PAQR5 inhibits the growth and metastasis of clear cell renal cell carcinoma by suppressing the JAK/STAT3 signaling pathway

Abstract

Background

Clear cell renal cell carcinoma (ccRCC) has a high degree of malignancy and poor overall prognosis in advanced and metastatic patients. Therefore, it is of great significance to find new prognostic biomarkers and therapeutic targets for ccRCC. The expression of progestin and adipoQ receptor family member 5 (PAQR5) is significantly downregulated in ccRCC compared with normal tissues, but its specific mechanism and potential biological function in ccRCC remain unclear.

Methods

The expression pattern of PAQR5 and the correlation between the PAQR5 expression and clinicopathological parameters and various survival periods in ccRCC patients were analyzed by using multiple public databases and ccRCC tissues chip. Its prognostic value was analyzed by univariate/multivariate Cox regression. In addition, MTT assay, EdU staining assay, flow cytometry, wound healing assay, transwell migration and invasion assay, colony formation assay, immunofluorescence assay, and a xenograft tumor model were conducted to assess the biological function of PAQR5 in ccRCC in vitro and in vivo.

Results

Our results indicated that the downregulation of PAQR5 was demonstrated in ccRCC tumor tissues and associated with poorer OS, DSS, and PFI. Meanwhile, the univariate/multivariate Cox regression analysis confirmed that PAQR5 might serve as an independent prognostic factor for ccRCC, and its low expression was tightly correlated with tumor progression and distant metastasis. Mechanistically, a series of gain- and loss-of-function assay revealed that PAQR5 could suppress the ccRCC proliferation, invasion, metastasis, and tumorigenicity in vitro and in vivo by inhibiting the JAK/STAT3 signaling pathway.

Conclusion

Our study revealed the tumor suppressor role of PAQR5 in ccRCC. PAQR5 is a valuable prognostic biomarker for ccRCC and may provide new strategies for clinical targeted therapy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13402-023-00813-w.

Introduction

Renal cell carcinoma (RCC) is a common malignant tumor of the urinary system, and its histological types are mainly divided into papillary renal cell carcinoma (pRCC), clear cell renal cell carcinoma (ccRCC), and chromophobe renal cell carcinoma (chRCC). Of these, ccRCC, named for its microscopic brilliance, is the most common type, accounting for 80–90% of kidney cancers [1]. ccRCC, characterized by high rates of recurrence, metastasis, mortality, and insensitivity to radiotherapy and chemotherapy, is usually accompanied by poor prognosis [2, 3]. As a heterogeneous disease, patients with ccRCC lack reliable and effective biomarkers that could reveal the molecular mechanisms of tumor progression and thus lack individualized treatment options. To date, biomarker-based therapeutic strategies for advanced ccRCC have been missing. Therefore, it is imperative to explore more potential therapeutic targets and predictive biomarkers for ccRCC.

The progestin and adipoQ receptor (PAQR) family is a class of membrane protein receptors with seven transmembrane structures, there are currently 11 members of this family in humans, namely PAQR1-11 [4–6]. Studies have shown that PAQRs are widely expressed in the human body and their biological functions are very complex [7, 8]. At present, the study on the structure and function of this protein family is still in its infancy. Many members of the PAQR family have been confirmed to be involved in the nontranscriptional regulatory effects of progesterone in vivo [9]. Therefore, PAQR5, PAQR7, and PAQR8 are also called progesterone membrane receptor γ (mPRγ), progesterone membrane receptor α (mPRα), and progesterone membrane receptor β (mPRβ), respectively, and are involved in the rapid regulation of progesterone [6, 10]. These mPRs have been primarily studied for their functions in the reproductive and neuronal systems, but aberrant expression of them has also been observed in multiple human cancers, including prostate, breast, endometrial, ovarian, and bladder cancers [11–17]. However, they seem to function inconsistently; for example, human endometrial cancer patients with high mPRβ and mPRγ expression had a favorable outcome [15], while the upregulation of PAQR6 is associated with AR signaling and a worse prognosis in prostate cancer [17]. Clinical observation found that prophylactic use of medroxyprogesterone acetate after renal cell carcinoma surgery could effectively reduce the incidence of postoperative metastasis [18], while bioinformatics data analysis indicated that PAQR5 was significantly expressed at low levels in ccRCC tissues and might be associated with poor prognosis [19]. This led us to consider the impacts of progesterone and related receptor molecules on ccRCC. Meanwhile, we found that the mRNA expression level of PAQR5 was the highest in kidney tissues compared with other tissues and organs in the human body, while its gene expression was significantly downregulated in ccRCC tissues compared with the corresponding normal tissues. Hence, we hypothesized that PAQR5 played a critical role in kidney tissue compared with other tissues.

