of strains carrying a umuC125 plasmid. Mutat. Res. 1991;250:183–197. doi: 10.1016/0027-5107(91)90175-n. [DOI] [PubMed] [Google Scholar]
  • 237.Marsh L, Walker GC. Cold sensitivity induced by overproduction of UmuDC in Escherichia coli. J. Bacteriol. 1985;162:155–161. doi: 10.1128/jb.162.1.155-161.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 238.McCool JD, Long E, Petrosino JF, Sandler HA, Rosenberg SM, Sandler SJ. Measurement of SOS expression in individual Escherichia coli K-12 cells using fluorescence microscopy. Mol Microbiol. 2004;53:1343–1357. doi: 10.1111/j.1365-2958.2004.04225.x. [DOI] [PubMed] [Google Scholar]
  • 239.McGrew DA, Knight KL. Molecular design and functional organization of the RecA protein. Crit. Rev. Biochem. Mol. Biol. 2003;38:385–432. doi: 10.1080/10409230390242489. [DOI] [PubMed] [Google Scholar]
  • 240.McKenzie GJ, Harris RS, Lee PL, Rosenberg SM. The SOS response regulates adaptive mutation. Proc. Natl. Acad. Sci. U.S.A. 2000;97:6646–6651. doi: 10.1073/pnas.120161797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 241.McNally KP, Freitag NE, Walker GC. LexA independent expression of a mutant mucAB operon. J. Bacteriol. 1990;172:6223–6231. doi: 10.1128/jb.172.11.6223-6231.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 242.Meddows TR, Savory AP, Grove JI, Moore T, Lloyd RG. RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand breaks. Mol Microbiol. 2005;57:97–110. doi: 10.1111/j.1365-2958.2005.04677.x. [DOI] [PubMed] [Google Scholar]
  • 243.Mellies JL, Haack KR, Galligan DC. SOS regulation of the type III secretion system of enteropathogenic Escherichia coli. J Bacteriol. 2007;189:2863–2872. doi: 10.1128/JB.01859-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 244.Menetski JP, Kowalczykowski SC. Biochemical properties of the Escherichia coli recA430 protein. Analysis of a mutation that affects the interaction of the ATP-recA protein complex with single-stranded DNA. J Mol Biol. 1990;211:845–855. doi: 10.1016/0022-2836(90)90078-Z. [DOI] [PubMed] [Google Scholar]
  • 245.Meyer RR, Glassberg J, Kornberg A. An Escherichia coli mutant defective in single-stranded binding protein is defective in DNA replication. Proc. Natl. Acad. Sci. U.S.A. 1979;76:1702–1705. doi: 10.1073/pnas.76.4.1702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 246.Miller C, Ingmer H, Thomsen LE, Skarstad K, Cohen SN. DpiA binding to the replication origin of Escherichia coli plasmids and chromosomes destabilizes plasmid inheritance and induces the bacterial SOS response. J Bacteriol. 2003;185:6025–6031. doi: 10.1128/JB.185.20.6025-6031.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 247.Miller C, Thomsen LE, Gaggero C, Mosseri R, Ingmer H, Cohen SN. SOS response induction by beta-lactams and bacterial defense against antibiotic lethality. Science. 2004;305:1629–1631. doi: 10.1126/science.1101630. [DOI] [PubMed] [Google Scholar]
  • 248.Miller HI, Friedman DI. An E. coli gene product required for lambda site-specific recombination. Cell. 1980;20:711–719. doi: 10.1016/0092-8674(80)90317-7. [DOI] [PubMed] [Google Scholar]
  • 249.Miller HI, Kikuchi A, Nash HA, Weisberg RA, Friedman DI. Site-specific recombination of bacteriophage lambda: the role of host gene products. Cold Spring Harb Symp Quant Biol. 1979;43(Pt. 2):1121–1126. doi: 10.1101/sqb.1979.043.01.125. [DOI] [PubMed] [Google Scholar]
  • 250.Miller HI, Kirk M, Echols H. SOS induction and autoregulation of the himA gene for site-specific recombination in E. coli. Proc. Natl. Acad. Sci. U.S.A. 1981;78:6754–6758. doi: 10.1073/pnas.78.11.6754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 251.Miller HI, Nash HA. Direct role of the himA gene product in phage integration. Nature (London) 1981;290:523–526. doi: 10.1038/290523a0. [DOI] [PubMed] [Google Scholar]
  • 252.Miyabe I, Zhang QM, Kano Y, Yonei S. Histone-like protein HU is required for recA gene-dependent DNA repair and SOS induction pathways in UV-irradiated Escherichia coli. Int J Radiat Biol. 2000;76:43–49. doi: 10.1080/095530000138998. [DOI] [PubMed] [Google Scholar]
  • 253.Mohana-Borges R, Pacheco AB, Sousa FJ, Foguel D, Almeida DF, Silva JL. LexA repressor forms stable dimers in solution. The role of specific DNA in tightening protein-protein interactions. J Biol Chem. 2000;275:4708–4712. doi: 10.1074/jbc.275.7.4708. [DOI] [PubMed] [Google Scholar]
  • 254.Moolenaar GF, Rossum-Fikkert Svan, Kesteren Mvan, Goosen N. Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair. Proc Natl Acad Sci U S A. 2002;99:1467–1472. doi: 10.1073/pnas.032584099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 255.Moore T, McGlynn P, Ngo HP, Sharples GJ, Lloyd RG. The RdgC protein of Escherichia coli binds DNA and counters a toxic effect of RecFOR in strains lacking the replication restart protein PriA. Embo J. 2003;22:735–745. doi: 10.1093/emboj/cdg048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 256.Morimatsu K, Kowalczykowski SC. RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange. A universal step of recombinational repair. Mol. Cell. 2003;11:1337–1347. doi: 10.1016/s1097-2765(03)00188-6. [DOI] [PubMed] [Google Scholar]
