Identification of two conserved B-cell epitopes targeting NSP4 of porcine reproductive and respiratory syndrome virus

Abstract

Porcine reproductive and respiratory syndrome virus (PRRSV) is a major pathogen that causes significant economic losses in the global swine industry. Its non-structural protein NSP4 is a 3 C-like serine protease (3CLSP), which plays a crucial role in viral polyprotein processing and replication. Here, we prepared two monoclonal antibodies (mAbs) against NSP4, which were designated as 7H10 and 1A2. To indentify the epitopes recognized by these mAbs, the NSP4 protein truncations were performed. The results showed that the minimal epitopes recognized by mAb 7H10 and mAb 1A2 were ¹²² VITEAGEL ¹²⁹ and ¹⁸⁹ VPSDLCALLA ¹⁹⁸, respectively. Alanine scanning analysis indicated that Ile¹²³, Thr¹²⁴, Gly¹²⁷, Glu¹²⁸, and Leu¹²⁹ are critical for mAb 7H10 recognition, while Val¹⁸⁹, Pro¹⁹⁰, Ser¹⁹¹, Asp¹⁹², and Leu¹⁹³ are critical for mAb 1A2 recognition. Moreover, these epitopes are highly conserved among PRRSV-2 strains. These findings provide a foundation for further research into the function of NSP4 and the pathogenic mechanisms of PRRSV.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-05164-2.

Introduction

Porcine reproductive and respiratory syndrome (PRRS) caused by porcine reproductive and respiratory syndrome virus (PRRSV) is one of the major threats to the global swine industry, posing significant economic losses [1]. PRRSV infection manifests as respiratory illness in piglets and severe reproductive problems such as miscarriage, stillbirth, and mummified fetuses in sows [2, 3], late-term miscarriage rates can exceed 30%, and neonatal mortality rates can reach 35% to 40% [4]. Additionally, PRRSV induces severe pulmonary inflammation and interstitial pneumonia, increasing the susceptibility of pigs to secondary infections [5, 6]. PRRSV is classified into two genotypes: PRRSV-1 (European-type) and PRRSV-2 (North American-type). Their complete genomes share only ~ 60% nucleotide identity, underscoring the profound genetic divergence between them. The prototype of PRRSV-1 is the Lelystad strain that emerged in Europe, whereas PRRSV-2 is exemplified by the VR-2332 strain first isolated in North America. China is currently dominated by PRRSV-2(e.g.NADC30-like [7] strain and NADC34-like strain [8]), which causes the more severe clinical presentation [9, 10]. Nevertheless, recent surveillance reveals that PRRSV-1 continues to expand its footprint and has already been detected in at least 28 Chinese provinces, prompting growing concern across the pig industry [11, 12].

PRRSV is a single-stranded, positive-sense RNA virus belonging to the family Arteriviridae. The genome is approximately 15 kb long and contains a critical region, ORF1, which includes two large open reading frames (ORF1a and ORF1b) [13–15]. The two ORFs encode polyproteins pp1a and pp1ab, which are cleaved by NSP4, a 3 C-like serine protease, consists of two antiparallel β-barrels (domains I and II) and a C-terminal α/β domain (domain III) into functional nonstructural proteins [16–21]. These proteins from pp1a and pp1ab cleaved by NSP4 subsequently form a replication-transcription complex (RTC) to facilitate viral replication [22]. NSP4 contains a His-Asp-Ser catalytic triad (His³⁹, Asp⁶⁴, and Ser¹¹⁸) located between domains I and II, which is essential for protease activity. Mutation of any of these residues results in a loss of NSP4 function [16, 23].

NSP4 utilizes its 3 C-like protease (3CLP) activity to cleave viral polyproteins and host immune factors, thereby playing a key role in viral replication and immune evasion [17–19, 21]. Overexpression of NSP4 enhances PRRSV replication [24], and PRRSV can replicate efficiently in the NSP4 overexpression cell line [25]. Additionally, NSP4 inhibits interferon production by blocking NF-κB activation and cleaving NEMO, thereby reducing IFN-β production [18]. It also upregulates PP2A activity and activates HMGCR, leading to increased intracellular cholesterol levels and inhibiting the host’s innate antiviral immunity [26]. Furthermore, NSP4 interacts with RBM39 to regulate c-Jun phosphorylation, promoting PRRSV infection [27], and with F-actin and myosin IIA to facilitate viral transmission [28].

Monoclonal antibodies (mAbs) are valuable tools for studying the interactions between viruses and their hosts, as well as for investigating viral immune evasion mechanisms. This study expressed PRRSV-2 NSP4 using a prokaryotic system and immunized BALB/c mice. Using hybridoma technology, we generated two mAbs, which were validated by Western blot and IFA. In addition, truncated overlapping peptides were used to identify two B-cell epitopes, and their conservation among PRRSV-2 strains was analyzed. These results provide a powerful tool for further research on the function of PPRSV NSP4.