Signal transducer and activator of transcription 3 (STAT3) is a member of the STAT family of proteins, which play important roles in transmitting signals from the plasma membrane to the nucleus, where they regulate gene transcription. STAT3 regulates the transcription of genes involved in various functions, including proliferation, apoptosis, angiogenesis, metastasis, and immune responses [20]. STAT3 plays a central role in the development, maintenance, and progression of multiple cancers mainly through the JAK2/STAT3 signaling pathway [21–23]. The IL6/JAK/STAT3 pathway is abnormally overactivated in many types of cancer, and its overactivation is often associated with poor clinical outcomes [24–26]. In the tumor microenvironment, the IL6/JAK/STAT3 signaling pathway drives the proliferation, survival, invasion, and metastasis of tumor cells, while strongly inhibiting the antitumor immune response, making this pathway an attractive drug target [27]. However, there are few reports on the IL6-JAK-STAT3 signaling pathway in ccRCC to date.

In this study, the low expression of PAQR5 in ccRCC was verified by multiple public databases and tissue chip. Subsequently, a series of gain- and loss-of-function assays were performed to confirm the anticancer effect and the underlying mechanisms of PAQR5 in ccRCC. The results demonstrated that PAQR5 could suppress ccRCC proliferation, invasion, metastasis, and tumorigenicity in vitro and in vivo by inhibiting the JAK/STAT3 signaling pathway. Collectively, these findings provide an important basis for PAQR5 as a novel therapeutic target and prognostic biomarker for ccRCC.

Materials and methods

Cell culture and reagents

The human renal carcinoma cell lines OS-RC-2, 786-O, 769-P, RCC4, SW839, A498, Caki-1, and normal renal tubular epithelial cell line HK-2 were acquired from the American Type Culture Collection (ATCC, Manassas, VA, USA). 10% FBS (Gibco, Grand Island, NY, USA) and 1% penicillin-streptomycin (HyClone Laboratories, Logan, UT) were added to 1640 culture media (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) for cell culture. Cells were maintained in a 37°C atmosphere supplied with 5% CO₂.

Quantitative RT‒PCR

The RNAfast 200 reagents (Feijie Bio, Shanghai, China) were used to isolate total RNA from renal carcinoma cells. The PrimeScript RT Master Mix (Takara Bio, Dalian, China) was used to reverse-transcribe the RNA into complementary DNA after being quantified by absorbance at 260 nm. The cDNA of specific genes was amplified by SYBR-Green PCR Master Mix (Takara Bio, Dalian, China) and the corresponding expression levels were detected by the CFX96 real-time PCR system (Bio-rad, CA, USA). Primer sequences were as follows: PAQR5, F: TTGCATGGAGGTTTGTGACTG and R: GGCACCATAGTCCAGGAAGT; and 18S, F: GTAGTCATATGCTTGTCTC and R: TCCGCAGCTTCACCTACGGA. 18S was used as an internal control for normalization.

Western blot assay

RIPA lysis buffer containing protease inhibitor and phosphatase inhibitor (Beyotime, Shanghai, China) was used to extract the total proteins of cancer cells and tissues after specific experimental treatment. The methods of protein collection and western blot analysis were described in detail as previously described [28]. A Nuclear Extraction Kit (Abcam, ab113474, Shanghai, China) was used to isolate nuclear and cytoplasmic proteins. In detail, the cells were digested with trypsin, collected into a micro-centrifuge tube, and washed twice with precooled PBS. 1 × 10⁶ cells were resuspended with 100 µl 1×pre-extraction buffer and then incubated on ice for 10 min. The suspension was oscillated for 10 s and centrifuged at 12,000 rpm for 1 min. The cytoplasmic extract was carefully removed from the nuclear granules. Cytoplasmic protein components could be used for downstream applications. 2 volumes of extraction buffer were added to the nuclear particles (about 10 µl per 10⁶ cells). The extract was incubated on ice for 15 min. The extract could be further ultrasonically treated for 3 × 10 s to increase nuclear protein extraction. Then the suspension was centrifuged at 14,000 rpm for 10 min at 4°C to get the nuclear extraction. The protein concentration of the nuclear and cytoplasmic extract was measured and analyzed by western blotting assay. In this study, antibodies were used from the following sources: anti-PAQR5 (DF4988) was purchased from Affinity. anti-E-cadherin (3195), anti-N-cadherin (13116), anti-MMP2 (40994), anti-MMP9 (13667), anti-phospho-STAT3 (Tyr705) (9145), anti-STAT3 (9139), anti-phospho-JAK2 (Tyr1007/1008) (3771), and anti-JAK2 (3230) were purchased from CST (Cell Signaling Technology). anti-Cyclin D1 (26939-1-AP), anti-Cyclin E1 (11554-1-AP), anti-CDK2 (10122-1-AP), anti-p21 (10355-1-AP), and anti-Histone H3 (17168-1-AP) were purchased from Proteintech Group. And anti-β-actin (AC026) was obtained from Abclonal.

Cell viability assay

Added 200 µl of culture medium containing 4,000 renal carcinoma cells into each well of 96-well plate. After culturing for an indicated time, discarded the previous medium and added 200 ul of fresh culture medium containing 10% MTT (Sigma-Aldrich, MO, USA) into each well. After 4 h, an ELISA reader (Bio-Rad, Hercules, CA, USA) was used to measure the absorbance at 490 nm.