  • 257.Mount DW. Isolation and genetic analysis of a strain of Escherichia coli K-12 with an amber recA mutation. J. Bacteriol. 1971;107:388–389. doi: 10.1128/jb.107.1.388-389.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 258.Mount DW, Low KB, Edmiston S. Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet light-induced mutations. J. Bacteriol. 1972;112:886–893. doi: 10.1128/jb.112.2.886-893.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 259.Mount DW, Walker AC, Kosel C. Suppression of lex mutations affecting deoxyribonucleic acid repair in Escherichia coli K-12 by closely linked thermosensitive mutations. J. Bacteriol. 1973;116:950–956. doi: 10.1128/jb.116.2.950-956.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 260.Mukherjee A, Cao C, Lutkenhaus J. Inhibition of FtsZ polymerization by SulA, an inhibitor of septation in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1998;95:2885–2890. doi: 10.1073/pnas.95.6.2885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 261.Munoz M, Ancos Bde, Sanchez-Moreno C, Cano MP. Effects of high pressure and mild heat on endogenous microflora and on the inactivation and sublethal injury of Escherichia coli inoculated into fruit juices and vegetable soup. J Food Prot. 2007;70:1587–1593. doi: 10.4315/0362-028x-70.7.1587. [DOI] [PubMed] [Google Scholar]
  • 262.Murli S, Walker GC. SOS mutagenesis. Curr. Opin. Genet. Dev. 1993;3:719–725. doi: 10.1016/s0959-437x(05)80089-9. [DOI] [PubMed] [Google Scholar]
  • 263.Nakamura Y, Osawa T, Yura T. Chromosomal location of a structural gene for the RNA polymerase sigma factor in Escherichia coli. Proc Natl Acad Sci U S A. 1977;74:1831–1835. doi: 10.1073/pnas.74.5.1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 264.Nakanishi A, Oshida T, Matsushita T, Imajoh-Ohmi S, Ohnuki T. Identification of DNA gyrase inhibitor (GyrI) in Escherichia coli. J Biol Chem. 1998;273:1933–1938. doi: 10.1074/jbc.273.4.1933. [DOI] [PubMed] [Google Scholar]
  • 265.Napolitano R, Janel-Bintz R, Wagner J, Fuchs RP. All three SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis. Embo J. 2000;19:6259–6265. doi: 10.1093/emboj/19.22.6259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 266.Napolitano RL, Lambert IB, Fuchs RPP. SOS factors involved in translesion synthesis. Proc. Natl. Acad. Sci. USA. 1997;94:5733–5738. doi: 10.1073/pnas.94.11.5733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 267.Ndjonka D, Bell CE. Structure of a hyper-cleavable monomeric fragment of phage lambda repressor containing the cleavage site region. J Mol Biol. 2006;362:479–489. doi: 10.1016/j.jmb.2006.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 268.Neher SB, Flynn JM, Sauer RT, Baker TA. Latent ClpX-recognition signals ensure LexA destruction after DNA damage. Genes Dev. 2003;17:1084–1089. doi: 10.1101/gad.1078003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 269.Nohmi T, Battista JR, Dodson LA, Walker GC. RecA-mediated cleavage activates UmuD for mutagenesis: Mechanistic relationship between transcriptional derepression and posttranslational activation. Proc. Natl. Acad. Sci. U.S.A. 1988;85:1816–1820. doi: 10.1073/pnas.85.6.1816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 270.Nunoshiba T, Nishioka H. 'Rec-lac test' for detecting SOS-inducing activity of environmental genotoxic substance. Mutat Res. 1991;254:71–77. doi: 10.1016/0921-8777(91)90042-n. [DOI] [PubMed] [Google Scholar]
  • 271.Nurse P, Zavitz K, Marians K. Inactivation of the Escherichia coli PriA DNA replication protein induces the SOS response. J. Bacteriol. 1991;173:6686–6693. doi: 10.1128/jb.173.21.6686-6693.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 272.Oeda K, Horiuchi T, Sekiguchi M. The uvrD gene of E. coli encodes a DNA-dependent ATPase. Nature (London) 1982;298:98–100. doi: 10.1038/298098a0. [DOI] [PubMed] [Google Scholar]
  • 273.Opperman T, Murli S, Smith BT, Walker GC. A model for a umuDC-dependent prokaryotic DNA damage checkpoint. Proc. Natl. Acad. Sci. U.S.A. 1999;96:9218–9223. doi: 10.1073/pnas.96.16.9218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 274.Opperman T, Murli S, Walker GC. The genetic requirements for UmuDC-mediated cold sensitivity are distinct from those for SOS mutagenesis. J. Bacteriol. 1996;178:4400–4411. doi: 10.1128/jb.178.15.4400-4411.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 275.Ossanna N, Mount DW. Mutations in uvrD induce the SOS response in Escherichia coli. J. Bacteriol. 1989;171:303–307. doi: 10.1128/jb.171.1.303-307.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 276.Padan E, Schuldiner S. Intracellular pH regulation in bacterial cells. Methods Enzymol. 1986;125:337–352. doi: 10.1016/s0076-6879(86)25029-6. [DOI] [PubMed] [Google Scholar]
  • 277.Padan E, Zilberstein D, Rottenberg H. The proton electrochemical gradient in Escherichia coli cells. Eur J Biochem. 1976;63:533–541. doi: 10.1111/j.1432-1033.1976.tb10257.x. [DOI] [PubMed] [Google Scholar]
  • 278.Pages V, Koffel-Schwartz N, Fuchs RP. recX, a new SOS gene that is co-transcribed with the recA gene in Escherichia coli. DNA Repair (Amst) 2003;2:273–284. doi: 10.1016/s1568-7864(02)00217-3. [DOI] [PubMed] [Google Scholar]
  • 279.Papavinasasundaram KG, Anderson C, Brooks PC, Thomas NA, Movahedzadeh F, Jenner PJ, Colston MJ, Davis EO. Slow induction of RecA by DNA damage in Mycobacterium tuberculosis. Microbiology. 2001;147:3271–3279. doi: 10.1099/00221287-147-12-3271. [DOI] [PubMed] [Google Scholar]
  • 280.Papavinasasundaram KG, Movahedzadeh F, Keer JT, Stoker NG, Colston MJ, Davis EO. Mycobacterial recA is cotranscribed with a potential regulatory gene called recX. Mol Microbiol. 1997;24:141–153. doi: 10.1046/j.1365-2958.1997.3441697.x. [DOI] [PubMed] [Google Scholar]