Results

Expression and purification of NSP4-ΔHR protein

The amino acids between positions 145 and 168 of NSP4 are the key hinge region (HR) that determines nuclear localization, deletion of this segment can prevent NSP4 from entering the nucleus, deletion of the HR region would be beneficial to the NSP4 expression [29]. Thus, we generated a truncated NSP4 variant, NSP4-ΔHR, by deleting residues 145–168 (Fig. 1A and B). The positive plasmid was transformed into Escherichia coli BL21 (DE3) competent cells for NSP4 expression. The result showed that NSP4-ΔHR was mainly expressed in the supernatant, and the protein molecular weight was approximately 22 kDa (Fig. 2A). After expression and purification, proteins with relatively high purity were obtained (Fig. 2C).

Fig. 1.

Schematic diagram of the construction and transformation of NSP4-ΔHR. A The position of HR rejoins (145-168aa) in NSP4 protein. B Construction and transformation of pET-28a-NSP4-ΔHR

Fig. 2.

Expression and purification of the NSP4-ΔHR protein. A Expression of pET28a-NSP4-ΔHR in E. coli BL21(DE3) was analyzed by SDS-PAGE. Lane M, protein molecular weight marker; Lane 1, ultrasonic lysis of the whole bacterial solution; Lane 2, lysate supernatant; Lane 3, lysate pellet. B SDS-PAGE analysis of purification of NSP4-ΔHR recombinant protein. After ultrasonic centrifugation, post-sonication supernatant was incubated with Ni-NTA resin for 1 h, and elution with 150 mM (lane 1), 200 mM (lane 2), 250 mM (lane 3), and 300 mM (lane 4) imidazole. Lane M: protein molecular weight marker. C Western blot analysis of NSP4-ΔHR by His-tag monoclonal antibody

Preparation of mAbs against NSP4 protein

The purified recombinant NSP4-ΔHR was used to immunize 4–6 weeks BALB/c mice, their splenocytes were then fused with SP/20 cells to generate hybridoma cells secreting specific monoclonal antibodies. Hybridoma cell supernatants were tested by IFA, and two hybridoma clones stably expressing and secreting antibodies against NSP4 were obtained and named 1A2 and 7H10 (Fig. 3A). We constructed pCI-NSP4 expression plasmid and transfected into 293 T cells. Western blot analysis revealed clear bands at approximately 22 kDa in the transfected pCI-NSP4 and HuN4-infected marc-145 cell samples incubated with mAbs 1A2 and 7H10, while no such bands were observed in cells transfected with empty plasmids and pig positive serum (Fig. 3B, Supplementary Material, Fig. 9). These results indicate that mAb 1A2 and 7H10 specifically recognize the linear epitopes of NSP4.

Fig. 3.

Identification of mAbs. A Indirect immunofluorescence assay (IFA) detection of PRRSV-infected marc-145 cells using mAb 7H10 and 1A2. marc-145 cells were infected with PRRSV at an MOI of 0.1 for 3 days, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 for 1 h. The cells were incubated with mAb 7H10, 1A2 and PRRSV N protein antibody (PC) as primary antibodies. The results were observed under an inverted fluorescence microscope. B Western blot analysis of NSP4 expression in 293 T cells. 293 T cells were transfected with pCI-NSP4 plasmids and empty plasmid for 24 h, lysed, and analyzed by Western blot using mAb 7H10 and 1A2 as primary antibodies

Mapping the epitopes recognized by mAb 7H10 and 1A2

The NSP4-ΔHR protein was divided into five overlapping fragments (Fig. 4A) and cloned into the pGEX-6p-1 vector for expression, respectively. SDS-PAGE showed that all the constructed expression plasmids were expressed in E. coli BL21 (DE3) (Fig. 4B). The Western blot results revealed that the mAb 7H10 recognized the overlapping parts of P4-4 and P4-5, a 16-amino acid sequence, ¹²⁰SPVITEAGELVGVHTG¹³⁵ (Fig. 4C), whereas the mAb 1A2 recognized peptide segment P4-5 (Fig. 4D). To further determine the minimal epitope, sequential truncation was performed. For mAb 7H10, both the SDS-PAGE and Western blot indicated the minimal recognition epitope as ¹²²VITEAGEL¹²⁹ (Fig. 5B). For mAb 1A2, peptide fragment P4-5 was further divided into three overlapping segments P51, P52, and P53 (Fig. 6A). Western blot analysis revealed that mAb 1A2 recognized segments P52 and P53, with weaker recognition of segment P52 (Fig. 6B). Further analysis identified the epitope as ¹⁸⁹VPSDLCALLAAKPELE²⁰⁴, with the minimal epitope was ¹⁸⁹VPSDLCALLA¹⁹⁸ (Fig. 6D).