Clinical specimens, tissue chip, and immunohistochemistry (IHC) assays

Clinical specimen tissues from patients (n = 6) with ccRCC and their corresponding normal tissues were provided by the Department of Urology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China. The Institutional Research Ethics Committees of the hospital approved this study, and all the patients signed informed consent. A ccRCC tissue chip (Cat No. HKid-CRCC060PG-01) containing 30 individual ccRCC patient tissues and corresponding non-cancer tissue was purchased from Outdo Biotech Co., Ltd. (Shanghai, China) to further verify the expression pattern of PAQR5 in ccRCC. The methods of immunohistochemistry (IHC) assays were described in detail as previously described [29].

Oligo small interfering RNA transfection and overexpression plasmid transfection

The siRNA sequences targeting human PAQR5 and STAT3 were obtained from GenePharma (Shanghai, China). The transfection of si-NC, si-PAQR5-1, si-PAQR5-2, si-STAT3 was conducted with the help of GP-transfection-Mate transfection reagent (GenePharma, Shanghai, China) according to the manufacturer’s instructions. The specific sequences of siRNAs used in this study were as follows, si-PAQR5-1: 5’-CUGGCCUCUUUCUUGUACUTT-3’; si-PAQR5-2: 5’-GAGACUCUCAACAUUUGGATT-3’; si-STAT3: 5’-CCAACGACCUGCAGCAAUA-3’; si-NC: 5’-UUCUCCGAACGUGUCACGUTT-3’. Plasmids overexpressing PAQR5 and STAT3 and empty vector were purchased from SinoBiological (Houston, TX, USA). Plasmids were transfected into ccRCC cells through using the XtremeGENE HP DNATransfection Reagent (Roche, Switzerland) based on the manufacturer’s protocols.

Wound healing assay

First, draw a marker line at the bottom of the 6-well plate, and then seeded the corresponding cells into it. When the cells covered the entire bottom of the dish, a scratch was made with a 200 µl pipette tip. The cells were cultured in a serum-free medium, and an inverted microscope (Olympus, Tokyo, Japan) was used to take photographs every 24 h until the scratches were almost completely closed.

Transwell assay

For the transwell migration assays, 4 × 10⁴ OS-RC-2 and 3 × 10⁴ 786-O cells suspended in 200 µl serum-free RIPA-1640 medium were inoculated above the chamber (Millipore, Darmstadt, Germany) after adding 800 µl complete medium under the chamber. For the transwell invasion assay, 60 µl of Matrigel (Sigma-Aldrich, MO, USA) was firstly added to the upper chamber 4 h in advance. Then, after adding 800 µl complete medium under the chamber, 8 × 10⁴ OS-RC-2 and 6 × 10⁴ 786-O suspended in 200 µl serum-free medium were seeded above the chamber and incubated together for a specified period. Then transwell chambers were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet for 10 min at room temperature. Finally, three fields were randomly selected from each chamber to observe and count cells under a 100× magnification inverted light microscope (Olympus, Tokyo, Japan).

Cell flow cytometry analysis

RCC cell lines under specific treatments were harvested from the 10 cm dishes and subsequently rinsed with iced PBS, fixed with 70% iced ethanol at 4°C overnight. Then cells were resuspended and co-incubated with 5 µl PI (propidium iodide) and RNase A for at least 15 min at room temperature in the dark according to the manufacturer’s instructions. Finally, the staining signal of renal carcinoma cells was detected using a FACSCalibur™ flow cytometer (BD Biosciences, NJ, USA).

EdU assay

The proliferation capacity of renal carcinoma cells was measured using the EdU Cell Proliferation Kit with Alexa Fluor 594 (Beyotime, Shanghai, China) according to the manufacturer’s instructions. The operational details were described previously [29].

Immunofluorescence assay

Renal carcinoma cells (2 × 10⁵) were seeded into 6-well plates pre-laid with glass slides and cultured in a cell incubator for 24 h. After the cells were fixed, permeated, and blocked, then incubated with primary antibodies diluted 1:100 in PBS at 4°C overnight. The following day, the slides were stained with fluorescent secondary antibodies for 2 h. Finally, the cells were incubated with DAPI for 5 min to stain the nuclei and sealed with glycerin. Immunofluorescence images of the target protein were captured under a positive fluorescence microscope (Olympus, Tokyo, Japan).

Colony formation assay

OS-RC-2 and 786-O cells treated with specific conditions were seeded into 6-well plates at 800 cells per well, incubated for 7 days. The cells were fixed with 4% paraformaldehyde for 15 min and then stained with 0.1% crystal violet for 10 min. Representative images were captured with a scanner and the number of colonies was counted at 100× magnification in 5 random areas to assess the clonogenicity ability.

Xenograft tumor model

Eight male nude mice (5-week-old; weighed 19–21 g) were randomly divided into two groups (4 per group), 100 µl of serum-free medium containing 50 µl of Matrigel and 2 × 10⁶ 786-O cells (control group or PAQR5 overexpression group) were subcutaneously injected on the right flanks of each mouse. Then, the body weight and tumor size of the mice were measured and recorded every 4 days until the 28th day. The nude mice were euthanized, and the tumors were obtained, weighed, measured, and examined and analyzed by immunohistochemistry. The tumor volume was calculated as (length × width²) × 0.5.