  • 281.Patil RV, Dekker EE. Cloning, nucleotide sequence, overexpression, and inactivation of the Escherichia coli 2-keto-4-hydroxyglutarate aldolase gene. J Bacteriol. 1992;174:102–107. doi: 10.1128/jb.174.1.102-107.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 282.Patterson MF, Kilpatrick DJ. The combined effect of high hydrostatic pressure and mild heat on inactivation of pathogens in milk and poultry. J Food Prot. 1998;61:432–436. doi: 10.4315/0362-028x-61.4.432. [DOI] [PubMed] [Google Scholar]
  • 283.Payne N, Sancar A. The LexA protein does not bind specifically to the two SOS box-like sequences immediately 5' to the phr gene. Mutat. Res. 1989;218:207–210. doi: 10.1016/0921-8777(89)90005-0. [DOI] [PubMed] [Google Scholar]
  • 284.Peat TS, Frank EG, McDonald JP, Levine AS, Woodgate R, Hendrickson WA. Structure of the UmuD' protein and its regulation in response to DNA damage. Nature. 1996;380:727–730. doi: 10.1038/380727a0. [DOI] [PubMed] [Google Scholar]
  • 285.Pennington JM, Rosenberg SM. Spontaneous DNA breakage in single living Escherichia coli cells. Nat Genet. 2007;39:797–802. doi: 10.1038/ng2051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 286.Perry KL, Elledge SJ, Mitchell B, Marsh L, Walker GC. umuDC and mucAB operons whose products are required for UV light- and chemical-induced mutagenesis: UmuD, MucA, and LexA proteins share homology. Proc. Natl. Acad. Sci. U.S.A. 1985;82:4331–4335. doi: 10.1073/pnas.82.13.4331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 287.Peterson KR, Mount DW. Analysis of the genetic requirements for viability of Escherichia coli K-12 DNA adenine methylase (dam) mutants. J Bacteriol. 1993;175:7505–7508. doi: 10.1128/jb.175.22.7505-7508.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 288.Petit C, Cayrol C, Lesca C, Kaiser P, Thompson C, Defais M. Characterization of dinY, a new Escherichia coli DNA repair gene whose products are damage inducible even in a lexA(Def) background. J. Bacteriol. 1993;175:642–646. doi: 10.1128/jb.175.3.642-646.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 289.Pham P, Seitz EM, Saveliev S, Shen X, Woodgate R, Cox MM, Goodman MF. Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis. Proc. Natl. Acad. Sci. U.S.A. 2002;99:11061–11066. doi: 10.1073/pnas.172197099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 290.Picksley SM, Attfield PV, Lloyd RG. Repair of double-strand breaks in Escherichia coli requires a functional recN gene product. Mol. Gen. Genet. 1984;195:267–274. doi: 10.1007/BF00332758. [DOI] [PubMed] [Google Scholar]
  • 291.Picksley SM, Morton SJ, Lloyd RG. The recN locus of Escherichia coli K12: molecular analysis and identification of the gene product. Mol Gen Genet. 1985;201:301–307. doi: 10.1007/BF00425675. [DOI] [PubMed] [Google Scholar]
  • 292.Prasad TK, Yeykal CC, Greene EC. Visualizing the assembly of human Rad51 filaments on double-stranded DNA. J Mol Biol. 2006;363:713–728. doi: 10.1016/j.jmb.2006.08.046. [DOI] [PubMed] [Google Scholar]
  • 293.Prieto-Alamo MJ, Jurado J, Gallardo-Madueno R, Monje-Casas F, Holmgren A, Pueyo C. Transcriptional regulation of glutaredoxin and thioredoxin pathways and related enzymes in response to oxidative stress. J Biol Chem. 2000;275:13398–13405. doi: 10.1074/jbc.275.18.13398. [DOI] [PubMed] [Google Scholar]
  • 294.Qiu Z, Goodman MF. The Escherichia colipolB locus is identical to dinA, the structural gene for DNA polymerase II. Characterization of Pol II purified from a polB mutant. J Biol Chem. 1997;272:8611–8617. doi: 10.1074/jbc.272.13.8611. [DOI] [PubMed] [Google Scholar]
  • 295.Quillardet P, Huisman O, D'Ari R, Hofnung M. SOS chromotest, a direct assay of induction of an SOS function in Escherichia coli K-12 to measure genotoxicity. Proc. Natl. Acad. Sci. U.S.A. 1982;79:5971–5975. doi: 10.1073/pnas.79.19.5971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 296.Quillardet P, Rouffaud MA, Bouige P. DNA array analysis of gene expression in response to UV irradiation in Escherichia coli. Res Microbiol. 2003;154:559–572. doi: 10.1016/S0923-2508(03)00149-9. [DOI] [PubMed] [Google Scholar]
  • 297.Quinones A, Juterbock W, Messer W. Expression of the dnaA gene of Escherichia coli is inducible by DNA damage. Mol. Gen. Genet. 1991;227:9–16. doi: 10.1007/BF00260699. [DOI] [PubMed] [Google Scholar]
  • 298.Quinones M, Kimsey HH, Ross W, Gourse RL, Waldor MK. LexA represses CTXphi transcription by blocking access of the alpha C-terminal domain of RNA polymerase to promoter DNA. J Biol Chem. 2006;281:39407–39412. doi: 10.1074/jbc.M609694200. [DOI] [PubMed] [Google Scholar]
  • 299.Quinones M, Kimsey HH, Waldor MK. LexA cleavage is required for CTX prophage induction. Mol Cell. 2005;17:291–300. doi: 10.1016/j.molcel.2004.11.046. [DOI] [PubMed] [Google Scholar]
  • 300.Radman M. Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli: SOS repair hypothesis. In: Prakash L, Sherman F, Miller M, Lawrence C, Tabor HW, editors. Molecular and Environmental Aspects of Mutagenesis. Springfield, Ill: Charles C. Thomas; 1974. pp. 128–142. [Google Scholar]
  • 301.Rai R, Peng G, Li K, Lin SY. DNA damage response: the players, the network and the role in tumor suppression. Cancer Genomics Proteomics. 2007;4:99–106. [PubMed] [Google Scholar]
  • 302.Rand L, Hinds J, Springer B, Sander P, Buxton RS, Davis EO. The majority of inducible DNA repair genes in Mycobacterium tuberculosis are induced independently of RecA. Mol Microbiol. 2003;50:1031–1042. doi: 10.1046/j.1365-2958.2003.03765.x. [DOI] [PubMed] [Google Scholar]