Fig. 4.

Identification of linear epitope that can be recognized by mAb 1A2 and 7H10 (A) schematic diagram of the design of truncated gene fragments spanning the NSP4-ΔHR protein and the position of the identified epitope. mAb 7H10 and 1A2 recognized specific regions (red lines), while black fragments did not react. B SDS-PAGE analysis of truncated NSP4-ΔHR segments expression. C and D Western blot analysis of the reactivity between the NSP4-ΔHR protein fragments and mAbs. mAb 7H10 recognized segments P4-4 and P4-5 (C), while 1A2 recognized segment p4-5 (D)

Fig. 5.

Amino Acid Truncation Expression and Alanine Mutation Analysis of mAb 7H10. A Schematic diagram of the B-cell epitope mapping of NSP4-ΔHR protein recognized by mAb 7H10. Two amino acids from the N-terminus or C-terminus were truncated respectively. The red amino acids indicate peptides that reacted with mAb 7H10, while grey amino acids represent peptides that did not react with mAb7H10. B The peptides expressed were analyzed by SDS-PAGE Coomassie brilliant blue staining and Western blot with mAb 7H10. C Schematic diagram of alanine mutation of the minimum epitopes identified by mAb 7H10. D The peptides expressed were analyzed by SDS-PAGE Coomassie brilliant blue staining and Western blot with mAb 7H10

Fig. 6.

Characterization of the recognition epitope of mAb 1A2. A Schematic diagram of segment P4-5 further truncation. B SDS-PAGE Coomassie brilliant blue staining and Western blot analysis with mAb 1A2 of the reactivity of segment P4-5 truncated frgment. C Schematic diagram of the B-cell epitope mapping of P523 recognized by mAb 1A2. Two amino acids from the N-terminus or C-terminus were truncated respectively. The red amino acids indicate peptides that reacted with mAb 1A2, while grey amino acids represent peptides that did not react with mAb 1A2. D SDS-PAGE Coomassie brilliant blue staining and Western blot analysis with mAb 1A2. E Schematic diagram of alanine mutation of the minimum epitopes identified by mAb 1A2. F The peptides expressed were analyzed by SDS-PAGE Coomassie brilliant blue staining and Western blot with mAb 1A2

Crucial amino acid mutations analysis

To identify the key residues recognized by the mAbs 1A2 and 7H10, we individually replaced each amino acid in the motifs ¹²²VITEAGEL¹²⁹ and ¹⁸⁹VPSDLCALLA¹⁹⁸ with alanine (Figs. 5C and 6E). Western blot analysis revealed that the mutation of Ile¹²³, Thr¹²⁴, Gly¹²⁷, Glu¹²⁸, or Leu¹²⁹ with alanine led to the mAb 7H10 fail to recognize the epitope¹²²VITEAGEL¹²⁹ (Fig. 5D), indicating that Ile¹²³, Thr¹²⁴, Gly¹²⁷, Glu¹²⁸, or Leu¹²⁹ are critical for the affinity between the epitope and mAb 7H10. Similarly, mutations of Val¹⁸⁹, Pro¹⁹⁰, Ser¹⁹¹, Asp¹⁹², or Leu¹⁹³ eliminated the binding activity of the epitope¹⁸⁹VPSDLCALLA¹⁹⁸ to mAb 1A2 (Fig. 6F). This finding revealed that the sequence ¹⁸⁹VPSDL¹⁹³ is essential for the binding activity between the epitope and mAb 1A2. Additionally, sequence alignment analysis via Jalview revealed that both minimal epitopes recognized by mAb 7H10 and 1A2 are highly conserved among PRRSV-2 strains (Fig. 7A) with a secondary structure β-strand and α-helix (Fig. 7B).

Fig. 7.