Bioinformatics and statistical analysis

The prognostic value of PAQR5 was calculated based on the Kaplan-Meier plotter database (http://kmplot.com), including OS (overall survival), DSS (disease-free survival), and PFI (progression-free interval). Univariate and multivariate Cox regression analysis were performed to assess whether PAQR5 was an independent prognostic factor for survival in ccRCC patients. Gene set enrichment analysis (GSEA) 2.0 software (http://software.broadinstitute.org/gsea/msigdb/collections. jsp#H) was used to analyze the significantly altered pathways related to PAQR5. The Student’s t-test was used to analyze the differences between two groups. All the statistical analyses were performed using GraphPad Prism version 8.0 (GraphPad Software, USA). All data was represented as the mean ± standard deviation (SD) of at least three independent experiments. P < 0.05 was considered statistically significant.

Results

PAQR5 is commonly expressed at low levels in ccRCC cells and tissues

To explore the expression pattern of PAQR5, we first detected its expression in human tissues and cell lines. The results from the HPA database showed that PAQR5 was mainly localized in the cytoplasm of cancer cells and that the mRNA expression level of PAQR5 was the highest in kidney tissues compared with other tissues and organs in the human body (Supplementary Fig. 1A, B). Furthermore, the mRNA expression detected in pancancer tissues demonstrated that PAQR5 was significantly downregulated in multiple tumor tissues compared with the corresponding normal tissues, especially in ccRCC (P < 0.001) (Supplementary Fig. 1C). Meanwhile, the data from multiple databases including the GEPIA website, TCGA database (unpaired and paired clinical samples), and GEO datasets, also verified the low expression of PAQR5 in ccRCC (Supplementary Fig. 2). Moreover, the results of the qRT‒PCR and western blotting assays from the ccRCC cell lines and fresh human ccRCC tissues further confirmed that the mRNA and protein expression levels of PAQR5 were remarkably downregulated in ccRCC (Fig. 1A-D). A ccRCC tissue chip (Cat No. HKid-CRCC060PG-01) containing 30 ccRCC and matched adjacent nontumor tissues was purchased from Outdo Biotech and subjected to the IHC assay. Consistently, the result of tissue chip convincingly verified our conclusion (Fig. 1E). Briefly, all of these data suggested that PAQR5 was significantly underexpressed in ccRCC tissues and cells and might serve as a tumor suppressor in ccRCC. In addition, the results of the gene promoter methylation analysis based on the UALCAN website and cell experiments suggested that promoter hypermethylation was the main reason for the apparent downregulation of PAQR5 in ccRCC (Supplementary Fig. 3).

Fig. 1.

PAQR5 is commonly expressed at low levels in ccRCC cells and tissues. A Quantitative real-time PCR (qRT‒PCR) analysis of the mRNA expression levels of PAQR5 in human renal carcinoma cell lines and the normal renal tubular epithelial cell line HK-2. 18S was applied as the endogenous control. Data are presented as the mean ± SEM, n = 3. B Western blot analysis of PAQR5 expression levels in human renal carcinoma cell lines and the normal renal tubular epithelial cell line HK-2. C PAQR5 protein expression levels were analyzed in six cases of fresh human ccRCC tissues and corresponding normal tissues by western blotting assay. β-actin was used as an internal loading control. D Quantification of the western blotting results. E Representative images of PAQR5 protein expression in ccRCC tissues and paired normal kidney tissues in ccRCC tissue chip detected by IHC. The scales bars are 500 μm and 100 μm, respectively. Scatter plots and heatmap showing the IHC scores of PAQR5 in 30 pairs of ccRCC tissues and normal renal tissues. *P < 0.05, **P < 0.01, ***P < 0.001

Downregulation of PAQR5 is positively correlated with worse survival outcomes in ccRCC patients

Next, we sought to investigate the prognostic significance of PAQR5. The relationship between PAQR5 expression and different clinicopathological characteristics was assessed (Supplementary Fig. 4). The results showed that the expression of PAQR5 mRNA was significantly correlated with age, gender, TNM stage, pathological stage, and histological grade, and its low expression indicated tumor progression and distant metastasis. Meanwhile, the correlation between PAQR5 expression and the survival outcomes of ccRCC patients was further evaluated using Kaplan‒Meier survival curves based on the TCGA database. The results showed that patients with low expression of PAQR5 usually had worse overall survival outcomes (OS; HR = 0.38), disease-specific survival (DSS; HR = 0.21), and progression-free intervals (PFI; HR = 0.29) (Fig. 2A). Univariate and multivariate Cox regression analyses revealed that PAQR5 might be an independent prognostic factor of OS in ccRCC (P < 0.001; Fig. 2B). Therefore, our results shed light on the finding that low expression of PAQR5 was associated with poorer OS, DSS, and PFI in ccRCC.

Fig. 2.