  • 303.Rangarajan S, Gudmundsson G, Qiu Z, Foster PL, Goodman MF. Escherichia coli DNA polymerase II catalyzes chromosomal and episomal DNA synthesis in vivo. Proc Natl Acad Sci U S A. 1997;94:946–951. doi: 10.1073/pnas.94.3.946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 304.Rangarajan S, Woodgate R, Goodman MF. A phenotype for enigmatic DNA polymerase II: A pivotal role for pol II in replication restart in UV-irradiated Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 1999;96:9224–9229. doi: 10.1073/pnas.96.16.9224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 305.Rangarajan S, Woodgate R, Goodman MF. Replication restart in UV-irradiated Escherichia coli involving pols II, III, V, PriA, RecA and RecFOR proteins. Mol. Microbiol. 2002;43:617–628. doi: 10.1046/j.1365-2958.2002.02747.x. [DOI] [PubMed] [Google Scholar]
  • 306.Relan NK, Jenuwine ES, Gumbs OH, Shaner SL. Preferential interactions of the Escherichia coli LexA repressor with anions and protons are coupled to binding the recA operator. Biochemistry. 1997;36:1077–1084. doi: 10.1021/bi9618427. [DOI] [PubMed] [Google Scholar]
  • 307.Renzette N, Gumlaw N, Nordman JT, Krieger M, Yeh SP, Long E, Centore R, Boonsombat R, Sandler SJ. Localization of RecA in Escherichia coli K-12 using RecA-GFP. Mol Microbiol. 2005;57:1074–1085. doi: 10.1111/j.1365-2958.2005.04755.x. [DOI] [PubMed] [Google Scholar]
  • 308.Renzette N, Gumlaw N, Sandler SJ. DinI and RecX modulate RecA-DNA structures in Escherichia coli K-12. Mol Microbiol. 2007;63:103–115. doi: 10.1111/j.1365-2958.2006.05496.x. [DOI] [PubMed] [Google Scholar]
  • 309.Roberts JW, Roberts CW. Proteolytic cleavage of bacteriophage lambda repressor in induction. Proc. Natl. Acad. Sci. U.S.A. 1975;72:147–151. doi: 10.1073/pnas.72.1.147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 310.Rohrwild M, Coux O, Huang HC, Moerschell RP, Yoo SJ, Seol JH, Chung CH, Goldberg AL. HslV-HslU: A novel ATP-dependent protease complex in Escherichia coli related to the eukaryotic proteasome. Proc Natl Acad Sci U S A. 1996;93:5808–5813. doi: 10.1073/pnas.93.12.5808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 311.Roland KL, Little JW. Reaction of LexA repressor with diisopropylfluorophosphate: A test of the serine protease model. J. Biol. Chem. 1990;265:12828–12835. [PubMed] [Google Scholar]
  • 312.Roland KL, Smith MH, Rupley JA, Little JW. In vitro analysis of mutant LexA proteins with an increased rate of specific cleavage. J. Mol. Biol. 1992;228:395–408. doi: 10.1016/0022-2836(92)90829-9. [DOI] [PubMed] [Google Scholar]
  • 313.Rolfes RJ, Zalkin H. Escherichia coli gene purR encoding a repressor protein for purine nucleotide synthesis. Cloning, nucleotide sequence, and interaction with the purF operator. J Biol Chem. 1988;263:19653–19661. [PubMed] [Google Scholar]
  • 314.Rolfes RJ, Zalkin H. Regulation of Escherichia coli purF. Mutations that define the promoter, operator, and purine repressor gene. J Biol Chem. 1988;263:19649–19652. [PubMed] [Google Scholar]
  • 315.Rosenberg SM. Evolving responsively: adaptive mutation. Nat. Rev. Genet. 2001;2:504–515. doi: 10.1038/35080556. [DOI] [PubMed] [Google Scholar]
  • 316.Rosenberg SM, Hastings PJ. Rebuttal: adaptive mutation in Escherichia coli (Foster) J Bacteriol. 2004;186:4853. doi: 10.1128/JB.186.15.4853.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 317.Rosner JL, Kass LR, Yarmolinksy MB. Parallel behavior of F and Pl in causing indirect induction of lysogenic bacteria. Cold Spring Harbor Symp. Quant. Biol. 1968;33:785–789. doi: 10.1101/sqb.1968.033.01.090. [DOI] [PubMed] [Google Scholar]
  • 318.Roth JR, Andersson DI. Rebuttal: adaptive point mutation (Rosenberg and Hastings) J Bacteriol. 2004;186:4844. doi: 10.1128/JB.186.15.4844.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 319.Rothfield L, Taghbalout A, Shih YL. Spatial control of bacterial division-site placement. Nat Rev Microbiol. 2005;3:959–968. doi: 10.1038/nrmicro1290. [DOI] [PubMed] [Google Scholar]
  • 320.Rothman RH, Clark AJ. Defective excision and postreplication repair of UV-damaged DNA in a recL mutant strain of E. coli K-12. Molec. gen. Genet. 1977;155:267–277. doi: 10.1007/BF00272805. [DOI] [PubMed] [Google Scholar]
  • 321.Rothman RH, Clark AJ. The dependence of postreplication repair on uvrB in a recF mutant of Escherichia coli K-12. Molec. Gen. Genet. 1977;155:279. doi: 10.1007/BF00272806. [DOI] [PubMed] [Google Scholar]
  • 322.Ryan KR, Shapiro L. Temporal and spatial regulation in prokaryotic cell cycle progression and development. Annu Rev Biochem. 2003;72:367–394. doi: 10.1146/annurev.biochem.72.121801.161824. [DOI] [PubMed] [Google Scholar]
  • 323.Ryder L, Sharples GJ, Lloyd RG. Recombination-dependent growth in exonuclease-depleted recBC sbcBC strains of Escherichia coli K-12. Genetics. 1996;143:1101–1114. doi: 10.1093/genetics/143.3.1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 324.Salles B, Defais M. Signal of induction of recA protein in E. coli. Mutat. Res. 1984;131:53–59. doi: 10.1016/0167-8817(84)90011-7. [DOI] [PubMed] [Google Scholar]
  • 325.Sancar A, Sancar GB, Rupp WD, Little JW, Mount DW. LexA protein inhibits transcription of the E. coliuvrA gene in vitro. Nature (London) 1982;298:96–98. doi: 10.1038/298096a0. [DOI] [PubMed] [Google Scholar]
  • 326.Sancar GB, Sancar A, Little JW, Rupp WD. The uvrB gene of Escherichia coli has both lexA-repressed and lexA-independent promoters. Cell. 1982;28:523–530. doi: 10.1016/0092-8674(82)90207-0. [DOI] [PubMed] [Google Scholar]