Multiple sequence alignment and structural analysis of PRRSV-2 NSP4. A Sequence alignment analysis of the identified epitopes waas performed using jalview2.22.5.0 software. The sequence alignment of the epitopes ¹²²VITEAGEL¹²⁹ and ¹⁸⁹VPSDLCALLA¹⁹⁸ among different PRRSV-2 isolates. B Cartoon representation of the overall structure of PRRSV nsp4 (PDB ID: 3FAN). The ¹²²VITEAGEL¹²⁹ and ¹⁸⁹VPSDLCALLA¹⁹⁸ epitopes were highlighted in iridescent and purple, respectively

Discussion

NSP4, a multifunctional protein with 3 C-like serine protease activity, contains dominant B-cell epitopes and is highly conserved, which cleaves viral polyprotein into multiple nonstructural proteins and can be detected in the early stage of PRRSV infection [30]. As a crucial protease encoded by PRRSV, NSP4 can inhibit IFN-β to antagonize host innate immunity by cleaving MAVS [19], NEMO [17], ZAP [31], pDCPla [32], and IKKα [33]. It can also downregulate SLA-I and induce caspase-3-dependent apoptosis, thereby promoting PRRSV infection [34]. These studies indicate that, in addition to its central role in the expression and processing of the viral replicase as a 3 C-like protease, NSP4 can induce host cell apoptosis and immune evasion. Therefore, NSP4 is a key target protein for research on the pathogenesis of PRRSV and drug design.

Currently, information on the preparation and epitope identification of NSP4 monoclonal antibodies remains relatively limited, as most studies have predominantly focused on the development of polyclonal antibodies. For instance, Cai et al. immunized New Zealand white rabbits with purified NSP4 protein to generate polyclonal antibodies capable of recognizing the NSP4 protein in PRRSV-infected host cells [35]. Furthermore, the NSP4 protein from the PRRSV XH-GD strain was employed as a coating antigen to detect PRRSV-specific antibodies in porcine serum. This method achieved a coincidence rate of 91.74% when compared to the commercial IDEXX PRRS ELISA kit, effectively distinguishing antibodies resulting from natural infections [36]. Additionally, NSP4-based indirect ELISA (iELISA) demonstrated a 92.2% consistency with the traditional N protein iELISA, successfully identifying false-negative reactions to highly pathogenic PRRSV vaccines [37]. These results indicate that the detection method based on NSP4 protein can be utilized for diagnostic purposes. In this study, the two mAbs 7H10 and 1A2 we prepared exhibited good IFA reactivity with the HuN4, NADC30-like, and NADC34-like strains, but did not react with the PRRSV-1-DV vaccine strain kept in our laboratory (Fig. 3A, Supplementary materials Fig. 8). This result may indicate that these two mAbs have the potential to distinguish between PRRSV-1 and PRRSV-2. However, whether they react with other PRRSV-2 strains and do not react with other PRRSV-1 strains requires further experimental analysis.

Furthermore, NSP4 is expressed in the early stages of viral replication and cleaves the pp1a/pp1ab polyproteins to generate the nonstructural proteins required for the replication-transcription complex (RTC) [30]. Although NSP4 plays a crucial role in the replication process, it is not a structural component of the virus particle and is therefore typically undetectable in mature PRRSV virus particles. Consistent with the Western blot experiments in this study, no distinct bands were observed when mAbs 1A2 and 7H10 were used as primary antibodies in PRRSV-2 porcine positive serum, on the contrary, samples from HuN4-infected marc-145 cell samples exhibited bands consistent with the theoretical size (Supplementary materials Fig. 9). These results indicate that both mAbs have good reactivity with the HuN4 strain.

Epitopes are crucial antigenic determinants of viral structural proteins, inducing antiviral immune responses and cellular immunity, which can be classified into B-cell and T-cell epitopes based on receptor types, and into linear and conformational epitopes based on structural characteristics. MAbs are key tools for identifying viral protein epitopes. A double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was established based on the 2D11 epitope (¹³⁸ KQGGGIVTRPSGQFCN¹⁵³) of NSP4 was shown to be an effective tool to compensate for the false negatives associated with an iELISA method with the N protein as coating antigen, especially on pig farms where PRRSV antibody levels varied widely [38]. This shows that by identifying the specific epitopes of NSP4, highly specific diagnostic reagents can be developed for the early detection of PRRSV infection. In this study, we prepared two mAbs 7H10 and 1A2, which were two new conserved epitopes ¹²²VITEAGEL¹²⁹ and ¹⁸⁹VPSDLCALLA¹⁹⁸ of NSP4. However, compared with NSP1, NSP2, NSP7 and NSP8, the antibody levels against NSP4 in PRRSV-infected pigs are relatively low, so we abandoned the development of an iELISA method [39]. Unexpectedly, in the alanine mutation analysis, the two mAbs failed to recognize the mutant peptides at position Ile¹²³, Thr¹²⁴, Gly¹²⁷, Glu¹²⁸, Leu¹²⁹ of peptides ¹²²VITEAGEL¹²⁹ and Val ¹⁸⁹, Pro¹⁹⁰, Ser¹⁹¹, Asp¹⁹², Leu¹⁹³of peptides ¹⁸⁹VPSDLCALLA¹⁹⁸(Figs. 5D and 6F). A possible explanation is that although the surrounding residues may not directly promote the binding interaction between epitopes and antibodies, the flank residues can affect the formation of the correct peptide conformation recognized by antibodies. The individual presence of ¹²³IT²⁴, ¹²⁷GEL¹²⁹ and ¹⁸⁹VPSDL¹⁹³ at the end of their flanking wings may stabilize the correct epitope conformation for antibody recognition and binding. The aa residues Val¹²², Glu¹²⁵ and ¹⁹⁴CALLA¹⁹⁸ can be replaced by alanine alone without completely losing their binding ability. Therefore, the alanine scanning mutagenesis results indicate that these aa residues may play an insignificant role in the recognition and binding of mAbs.