Downregulation of PAQR5 is positively correlated with worse survival outcomes in ccRCC patients. A Kaplan‒Meier survival curves of OS, DSS, and PFI in 539, 528, and 537 ccRCC patients respectively. Patients were divided into high and low expression groups cutoff by the median expression of PAQR5. B Forest plots for univariate and multivariate Cox regression analysis of overall survival in 539 patients with clear cell renal cell carcinoma with respect to PAQR5 expression and diverse clinicopathological parameters

PAQR5 suppresses cell proliferation of ccRCC in vitro

To gain insight into the biological functions of PAQR5 in ccRCC, the GO terms and KEGG pathway enrichment analysis based on the coexpressed genes explored in LinkedOmics and gene set enrichment analysis (GSEA) based on the TCGA-KIRC dataset and hallmark signatures were both performed (Supplementary Figs. 5 and 6). The results of GO terms and KEGG pathway enrichment analysis suggested that PAQR5 mainly participated in cell cycle-related signaling pathways (Supplementary Fig. 5C, F). Meanwhile, from the result of GSEA we can get the top 50 genes which were induced or repressed in PAQR5 high or low expression ccRCC patients’ groups and the significant changes in “hallmark gene sets” (browse 50 gene sets) enrichment analysis (Tables S1, S2). After a NES (normalized enrichment analysis) score, nominal P-value and FDR (false discovery rate) q-value analysis, we found that the gene sets of “hallmark_G2M_CHECKPOINT” and “hallmark_E2F_TARGETS” were enriched in the low expression of PAQR5 patients’ group. These results uncovered that PAQR5 inhibition was correlated with increased cell proliferative capability and viability in ccRCC progression.

To confirm the above hypothesis, the expression of PAQR5 was knocked down by si-PAQR5-1 and si-PAQR5-2 in OS-RC-2 cells and overexpressed in 786-O cells by the PAQR5 plasmid to investigate the biological function of PAQR5 in ccRCC (Fig. 3A). The MTT assay and EdU assay revealed that PAQR5 inhibition promoted the proliferative capacity of OS-RC-2 cells, while PAQR5 overexpression repressed the proliferative ability of 786-O cells in a time-dependent manner (Fig. 3B, C). The similar effect was observed in the flow cytometry analysis, in which the cell cycle transition was accelerated from G1 to S phase after PAQR5 knockdown in OS-RC-2 cells, whereas cell cycle arrest in G0/G1 phase was observed after PAQR5 overexpression in 786-O cells (Fig. 3D). All findings indicated that PAQR5 could suppress the cell proliferation capacity of ccRCC in vitro.

Fig. 3.

PAQR5 suppresses cell proliferation of ccRCC in vitro. A The efficiency of PAQR5 knockdown in the OS-RC-2 cell line and overexpression in the 786-O cell line was verified by western blotting analysis. The OS-RC-2 cell line was transfected with si-PAQR5-1 or si-PAQR5-2 or si-NC, and the 786-O cell line was transfected with the PAQR5 overexpression vector or negative control vector. β-actin was used as a loading control. B Cell viability was detected by an MTT assay in PAQR5 overexpressing or PAQR5-downregulated ccRCC cells. C An EdU incorporation assay for staining proliferating cells (red indicates EdU-incorporated cells; blue indicates nuclear staining with Hoechst 33342) was conducted in OS-RC-2 and 786-O cells with treatment as indicated. Quantification analysis is shown on the right. Scale bars, 100 μm. D The cell cycle distribution of OS-RC-2 and 786-O cells treated as indicated was analyzed by flow cytometry. The quantitative analysis of the results is shown on the corresponding right. *P < 0.05, **P < 0.01, ***P < 0.001

PAQR5 inhibits the migration and invasiveness of ccRCC cells in vitro

We also found that the terms of extracellular matrix organization were also enriched in the GO analysis (Supplementary Fig. 5C-E). Meanwhile, GSEA showed that the epithelial-mesenchymal-transition pathway and apical junction pathway were enriched in the PAQR5 low expression group (FDR < 0.25, P < 0.05) (Supplementary Fig. 6C). Because they are all related to invasion and migration phenotypes exhibited in common, sustained metastatic ability is an important hallmark of malignant tumor progression [30]. Therefore, both wound-healing and transwell assays were performed after PAQR5 knockdown and overexpression. The results obtained showed that PAQR5 silencing promoted, while PAQR5 overexpression inhibited, the invasion and migration capacity in ccRCC cells (Fig. 4A, B). Thus, we concluded that PAQR5 suppressed ccRCC metastasis capability in vitro. Subsequently, we found that the expression of cell cycle-related proteins such as Cyclin E1, Cyclin D1, and CDK2 was reduced after PAQR5 overexpression, while p21 was upregulated (Fig. 4C). Moreover, PAQR5 overexpression blocked the EMT process by simultaneously upregulating epithelial marker (E-cadherin) and downregulating mesenchymal marker (N-cadherin) in 786-O cells (Fig. 4C). Furthermore, we found that the protein expression levels of MMP2 and MMP9 were suppressed in 786-O cells after overexpressing PAQR5 (Fig. 4C). The opposite results were observed in OS-RC-2 cells after PAQR5 knockdown. The above results indicated that PAQR5 acted as a tumor suppressor gene by inhibiting cell proliferation and metastasis in ccRCC.

Fig. 4.