  • 327.Sancar GB, Smith FW, Sancar A. Identification and amplification of the E. coli phr gene product. Nucleic Acids Res. 1983;11:6667–6678. doi: 10.1093/nar/11.19.6667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 328.Sandler SJ, Clark AJ. RecOR suppression of recF mutant phenotypes in Escherichia coli K-12. J Bacteriol. 1994;176:3661–3672. doi: 10.1128/jb.176.12.3661-3672.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 329.Sandler SJ, Samra HS, Clark AJ. Differential suppression of priA2::kan phenotypes in Escherichia coli K- 12 by mutations in priAlexA, and dnaC. Genetics. 1996;143:5–13. doi: 10.1093/genetics/143.1.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 330.Sargentini NJ, Smith KC. Quantitation of the involvement of the recA, recB, recC, recF, recJ, recN, lexA, radA, radB, uvrD, and umuC genes in the repair of X-ray-induced DNA double-strand breaks in Escherichia coli. Radiat. Res. 1986;107:58–72. [PubMed] [Google Scholar]
  • 331.Sassanfar M, Roberts JW. Nature of the SOS-inducing signal in Escherichia coli: The involvement of DNA replication. J. Mol. Biol. 1990;212:79–96. doi: 10.1016/0022-2836(90)90306-7. [DOI] [PubMed] [Google Scholar]
  • 332.Sauer RT, Ross MJ, Ptashne M. Cleavage of the λ and P22 repressors by RecA protein. J. Biol. Chem. 1982;257:4458–4462. [PubMed] [Google Scholar]
  • 333.Schlacher K, Leslie K, Wyman C, Woodgate R, Cox MM, Goodman MF. DNA polymerase V and RecA protein, a minimal mutasome. Mol Cell. 2005;17:561–572. doi: 10.1016/j.molcel.2005.01.006. [DOI] [PubMed] [Google Scholar]
  • 334.Schnarr M, Granger-Schnarr M, Hurstel S, Pouyet J. The carboxy-terminal domain of the LexA repressor oligomerises essentially as the entire protein. FEBS Lett. 1988;234:56–60. doi: 10.1016/0014-5793(88)81302-4. [DOI] [PubMed] [Google Scholar]
  • 335.Schnarr M, Oertel-Buchheit P, Kazmaier M, Granger-Schnarr M. DNA binding properties of the LexA repressor. Biochimie. 1991;73:423–431. doi: 10.1016/0300-9084(91)90109-e. [DOI] [PubMed] [Google Scholar]
  • 336.Schuldiner S, Agmon V, Brandsma J, Cohen A, Friedman E, Padan E. Induction of SOS functions by alkaline intracellular pH in Escherichia coli. J Bacteriol. 1986;168:936–939. doi: 10.1128/jb.168.2.936-939.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 337.Seong IS, Oh JY, Yoo SJ, Seol JH, Chung CH. ATP-dependent degradation of SulA, a cell division inhibitor, by the HslVU protease in Escherichia coli. FEBS Lett. 1999;456:211–214. doi: 10.1016/s0014-5793(99)00935-7. [DOI] [PubMed] [Google Scholar]
  • 338.Shan Q, Bork JM, Webb BL, Inman RB, Cox MM. RecA protein filaments: end-dependent dissociation from ssDNA and stabilization by RecO and RecR proteins. J. Mol. Biol. 1997;265:519–540. doi: 10.1006/jmbi.1996.0748. [DOI] [PubMed] [Google Scholar]
  • 339.Shen X, Sayer JM, Kroth H, Ponten I, O'Donnell M, Woodgate R, Jerina DM, Goodman MF. Efficiency and accuracy of SOS-induced DNA polymerases replicating benzo[a]pyrene-7,8-diol 9,10-epoxide A and G adducts. J. Biol. Chem. 2002;277:5265–5274. doi: 10.1074/jbc.M109575200. [DOI] [PubMed] [Google Scholar]
  • 340.Sherratt DJ. Bacterial Chromosome Dynamics. 2003;301:780–785. doi: 10.1126/science.1084780. [DOI] [PubMed] [Google Scholar]
  • 341.Shinagawa H, Iwasaki H, Kato T, Nakata A. RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 1988;85:1806–1810. doi: 10.1073/pnas.85.6.1806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 342.Shinagawa H, Kato T, Ise T, Makino K, Nakata A. Cloning and characterization of the umu operon responsible for inducible mutagenesis in Escherichia coli. Gene. 1983;23:167–174. doi: 10.1016/0378-1119(83)90048-3. [DOI] [PubMed] [Google Scholar]
  • 343.Shinagawa H, Makino K, Amemura M, Kimura S, Iwasaki H, Nakata A. Structure and regulation of the Escherichia coli ruv operon involved in DNA repair and recombination. J. Bacteriol. 1988;170:4322–4329. doi: 10.1128/jb.170.9.4322-4329.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 344.Shurvinton CE, Lloyd RG. Damage to DNA induces expression of the ruv gene of Escherichia coli. Mol. Gen. Genet. 1982;185:352–355. doi: 10.1007/BF00330811. [DOI] [PubMed] [Google Scholar]
  • 345.Siegel EC. The Escherichia coliuvrD gene is inducible by DNA damage. Mol. Gen. Genet. 1983;191:397–400. doi: 10.1007/BF00425753. [DOI] [PubMed] [Google Scholar]
  • 346.Sigal N, Delius H, Kornberg T, Gefter ML, Alberts B. A DNA-unwinding protein isolated from Escherichia coli: its interaction with DNA and with DNA polymerases. Proc Natl Acad Sci U S A. 1972;69:3537–3541. doi: 10.1073/pnas.69.12.3537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 347.Silver MS, Fersht AR. Direct observation of complexes formed between recA protein and a fluorescent single-stranded deoxyribonucleic acid derivative. Biochemistry. 1982;21:6066–6072. doi: 10.1021/bi00267a007. [DOI] [PubMed] [Google Scholar]
  • 348.Simmons LA, Grossman AD, Walker GC. Replication is required for the RecA localization response to DNA damage in Bacillus subtilis. Proc Natl Acad Sci U S A. 2007;104:1360–1365. doi: 10.1073/pnas.0607123104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 349.Sims J, Benz EW., Jr Initiation of DNA replication by the Escherichia coli dnaG protein: evidence that tertiary structure is involved. Proc Natl Acad Sci U S A. 1980;77:900–904. doi: 10.1073/pnas.77.2.900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 350.Singleton MR, Dillingham MS, Gaudier M, Kowalczykowski SC, Wigley DB. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature. 2004;432:187–193. doi: 10.1038/nature02988. [DOI] [PubMed] [Google Scholar]