In summary, we prepared two monoclonal antibodies 1A2 and 7H10 targeting the NSP4 protein. These mAbs specifically recognize novel epitopes on the NSP4 protein. Our study provided a basis for the development of differential diagnostic detection methods for PRRSV and further research on the function of NSP4 protein.

Materials and methods

Cells, virus and reagents

Marc-145 cells, 293 T cells and SP/20 cells were purchased from the American Type Culture Collection and were preserved in our laboratory that grew in Dulbecco′s Modified Eagle′s Medium supplemented with 10% FBS (Gibco-BRL, Grand Island, NY, USA), 1% L-glutamine and 2% penicillin and streptomycin; the HP-PRRSV HuN4 strain(GenBank accession no. EF635006), PRRSV-1-DV vaccine strain (GenBank accession no. MT311646), NADC30-like strain and NADC34-like strain (unpublished data) were isolated and kept in our laboratory that using to infect marc-145 cells for IFA, porcine positive serum; BL21(DE3) Competent cells were purchased from Weidi Bio Co., LTD. (China) and stored at −80℃; Ni Sepharose 6 Fast Flow(GE); PrimeSTAR Max DNA Polymerase (Code No. R045A) was purchased from TaKaRa; IPTG, imidazole, Triton X-100 were from Sigma (USA); FITC-conjugated goat anti-mouse IgG (Sigma, St. Louis, MO, USA) and DyLight 800-labeled anti-mouse IgG (H + L) antibody (KPL, USA) were purchased from Serotec (UK); PEG-6000 (Sigma-Aldrich, USA); hypoxanthine-aminopterin-thymidine (HAT) and hypoxanthine-thymidine(HT) (Sigma-Aldrich, USA). All chemical reagents were from commercial sources and of analytical grade.

Construction of pET-28a-NSP4-ΔHR expression plasmid

The nsp4-ΔHR fragment from PRRSV HuN4 was PCR-amplified with primers carrying 15-bp homologous arms and embedded NcoI/XhoI sites. After 35 cycles (98 °C 2 min; 95 °C 30 s, 55 °C 30 s, 72 °C 5 s) using PrimeSTAR Max polymerase (TaKaRa, R045A), the amplified product was gel-extraction (1% agarose, HiBind mini-column, Omega J0582). The fragment was then recombined into Nco I-Xho I-linearized pET-28a at 55 °C for 50 min, and the resulting plasmid was transformed into E. coli BL21(DE3) competent cells.

Expression and purification of pET-28a-NSP4-ΔHR protein

The resulting products were added to 50µL of E. coli BL21 (DE3) competent cells, incubated on ice for 30 min, and then heat shocked at 42 °C for 90 s. The cells were resuspended in 700µL of antibiotic-free LB medium (5 g yeast extract, 10 g pancreatic peptone and 10 g sodium chloride,1 L), incubated at 37 °C with shaking at 200 rpm for 1 h. After centrifuged at 2000 rpm for 5 min, the pellet was resuspended in the remaining supernatant, and a 100µL supernatant was spread on LB agar plates containing 1% ampicillin. After overnight incubation at 37 °C, a single, colony was selected and inoculated into 4 mL of LB medium containing 1% ampicillin. The culture was incubated at 37 °C with shaking at 200 rpm for 6–8 h and 2 mL was taken for sequencing. Sequencing-confirmed bacterial cultures were activated and transferred to a 100 mL conical flask at a 1:1000 dilution ratio and incubated. When the optical density (OD600) of the bacterial culture reached 0.6–0.8, IPTG was added to a final concentration of 0.1 mM for induction and expression for 20 h. After ammonium sulfate precipitation, the supernatant was filtered through a 0.22–0.45 μm filter membrane and incubated with Ni-NTA resin equilibrated in 5–10 volumes of equilibration buffer at 4 °C for 1–2 h. Impurities were removed by washing with PB buffer (0.2 M NaH₂PO₄・H₂O; 0.2 M Na₂HPO₄・7H₂O; pH 7.5) containing 50 mM and 80 mM imidazole to eliminate unbound and nonspecifically bound proteins. Gradient elution was then performed via PB buffer with imidazole concentrations of 150 mM、200 mM、250 mM and 300 mM imidazole.