PAQR5 inhibits the migration and invasiveness of ccRCC cells in vitro. A Representative images of wound healing assays in PAQR5 knockdown (KD) OS-RC-2 sublines and PAQR5 overexpressing (OE) 786-O sublines. Quantitative data is shown on the right. B Representative images of transwell migration and invasion in PAQR5-KD OS-RC-2 sublines and PAQR5-OE 786-O sublines. Quantitative data is shown on the corresponding below. Scale bars, 100 μm. C Western blot analysis of p21, Cyclin E1, Cyclin D1, CDK2, E-cadherin, N-cadherin, MMP2, and MMP9 in PAQR5-KD OS-RC-2 sublines and PAQR5-OE 786-O sublines. β-actin was used as an internal loading control. **P < 0.01; ***P < 0.001. KD: knockdown; OE: overexpression

PAQR5 represses the IL6-JAK-STAT3 signaling pathway in ccRCC cells

GSEA indicated that “HALLMARK_IL6_JAK_STAT3_SIGNALING” was upregulated and responded to low PAQR5 expression (Fig. 5A). We reviewed the literature and found that this signaling pathway shared many features with our verified role of PAQR5 in ccRCC. Therefore, it is worth exploring the relationship between PAQR5 and the JAK2/STAT3 pathway in ccRCC. Considering the complexity of experimental grouping and the high consistency of results between the two knockdown sequences, the most potent si-PAQR5-1 was used for subsequent experiments. The outcomes of western blotting showed that PAQR5 knockdown activated the JAK/STAT3 signaling pathway by increasing the expression of P-JAK2 and P-STAT3 while overexpressing PAQR5 exerted the opposite effect (Fig. 5B). Meanwhile, by extracting and separating the cytoplasmic/nuclear proteins, we demonstrated that PAQR5 knockdown promoted, while PAQR5 overexpression repressed, the translocation of P-STAT3 from the cytoplasm to the nucleus (Fig. 5C). A similar result was also obtained in the immunofluorescence assay (Fig. 5D). All of the results revealed that PAQR5 deficiency promoted the activation of the JAK/STAT3 signaling pathway by accelerating the nuclear translocation of P-STAT3.

Fig. 5.

PAQR5 represses the IL6-JAK-STAT3 signaling pathway in ccRCC cells. A GSEA results showed that “HALLMARK_IL6_JAK_STAT3_SIGNALING” was enriched in the PAQR5-low expression group. B JAK2, P-JAK2, STAT3, and P-STAT3 were evaluated by western blotting assay in PAQR5-KD OS-RC-2 and PAQR5-OE 786-O sublines. β-actin was used as a loading control. C The phosphorylation level of STAT3 (Tyr705) in nuclear fractions and cytoplasmic fractions was analyzed by western blotting after treatment as indicated. Histone H3 and β-actin were used as the loading controls for the nucleus and cytoplasm, respectively. D Immunofluorescence indicated the nuclear translocation of phosphorylated STAT3 (P-STAT3) induced by PAQR5 in the PAQR5-KD OS-RC-2 and PAQR5-OE 786-O sublines. Scale bars, 50 μm

PAQR5 inhibits the growth, migration, and invasion of ccRCC cells by curbing the JAK-STAT3 pathway

According to the above data, it was necessary to dissect the mechanisms of PAQR5-mediated JAK/STAT3 signaling in regulating the malignant progression of ccRCC. First, the stable subcellular lines with ectopic PAQR5 and STAT3 overexpression alone or with both PAQR5 and STAT3 overexpression simultaneously in 786-O cells and endogenous PAQR5 and STAT3 knockdown alone or both knockdown in OS-RC-2 cells were established. Meanwhile, the expression changes of key genes in JAK/STAT3 signaling pathway were detected and the result demonstrated that PAQR5 could affect the expression of downstream proteins such as MMP2, MMP9, Cyclin E1, Cyclin D1, and CDK2 by depending on JAK/STAT3 pathway (Fig. 6A). Subsequently, functional experiments were performed to further verify the mechanism. As shown in Fig. 6B, STAT3 overexpression partly reversed the anti-proliferation effect induced by PAQR5 overexpression in 786-O cells, and the pro-proliferative ability caused by PAQR5 depletion was partially abolished by STAT3 knockdown in OS-RC-2 cells. Similar results were also observed in the colony formation assay (Fig. 6C). As expected, STAT3 overexpression also significantly potentiated the migration and invasion phenotype suppressed by PAQR5 in 786-O cells while the migration and invasion capacity enhanced by PAQR5 knockdown was partly abrogated by the knockdown of STAT3 in OS-RC-2 cells (Fig. 6D). The above findings were highly consistent with the results of western blotting assays in Fig. 6A. These results collectively indicated that PAQR5 exerted its tumor suppressive role in ccRCC by inhibiting the JAK/STAT3 signaling pathway.

Fig. 6.