  • 351.Slater SC, Lifsics MR, O'Donnell M, Maurer R. holE, the gene coding for the theta subunit of DNA polymerase III of Escherichia coli: characterization of a holE mutant and comparison with a dnaQ (epsilon-subunit) mutant. J Bacteriol. 1994;176:815–821. doi: 10.1128/jb.176.3.815-821.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 352.Smith M, Cavenaugh MM, Little JW. Mutant LexA proteins with an increased rate of in vivo cleavage. Proc. Natl. Acad. Sci. U.S.A. 1991;88:7356–7360. doi: 10.1073/pnas.88.16.7356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 353.Snyder M, Drlica K. DNA gyrase on the bacterial chromosome: DNA cleavage induced by oxolinic acid. J. Mol. Biol. 1979;131:287–302. doi: 10.1016/0022-2836(79)90077-9. [DOI] [PubMed] [Google Scholar]
  • 354.Sommer S, Knezevic J, Bailone A, Devoret R. Induction of only one SOS operon, umuDC, is required for SOS mutagenesis in E. coli. Mol. Gen. Genet. 1993;239:137–144. doi: 10.1007/BF00281612. [DOI] [PubMed] [Google Scholar]
  • 355.Sousa FJ, Lima LM, Pacheco AB, Oliveira CL, Torriani I, Almeida DF, Foguel D, Silva JL, Mohana-Borges R. Tetramerization of the LexA repressor in solution: implications for gene regulation of the E.coli SOS system at acidic pH. J Mol Biol. 2006;359:1059–1074. doi: 10.1016/j.jmb.2006.03.069. [DOI] [PubMed] [Google Scholar]
  • 356.Steinborn G. Uvm mutants of Escherichia coli K12 deficient in UV mutagenesis. I. Isolation of uvm mutants and their phenotypical characterization in DNA repair and mutagenesis. Mol. Gen. Genet. 1978;165:87–93. doi: 10.1007/BF00270380. [DOI] [PubMed] [Google Scholar]
  • 357.Stohl EA, Brockman JP, Burkle KL, Morimatsu K, Kowalczykowski SC, Seifert HS. Escherichia coli RecX inhibits RecA recombinase and coprotease activities in vitro and in vivo. J Biol Chem. 2003;278:2278–2285. doi: 10.1074/jbc.M210496200. [DOI] [PubMed] [Google Scholar]
  • 358.Story RM, Bishop DK, Kleckner N, Steitz TA. Structural relationship of bacterial RecA proteins to recombination proteins from bacteriophage T4 and yeast. Science. 1993;259:1892–1896. doi: 10.1126/science.8456313. [DOI] [PubMed] [Google Scholar]
  • 359.Story RM, Steitz TA. Structure of the RecA protein-ADP complex. Nature (London) 1992;355:374–376. doi: 10.1038/355374a0. [DOI] [PubMed] [Google Scholar]
  • 360.Story RM, Weber IT, Steitz TA. The structure of the E. coli recA protein monomer and polymer. Nature (London) 1992;355:318–325. doi: 10.1038/355318a0. [DOI] [PubMed] [Google Scholar]
  • 361.Sugino A, Peebles CL, Kreuzer KN, Cozzarelli NR. Mechanism of action of nalidixic acid: Purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme. Proc. Natl. Acad. Sci. U.S.A. 1977;74:4767–4771. doi: 10.1073/pnas.74.11.4767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 362.Sukchawalit R, Vattanaviboon P, Utamapongchai S, Vaughn G, Mongkolsuk S. Characterization of Xanthomonas oryzae pv. oryzae recX, a gene that is required for high-level expression of recA. FEMS Microbiol Lett. 2001;205:83–89. doi: 10.1111/j.1574-6968.2001.tb10929.x. [DOI] [PubMed] [Google Scholar]
  • 363.Sutton MD. The Escherichia coli dnaN159 mutant displays altered DNA polymerase usage and chronic SOS induction. J Bacteriol. 2004;186:6738–6748. doi: 10.1128/JB.186.20.6738-6748.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 364.Sutton MD, Farrow MF, Burton BM, Walker GC. Genetic interactions between the Escherichia coliumuDC gene products and the beta processivity clamp of the replicative DNA polymerase. J. Bacteriol. 2001;183:2897–2909. doi: 10.1128/JB.183.9.2897-2909.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 365.Sutton MD, Guzzo A, Narumi I, Costanzo M, Altenbach C, Ferentz AE, Hubbell WL, Walker GC. A model for the structure of the Escherichia coli SOS-regulated UmuD2 protein. DNA Repair (Amst) 2002;1:77–93. doi: 10.1016/s1568-7864(01)00006-4. [DOI] [PubMed] [Google Scholar]
  • 366.Sutton MD, Opperman T, Walker GC. The Escherichia coli SOS mutagenesis proteins UmuD and UmuD' interact physically with the replicative DNA polymerase. Proc. Natl. Acad. Sci. USA. 1999;96:12373–12378. doi: 10.1073/pnas.96.22.12373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 367.Sutton MD, Smith BT, Godoy VG, Walker GC. The SOS response: Recent insights into umuDC-dependent DNA damage tolerance. Annu. Rev. Genet. 2000;34:479–497. doi: 10.1146/annurev.genet.34.1.479. [DOI] [PubMed] [Google Scholar]
  • 368.Sweasy JB, Chen M, Loeb LA. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication. J Bacteriol. 1995;177:2923–2925. doi: 10.1128/jb.177.10.2923-2925.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 369.Trusca D, Scott S, Thompsopn C, Bramhill D. Bacterial SOS checkpoint protein SulA inhibits polymerization of purified FtsZ cell division protein. J. Bacteriol. 1998;180:3946–3953. doi: 10.1128/jb.180.15.3946-3953.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 370.Tsaneva IR, Illing G, Lloyd RG, West SC. Purification and properties of the RuvA and RuvB proteins of Escherichia coli. Molec. Gen. Genet. 1992:1–10. doi: 10.1007/BF00286175. [DOI] [PubMed] [Google Scholar]
  • 371.Tsaneva IR, Muller B, West SC. ATP-dependent branch migration of Holliday junctions promoted by the RuvA and RuvB proteins of E. coli. Cell. 1992;69:1171–1180. doi: 10.1016/0092-8674(92)90638-s. [DOI] [PubMed] [Google Scholar]
  • 372.Tseng YC, Hung JL, Wang TC. Involvement of RecF pathway recombination genes in postreplication repair in UV-irradiated Escherichia coli cells. Mutat Res. 1994;315:1–9. doi: 10.1016/0921-8777(94)90021-3. [DOI] [PubMed] [Google Scholar]