Mouse experiment

Female BALB/c mice (4–6 weeks old) were purchased from the Experimental Animal Center of the Harbin Veterinary Research Institute (HVRI) and were housed in independent ventilation cages in the B3 laboratory. After a one-week acclimation period, each mouse received an intramuscular injection with a total of 200µL of the mixture containing 40 µg NSP4 protein and equal volume ISA 201 adjuvant. Serum titers were measured one week after the third immunization, which was spaced 14 days apart from the previous injections. Mice suitable for fusion received an intraperitoneal booster immunization with 80 µg of protein without adjuvant. Three days after re-immunization, the mice were euthanized by CO₂ inhalation and cervical dislocation, and the spleen cells were isolated and were fused with SP2/0 myeloma cells at a 1:7 ratio using PEG-6000 in a 37 °C water bath. The fused cells were resuspended in DMEM containing 1× HAT, 20% FBS, and 2% SP plated into 96-well plates, and incubated at 37 °C with 5% CO₂. The supernatants were tested for antibody production 7 d later. Positive clones were subcloned 2–3 times by limited dilution until the antibody positivity rate reached 100%. Stable antibody-secreting hybridoma cell lines were expanded and cryopreserved in liquid nitrogen for long-term storage.

Indirect Immunofluorescence assay (IFA)

Marc-145 cells in 96-well plates were infected with the wild-type HuN4 virus at a multiplicity of infection (MOI) of 0.1. After 3–5 days, the cells were fixed with 4% paraformaldehyde, permeabilized with 1%Triton X-100, and blocked with 1% BSA. The cells were then incubated with supernatants of mAbs 1A2 and 7H10 as primary antibodies, with mAb 1H4 against N protein as the positive control and mouse negative serum as the negative control, at 37 °C for 1 h. Next, the cells were subsequently incubated with FITC-conjugated goat anti-mouse IgG secondary antibody at 37 °C for 1 h. Finally, after washing with PBST, the results were observed under an inverted fluorescence microscope.

Western blot

NSP4 eukaryotic expression plasmids were constructed and transfected into 293 T cells. After 24 h, the cells were lysed on ice with RIPA buffer. The cell lysate was mixed with protein loading buffer, denatured, and separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% SDS-PAGE) before being transferred to a PVDF membrane. The membrane was blocked with 5% BSA and incubated with the mAbs 7H10 and 1A2 at 37 °C for 1 h. After three washes with PBST, the membrane was probed with a 1:10,000 dilution of DyLight 800-labeled anti-mouse IgG (H + L) for 1 h and the result was then visualized via Odyssey CLx Image Studio (LI-COR, USA). Additionally, based on the NSP4 amino acid sequence, a series of truncated or mutated peptides were designed and inserted into the pGEX-6P-1 vector via the Bam HI and XhoI restriction sites. The constructs were subsequently transformed into E. coli BL21(DE3), which was subsequently expressed for 12 h at 37 °C with 0.1 mM IPTG. After isolating the protein by 12% SDS-PAGE, the protein was transferred to the PVDF membrane, the membrane was blocked with 5% skim milk and incubated with mAbs 7H10 and 1A2 at 37 °C for 1 h. Next, the membrane was incubated with Goat Anti-mouse(H + L) for 1 h at 37 °C. Finally, the membrane was then visualized via a thin-film exposure system. The primers used are listed in Table 1.

Table 1.