PAQR5 inhibits the growth, migration, and invasion of ccRCC cells by curbing the JAK-STAT3 pathway. A The OS-RC-2 cell line was transfected with si-PAQR5 or si-STAT3 alone or with both si-PAQR5 and si-STAT3, while the 786-O cell line was transfected with PAQR5 overexpression plasmids or STAT3 overexpression plasmids alone or with both overexpression plasmids simultaneously. The efficiency of PAQR5 and STAT3 knockdown in the OS-RC-2 cell line and overexpression in the 786-O cell line was verified by detecting the expression of PAQR5 and STAT3 proteins using western blotting analysis. The expression of P-STAT3 (Tyr705), Cyclin E1, Cyclin D1, CDK2, MMP2, and MMP9 were also examined after treatment as indicated. β-actin was used as a loading control. B An MTT assay was conducted to evaluate the viability of OS-RC-2 and 786-O cells after treatment as indicated. C Colony formation assays were also performed in OS-RC-2 and 786-O cells treated as described above. Quantification analysis is shown on the right. D The migration and invasion abilities were analyzed by a transwell Boyden assay without or with Matrigel in OS-RC-2 and 786-O cells after treatment as indicated. Quantification analysis is shown below. Scale bars, 100 μm. **P < 0.01, ***P < 0.001 versus the scrambled si-NC group or control group, ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 versus the si-STAT3 group or PAQR5 group

PAQR5 attenuates the tumorigenicity of ccRCC in vivo

To verify the tumor suppression role of PAQR5 in vivo, a xenograft model was established. Representative graphics of the obtained tumors are shown in Fig. 7A. It clearly displayed that the xenograft tumors in the PAQR5 overexpression group grew more slowly (Fig. 7B). The tumor weights were also much lighter in the PAQR5-overexpressing group (Fig. 7C). The results of western blotting assays showed that the expression level of P-STAT3 significantly decreased with the overexpression of PAQR5 (Fig. 7D). A similar result was also observed by immunohistochemistry. The results demonstrated that PAQR5 was stronger, while P-STAT3 and Ki-67 were weaker in PAQR5-overexpressing tumor tissues (Fig. 7E). All results suggested that PAQR5 attenuated the tumorigenicity of ccRCC in vivo.

Fig. 7.

PAQR5 attenuates the tumorigenicity of ccRCC in vivo. A Representative image of the tumors harvested from the control group and the PAQR5 overexpression group is shown in the left panel. B The tumor volume changes in the control group and the PAQR5 overexpression group were measured and calculated every four days. C The tumor weight in the control group and the PAQR5 overexpression group was determined after the tumors were harvested at the end of the experiment. D The expression levels of PAQR5, P-STAT3, and STAT3 were evaluated by western blotting analysis. β-actin was used as an internal control. E Immunohistochemistry was used to detect the expression of PAQR5, P-STAT3, and Ki-67. The scale bar represents 50 μm. F An illustration of how PAQR5 inhibits cell proliferation, invasion, migration, and tumorigenicity in ccRCC by suppressing the JAK-STAT3 signaling pathway. **P < 0.01, ***P < 0.001

Discussion

The global incidence of renal cell carcinoma (RCC) has been increasing over the past few decades, and RCC is the sixth most commonly diagnosed cancer in men and the tenth in women in the United States [31]. ccRCC is a tumor type with features of high immune infiltration and vascularization [32], so ICI and TKI therapy have been approved as the standard treatment for early and late metastatic ccRCC patients [33, 34]. However, the effectiveness of monotherapy is still limited, and only a small number of people can benefit consistently. A growing number of studies now recommend the combination of ICI and TKI, which can indeed improve the curative effect to some extent, but at the same time, it is accompanied by more adverse events [35–37]. Therefore, there is an urgent need to identify a novel and reliable biomarker that can effectively monitor the clinical response and predict the prognosis of ccRCC therapy, and screen out patients who may benefit more from immunotherapy or targeted therapy to achieve precise treatment.

Progestin and adipoQ receptor family member 5 (PAQR5), as a member of the progestin and adipoQ receptor family, also represents one of the progesterone membrane receptor (mPR) subtypes. There are few relevant reports about PAQR5 at present, and existing reports mainly focus on its progesterone receptor-mediated reproductive endocrine signal and neurodevelopment roles [38, 39]. More recently, PAQR5 was found to be a potential prognostic risk assessment molecule for esophageal adenocarcinoma and served as a protective factor [40]. Meanwhile, higher level of PAQR5 was correlated with a lower FIGO stage in endometrial cancer [15]. PAQR5 is also involved in the antitumor effects of progesterone in ovarian cancer [41]. PAQR5 is mainly expressed in kidney tissue and the reproductive system in the human body. However, little is known about the specific mechanism of the anticancer effect of PAQR5, or the relationship between PAQR5 and ccRCC. Moreover, the roles and functions of PAQR5 in ccRCC in vitro and in vivo have never been reported. Hence, bioinformatics analysis, gain- and loss-of-function assays in vitro and in vivo, and clinical sample information were integrated in our study to expand the related research on PAQR5 in ccRCC, aiming to clarify the specific impacts of PAQR5 in ccRCC, as well as its prognostic value, and to explore its potential mechanism in ccRCC from multiple levels and perspectives. This is also the first such comprehensive study on PAQR5 in ccRCC, which is expected to provide new directions for ccRCC clinical treatment strategies.