  • 373.Ubeda C, Barry P, Penades JR, Novick RP. A pathogenicity island replicon in Staphylococcus aureus replicates as an unstable plasmid. Proc Natl Acad Sci U S A. 2007 doi: 10.1073/pnas.0705994104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 374.Ubeda C, Maiques E, Knecht E, Lasa I, Novick RP, Penades JR. Antibiotic-induced SOS response promotes horizontal dissemination of pathogenicity island-encoded virulence factors in staphylococci. Mol Microbiol. 2005;56:836–844. doi: 10.1111/j.1365-2958.2005.04584.x. [DOI] [PubMed] [Google Scholar]
  • 375.Ubeda C, Maiques E, Tormo MA, Campoy S, Lasa I, Barbe J, Novick RP, Penades JR. SaPI operon I is required for SaPI packaging and is controlled by LexA. Mol Microbiol. 2007;65:41–50. doi: 10.1111/j.1365-2958.2007.05758.x. [DOI] [PubMed] [Google Scholar]
  • 376.Umezu K, Chi N-W, Kolodner RD. Biochemical interactions of the Escherichia coli RecF, RecO, and RecR proteins with RecA protein and single-stranded binding protein. Proc. Natl. Acad. Sci. U.S.A. 1993;90:3875–3879. doi: 10.1073/pnas.90.9.3875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 377.Umezu K, Kolodner RD. Protein interactions in genetic recombination in Escherichia coli. Interactions involving RecO and RecR overcome the inhibition of RecA by single-stranded DNA-binding protein. J. Biol. Chem. 1994;269:30005–30013. [PubMed] [Google Scholar]
  • 378.Umezu K, Nakayama K, Nakayama H. Escherichia coli RecQ protein is a DNA helicase. Proc. Natl. Acad. Sci. U.S.A. 1990;87:5363–5367. doi: 10.1073/pnas.87.14.5363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 379.VanLoock MS, Yu X, Yang S, Galkin VE, Huang H, Rajan SS, Anderson WF, Stohl EA, Seifert HS, Egelman EH. Complexes of RecA with LexA and RecX differentiate between active and inactive RecA nucleoprotein filaments. J. Mol. Biol. 2003;333:345–354. doi: 10.1016/j.jmb.2003.08.053. [DOI] [PubMed] [Google Scholar]
  • 380.VanLoock MS, Yu X, Yang S, Lai AL, Low C, Campbell MJ, Egelman EH. ATP-Mediated Conformational Changes in the RecA Filament. Structure (Camb) 2003;11:187–196. doi: 10.1016/s0969-2126(03)00003-0. [DOI] [PubMed] [Google Scholar]
  • 381.Vierling S, Weber T, Wohlleben W, Muth G. Transcriptional and mutational analyses of the Streptomyces lividans recX gene and its interference with RecA activity. J Bacteriol. 2000;182:4005–4011. doi: 10.1128/jb.182.14.4005-4011.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 382.Villani G, Pierre A, Salles B. Quantification of SSB protein in E. coli and its variation during RecA protein induction. Biochimie. 1984;66:471–476. doi: 10.1016/0300-9084(84)90082-8. [DOI] [PubMed] [Google Scholar]
  • 383.Villaverde A, Barbe J. SOS system induction in Escherichia coli cells with distinct levels of ribonucleotide reductase activity. Mutat Res. 1992;281:137–141. doi: 10.1016/0165-7992(92)90049-n. [DOI] [PubMed] [Google Scholar]
  • 384.Vogel J, Argaman L, Wagner EGH, Altuvia S. The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Current Biol. 2004 doi: 10.1016/j.cub.2004.12.003. In press. [DOI] [PubMed] [Google Scholar]
  • 385.Voloshin ON, Camerini-Otero RD. The DinG protein from Escherichia coli is a structure-specific helicase. J Biol Chem. 2007;282:18437–18447. doi: 10.1074/jbc.M700376200. [DOI] [PubMed] [Google Scholar]
  • 386.Voloshin ON, Ramirez BE, Bax A, Camerini-Otero RD. A model for the abrogation of the SOS response by an SOS protein: a negatively charged helix in DinI mimics DNA in its interaction with RecA. Genes Dev. 2001;15:415–427. doi: 10.1101/gad.862901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 387.Voloshin ON, Vanevski F, Khil PP, Camerini-Otero RD. Characterization of the DNA damage-inducible helicase DinG from Escherichia coli. J Biol Chem. 2003;278:28284–28293. doi: 10.1074/jbc.M301188200. [DOI] [PubMed] [Google Scholar]
  • 388.Wade JT, Reppas NB, Church GM, Struhl K. Genomic analysis of LexA binding reveals the permissive nature of the Escherichia coli genome and identifies unconventional target sites. Genes Dev. 2005;19:2619–2630. doi: 10.1101/gad.1355605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 389.Wagner J, Nohmi T. Escherichia coli DNA polymerase IV mutator activity: genetic requirements and mutational specificity. J. Bacteriol. 2000;182:4587–4595. doi: 10.1128/jb.182.16.4587-4595.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 390.Walker GC. Inducible DNA repair systems. Annu. Rev. Biochem. 1985;54:425–457. doi: 10.1146/annurev.bi.54.070185.002233. [DOI] [PubMed] [Google Scholar]
  • 391.Walker GC. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 1984;48:60–93. doi: 10.1128/mr.48.1.60-93.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 392.Walker GC. The SOS response of Escherichia coli. In: Neidhardt F, Ingraham JL, Low KB, Magasanik B, Schaecter M, Umbarger HE, editors. Escherichia coli and Salmonella typhimurium, cellular and molecular biology. Washington, DC: American Society for Microbiology; 1987. pp. 1346–1357. [Google Scholar]
  • 393.Walker GC. To cleave or not to cleave? Insights from the LexA crystal structure. Mol Cell. 2001;8:486–487. doi: 10.1016/s1097-2765(01)00337-9. [DOI] [PubMed] [Google Scholar]
  • 394.Wang L, Lutkenhaus J. FtsK is an essential cell division protein that is localized to the septum and induced as part of the SOS response. Mol Microbiol. 1998;29:731–740. doi: 10.1046/j.1365-2958.1998.00958.x. [DOI] [PubMed] [Google Scholar]
  • 395.Wang T-CV, Smith KC. Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coliuvrB cells. Mutat. Res. 1986;165:39–44. doi: 10.1016/0167-8817(86)90007-6. [DOI] [PubMed] [Google Scholar]