Primers used for NSP4-HR expression and truncation identification

Primer name	Primer sequence 5 ‘to 3’
28a-NSP4-F	TAACTTTAAGAAGGAGATATACCATGGGCGCTTTCAGAACTCA
28a-NSP4-R	GTGATGTGATCCCCCTCCTCCCTCGAGTTCCAGTTCGGGTTTGGC
HR-F	CAAGGAGGAGGCATTGTCCCTAAGGTCCCGCTCGGT
HR-R	ACCGAGCGGGACCTTAGGGACAATGCCTCCTCCTTG
4-1-F	ccacgtgggtccCTGGGATCCGGCGCTTTCAGAACT
4-1-R	CGATGCGGCCGCTCGAGCTACTATGAGTTACCCGTAAG
4-2-F	cacgtgggtccCTGGGATCCGGGAAAATCAAGTGCG
4-2-R	GATGCGGCCGCTCGAGCTACTACCCTTGCCAATTCGG
4-3-F	cacgtgggtccCTGGGATCCGATGTAAAAGGGGACTT
4-3-R	TGCGGCCGCTCGAGCTACTACCCAATAACACCGGgtT
4-4-F	accacgtgggtccCTGGGATCCCGCGCCTATTGGCTG
4-4-R	ATGCGGCCGCTCGAGCTACTATCCTGTGTGAACGCCA
4–5-F	cacgtgggtccCTGGGATCCTCCCCAGTGATTACCG
4–5-R	GATGCGGCCGCTCGAGCTACTACTATTCCAGTTCGGGTTTG
1A2-45-F	GGGCCCCTGGGATCCTCCCCAGTGATTACCGA
1A2-45-1-R	GATGCGGCCGCTCGAGGGTAATCACTGGGGA
1A2-45-2-F	GGGCCCCTGGGATCCGGCGTTCACACAGGA
1A2-45-2-R	GATGCGGCCGCTCGAGTCCTGTGTGAACGCC
7H10-34-F	GGGCCCCTGGGATCCCGCGCCTATTGGCTGA
7H10-34-R	GATGCGGCCGCTCGAGCCCAATAACACCGGgtTCaACGCCA
1A2-5-1-F	CCAGGGGCCCCTGGGATCCTCAAACAAACAAGGAGG
1A2-5-1-R	GTCACGATGCGGCCGCTCGAGTTTAATTATGTGACTG
1A2-5-3-R	CGATGCGGCCGCTCGAGTTCCAGTTCGGGTTTGGCA
1A2-5-2-F	GGGGCCCCTGGGATCCCCTAAGGTCCCGCTCGG
1A2-5-2-R	TCACGATGCGGCCGCTCGAGACAAAGATCTGAAGGC
1A2-5-3-F	GGGGCCCCTGGGATCCGGCAGTCACATAATTAA
1A2-45-F	GGGCCCCTGGGATCCTCCCCAGTGATTACCGA
1A2-45-R	GATGCGGCCGCTCGAGTCCTGTGTGAACGCCAACAAG
7H10-45-C2	GATGCGGCCGCTCGAGGTGAACGCCAACAAGCTCACCGGCTTCGGTA
7H10-45-C4	GATGCGGCCGCTCGAGGCCAACAAGCTCACCGGCTTCGGTAATCACT
7H10-45-C6	GATGCGGCCGCTCGAGAAGCTCACCGGCTTCGGTAATCACTGGGG
7H10-45-C8	GATGCGGCCGCTCGAGACCGGCTTCGGTAATCACTGGGG
7H10-45-C10	GATGCGGCCGCTCGAGTTCGGTAATCACTGGGG
7H10-45-N2-F	GGGCCCCTGGGATCCGTGATTACCGA
7H10-45-N2-R	ATGCGGCCGCTCGAGTCCTGTGTGAACGCCAACAAGCTCACCGGCTTCGG
7H10-45-N4-F	GGGGCCCCTGGGATCCACCGAAGCCGGTGAGC
7H10-45-N4-R	ATGCGGCCGCTCGAGTCCTGTGTGAACGCCAACAAGCTCACCGGCTTC
7H10-45-N6-F	GGGGCCCCTGGGATCCGCCGGTGAGC
7H10-45-N6-R	ATGCGGCCGCTCGAGTCCTGTGTGAACGCCAACAAGCTCACCGGC
7H10-45-N8-F	GGGCCCCTGGGATCCGAGCTTGTTGGC
7H10-45-N8-R	GATGCGGCCGCTCGAGTCCTGTGTGAACGCCAACAAGCTC
7H10-45-N10-F	GGGCCCCTGGGATCCGTTGGCGTTCACACAGGA
7H10-45-N10-R	ACGATGCGGCCGCTCGAGTCCTGTGTGAACGCCAAC
7H10-45-C2	GATGCGGCCGCTCGAGGTGAACGCCAACAAGCTCACCGGCTTCGGTA
1A2-C2-R	ATGCGGCCGCTCGAGTTCGGGTTTGGCAGCAAGCAGGGCACAAAGATCT
1A2-C4-R	ATGCGGCCGCTCGAGTTTGGCAGCAAGCAGGGCACAAAGATCTGAAGGC
1A2-C6-R	ATGCGGCCGCTCGAGAGCAAGCAGGGCACAAAGATCTGAAGGC
1A2-C8-R	ATGCGGCCGCTCGAGCAGGGCACAAAGATCTGAAGGC
1A2-C10-R	ATGCGGCCGCTCGAGACAAAGATCTGAAGGC
1A2-N2-F	GGGGCCCCTGGGATCCTCAGATCTTTGTGCCCTGCTTGCTGCCAAA
1A2-N4-F	GGGGCCCCTGGGATCCCTTTGTGCCCTGCTTGCTGCCAAACCCGAA
1A2-N6-F	GGGGCCCCTGGGATCCGCCCTGCTTGCTGCCAAACCCGAA
1A2-N8-F	GGGGCCCCTGGGATCCCTTGCTGCCAAACCCGAA
1A2-N10-F	GGGGCCCCTGGGATCCGCCAAACCCGAA
1A2-N10-R	CGATGCGGCCGCTCGAGTTCCAGTTCGGGTTT
1A2-C2-R	ATGCGGCCGCTCGAGTTCGGGTTTGGCAGCAAGCAGGGCACAAAGATCTG
1A2-C4-R	ATGCGGCCGCTCGAGTTTGGCAGCAAGCAGGGCACAAAGATCTGAAGGC
1A2-C6-R	ATGCGGCCGCTCGAGAGCAAGCAGGGCACAAAGATCTGAAGGC
1A2-C8-R	ATGCGGCCGCTCGAGCAGGGCACAAAGATCTGAAGGC
1A2-C10-R	ATGCGGCCGCTCGAGACAAAGATCTGAAGGC
1A2-N2-F	GGGGCCCCTGGGATCCTCAGATCTTTGTGCCCTGCTTGCTGCCAAA
1A2-N4-F	GGGGCCCCTGGGATCCCTTTGTGCCCTGCTTGCTGCCAAACCCGAA
1A2-173 A-R	GATGCGGCCGCTCGAGTAGCAGCCAGGGCACAAAGATCTGAAGGCAC
1A2-172 A-R	ATGCGGCCGCTCGAGTAGCAAGAGCGGCACAAAGATCTGAAGGCAC
1A2-170 A-F	GGGCCCCTGGGATCCGTGCCTTCAGATCTTGCT
1A2-170 A-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCAGCAAGATCTGAA
1A2169A-F	GGGCCCCTGGGATCCGTGCCTTCAGATGCATG
1A2-169 A-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCACATGCATCTGAAGGCA
1A2-168 A-F	GGGGCCCCTGGGATCCGTGCCTTCAGCTCTTT
1A2-168 A-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCACAAAGAGCTGAAGGCAC
1A2-165–174-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCACAAAGATCTGAAGGCA
1A2-167 A-F	GGGGCCCCTGGGATCCGTGCCTGCAGATCTTT
1A2-167-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCACAAAGATCTGCAGGCA
1A2-166 A-F	GGGGCCCCTGGGATCCGTGGCTTCAGATCTTT
1A2-166 A-R	TGCGGCCGCTCGAGTAGCAAGCAGGGCACAAAGATCTGAAGCCAC
1A2-165 A-F	GGGGCCCCTGGGATCCGCGCCTTCAGATCTTT
1A2-165 A-R	ATGCGGCCGCTCGAGTAGCAAGCAGGGCACAAAGATCTGAAGGCGC
7H10-122–129-F	GATCCGTGATTACCGAAGCCGGTGAGCTT
7H10-122–129-R	TCGAGAAGCTCACCGGCTTCGGTAATCACGGATC
7H10-128-F	GATCCGTGATTACCGAAGCCGGTGCACTT
7H10-128-R	TCGAGAAGTGCACCGGCTTCGGTAATCACGGATC
7H10-129-F	GATCCGTGATTACCGAAGCCGGTGAGGCT
7H10-129-R	TCGAGAGCCTCACCGGCTTCGGTAATCACGGATC