  • 396.Wang TC, Smith KC. Different effects of recJ and recN mutations on the postreplication repair of UV-damaged DNA in Escherichia coli K-12. J Bacteriol. 1988;170:2555–2559. doi: 10.1128/jb.170.6.2555-2559.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 397.Wang X, Cheung HW, Chun AC, Jin DY, Wong YC. Mitotic checkpoint defects in human cancers and their implications to chemotherapy. Front Biosci. 2008;13:2103–2114. doi: 10.2741/2827. [DOI] [PubMed] [Google Scholar]
  • 398.Wang Z, Lazarov E, O'Donnell M, Goodman MF. Resolving a fidelity paradox: why Escherichia coli DNA polymerase II makes more base substitution errors in AT- compared with GC-rich DNA. J Biol Chem. 2002;277:4446–4454. doi: 10.1074/jbc.M110006200. [DOI] [PubMed] [Google Scholar]
  • 399.Wechsler JA, Gross JD. Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol Gen Genet. 1971;113:273–284. doi: 10.1007/BF00339547. [DOI] [PubMed] [Google Scholar]
  • 400.Weigle JJ. Induction of mutation in a bacterial virus. Proc. Natl. Acad. Sci. U.S.A. 1953;39:628–636. doi: 10.1073/pnas.39.7.628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 401.Weiss DS. Bacterial cell division and the septal ring. Mol Microbiol. 2004;54:588–597. doi: 10.1111/j.1365-2958.2004.04283.x. [DOI] [PubMed] [Google Scholar]
  • 402.Wertman KF, Little JW, Mount DW. Rapid mutational analysis of regulatory loci in Escherichia coli K-12 using bacteriophage M13. Proc. Natl. Acad. Sci. U.S.A. 1984;81:3801–3805. doi: 10.1073/pnas.81.12.3801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 403.Wertman KF, Mount DW. Nucleotide sequence binding specificity of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 1985;163:376–384. doi: 10.1128/jb.163.1.376-384.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 404.Whitby MC, Lloyd RG. Altered SOS induction associated with mutations in recFrecO and recR. Mol. Gen. Genet. 1995;246:174–179. doi: 10.1007/BF00294680. [DOI] [PubMed] [Google Scholar]
  • 405.Witkin EM. The mutability towards ultraviolet light of recombination-deficient strains of Escherichia coli. Mutat. Res. 1969;8:9–14. doi: 10.1016/0027-5107(69)90135-3. [DOI] [PubMed] [Google Scholar]
  • 406.Witkin EM. Mutation-proof and mutation-prone modes of survival in derivatives of Escherichia coli B differing in sensitivity to ultraviolet light. Brookhaven Symp. Biol. 1967;20:495–503. [Google Scholar]
  • 407.Witkin EM. Thermal enhancement of ultraviolet mutability in a tif-1 uvrA derivative of Escherichia coli B/r: Evidence that ultraviolet mutagenesis depends upon an inducible function. Proc. Natl. Acad. Sci. U.S.A. 1974;71:1930–1934. doi: 10.1073/pnas.71.5.1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 408.Witkin EM. Ultraviolet mutagenesis and inducible DNA repair in Escherichia coli. Bacteriol. Rev. 1976;40:869–907. doi: 10.1128/br.40.4.869-907.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 409.Witkin EM, McCall JO, Volkert MR, Wermundsen IE. Constitutive expression of SOS functions and modulation of mutagenesis resulting from resolution of genetic instability at or near the recA locus of Escherichia coli. Mol. Gen. Genet. 1982;185:43–50. doi: 10.1007/BF00333788. [DOI] [PubMed] [Google Scholar]
  • 410.Wood LF, Tszine NY, Christie GE. Activation of P2 late transcription by P2 Ogr protein requires a discrete contact site on the C terminus of the alpha subunit of Escherichia coli RNA polymerase. J Mol Biol. 1997;274:1–7. doi: 10.1006/jmbi.1997.1390. [DOI] [PubMed] [Google Scholar]
  • 411.Woodgate R, Ennis DG. Levels of chromosomally encoded Umu proteins and requirements for in vivo UmuD cleavage. Mol. Gen. Genet. 1991;229:10–16. doi: 10.1007/BF00264207. [DOI] [PubMed] [Google Scholar]
  • 412.Wuytack EY, Diels AM, Michiels CW. Bacterial inactivation by high-pressure homogenisation and high hydrostatic pressure. Int J Food Microbiol. 2002;77:205–212. doi: 10.1016/s0168-1605(02)00054-5. [DOI] [PubMed] [Google Scholar]
  • 413.Yasuda T, Morimatsu K, Horii T, Nagata T, Ohmori H. Inhibition of Escherichia coli RecA coprotease activities by DinI. Embo J. 1998;17:3207–3216. doi: 10.1093/emboj/17.11.3207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 414.Yasuda T, Morimatsu K, Kato R, Usukura J, Takahashi M, Ohmori H. Physical interactions between DinI and RecA nucleoprotein filament for the regulation of SOS mutagenesis. Embo J. 2001;20:1192–1202. doi: 10.1093/emboj/20.5.1192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 415.Yasuda T, Nagata T, Ohmori H. Multicopy suppressors of the cold-sensitive phenotype of the pcsA68 (dinD68) mutation in Echerichia coli. J. Bacteriol. 1996;178:3854–3859. doi: 10.1128/jb.178.13.3854-3859.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 416.Yoo SJ, Seol JH, Kang MS, Chung CH. Poly-L-lysine activates both peptide and ATP hydrolysis by the ATP-dependent HslVU protease in Escherichia coli. Biochem Biophys Res Commun. 1996;229:531–535. doi: 10.1006/bbrc.1996.1838. [DOI] [PubMed] [Google Scholar]
  • 417.Yoo SJ, Seol JH, Shin DH, Rohrwild M, Kang MS, Tanaka K, Goldberg AL, Chung CH. Purification and characterization of the heat shock proteins HslV and HslU that form a new ATP-dependent protease in Escherichia coli. J Biol Chem. 1996;271:14035–14040. doi: 10.1074/jbc.271.24.14035. [DOI] [PubMed] [Google Scholar]
  • 418.Yu X, Egelman EH. The LexA repressor binds within the deep helical groove of the activated RecA filament. J. Mol. Biol. 1993;231:29–40. doi: 10.1006/jmbi.1993.1254. [DOI] [PubMed] [Google Scholar]
  • 419.Zlotnick A, Mitchell RS, Steed RK, Brenner SL. Analysis of two distinct single-stranded DNA binding sites on the recA nucleoprotein filament. J Biol Chem. 1993;268:22525–22530. [PubMed] [Google Scholar]

RESOURCES