Conservation analysis

More than 30 PRRSV-2 strains of different branches were downloaded from UniProt for sequence alignment and analysis. The conservation of the epitopes was analyzed by jalview2.22.5.0, and the structure analysis using ChimeraX1.1.0 software.

Authors’ contributions

Xiang was responsible for the preparation of monoclonal antibodies and the identification of epitopes, as well as data analysis, result organization and the writing of the first draft. Meng conducted the revision of the initial draft and data analysis, and participated in the experimental operation; Qi and Shi revise the article; Supervision and guidance of the research and article revision were conducted by Wang, An and Cai.

Funding

The study was supported by the National Key Research and Development Program of China (grant number 2022YFD1800305-02).

Data availability

Detailed data available in attached Supplementary file.

Declarations

Ethics approval and consent to participate

The protocol was approved by the Committee on the Ethics of Animal Experiments of the Harbin Veterinary Research Institute (HVRI) of the Chinese Academy of Agricultural Sciences (CAAS) and the Animal Ethics Committee of Heilongjiang Province, China (Permission number: 241119-04-GR). The use obtained informed consent from the owner to use the animals in this study and handling of experimental animals are carried out under conditions that comply with animal welfare standards to ensure that the animals’ suffering and discomfort are minimized. The breeding environment, conditions and experimental operations of the experimental animals all met the relevant ethical requirements, and the animals were treated humanely after the experiments.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.