Through GSEA, we identified 8 signaling pathways that were enriched in the PAQR5-low expression group, including epithelial-mesenchymal-transition, G2M checkpoint, angiogenesis, apical junction, IL6-JAK-STAT3 signaling, IL2-STAT5 signaling, KRAS signaling, and TNFα-NFκB signaling pathways. Meanwhile, the results of GO enrichment analysis based on the PAQR5 coexpressed genes demonstrated that PAQR5 mainly participated in nuclear division, regulation of cell cycle phase transition, and extracellular matrix organization. KEGG pathway analysis revealed enrichment in the Hippo, mTOR, cell cycle, and p53 signaling pathways. Based on the above results, the signaling pathways regulated by PAQR5 were mainly related to EMT, the cell cycle, angiogenesis, the inflammatory response, and immune regulation. Cancer progression by endowing cancer cells with more motility and aggressive phenotypes was reported to be a key underpinning of EMT [42, 43]. Cell cycle regulation and maintenance of cell adhesion promote tumor cell initiation and progression [44]. ccRCC has the highest angiogenic score compared to the other 18 epithelial cancer types, and has a high degree of immune infiltration; thus, antiangiogenic therapy and immunotherapy are the standard treatments for ccRCC [45, 46]. KRAS has been reported to be activated in various tumor types, regulating diverse downstream signals that facilitate cell proliferation, survival, differentiation, and invasion [47]. The IL2/STAT5 pathway is critical in many biological processes, including proliferation, apoptosis, and differentiation, and the dysregulation of STAT5 have been reported in different malignancies [48]. NF-κB signaling is a commonly abnormal activated pathway in cancer, and in addition to causing resistance to radiotherapy and chemotherapy, it also plays a crucial role in accelerating cancer development and malignant progression [49]. The GSEA results, as well as GO and KEGG enrichment analysis, demonstrated that lower PAQR5 expression was associated with these signaling pathway gene signatures, which might indicate that PAQR5 could negatively regulate proliferation, angiogenesis, invasion, metastasis, and tumorigenicity in ccRCC. This was also consistent with the relevant phenotypes obtained in our cellular experiments (Figs. 3, 4, 5 and 6), which further verified the reliability of our results.

The IL6-JAK-STAT3 pathway is always aberrantly overactivated in multiple cancers and dramatically impacts tumors by enabling various biological advances, such as angiogenesis, invasion, and metastasis, which are responsible for malignant progression and poor prognosis [24, 25, 50]. Activation of the IL6-JAK-STAT3 signaling pathway in cancer can promote tumor progression by promoting tumor growth, influencing the tumor microenvironment, and inducing antitumor immunity [27]. Since ICI significantly enhances the treatment of patients with advanced cancer, many studies have explored their relationship. The results showed that PD-1 and/or PD-L1 expression was induced by signal transduction through the IL6-JAK-STAT3 pathway [51–53]. Studies have confirmed that the IL6-JAK-STAT3 pathway is a promising prognostic risk pathway in ccRCC [54]. As shown in Fig. 5, downregulation of PAQR5 resulted in increased JAK2 phosphorylation and activation, and STAT3 was subsequently phosphorylated and activated by P-JAK2 and translocated from the cytosol to the nucleus, where binds to the promoter sequences of target genes and regulates gene transcription. Various genes, including MMP2, MMP9, BCL-2, survivin, and Cyclin family members, have been confirmed to be downstream target genes of STAT3. Therefore, downregulation of PAQR5 promoted the expression of MMP2, MMP9, CyclinD1, CyclinE1, and CDK2 by activating STAT3, which could accelerate the proliferation, invasion, and metastasis of ccRCC. Our gain- and loss-of-function assays further demonstrated the mechanism by which PAQR5 negatively regulates the IL6-JAK-STAT3 signaling pathway in ccRCC cells. Hence, the results above seem to explain why the low expression of PAQR5 in ccRCC led to malignant tumor progression and a worse prognosis. Overall, our findings revealed the biological functions and possible signaling pathways related to PAQR5, which were instructive for subsequent functional studies of PAQR5 in ccRCC, and provided new points for clinical targeted therapy.

There are some highlights of this study. On the one hand, the low expression of PAQR5 was not only analyzed in multiple comprehensive datasets but also validated by qRT‒PCR, western blot, immunohistochemistry, and tissue chip, making our results more credible. On the other hand, we uncovered the underlying mechanism of the PAQR5-mediated JAK/STAT3 pathway in ccRCC and verified related phenotypes through a series of in vitro and in vivo experiments. This provided a deeper understanding of the role of PAQR5 in ccRCC. However, there are some limitations. First, the study lacked treatment information, including in particular clinical datasets to validate the relationship between PAQR5 and patients receiving targeted therapy. In addition to tumor biology, multiple factors are involved in the survival prognosis of ccRCC patients. Moreover, the impact of PAQR5 in ccRCC still require further exploration, especially the more specific mechanism by which PAQR5 regulates the JAK/STAT3 signaling pathway.

Conclusion

In general, our study revealed the tumor suppressive effect of PAQR5 in ccRCC. Univariate/multivariate Cox regression analysis indicated that PAQR5 might serve as an independent prognostic factor for ccRCC, and the low expression of PAQR5 predicted disease progression and poorer prognosis. In addition, we also identified that PAQR5 suppressed ccRCC progression by inhibiting the JAK/STAT3 signaling pathway (Fig. 7F). Thus, PAQR5 is a promising biomarker that can predict clinical outcomes and treatment responses and may become a valuable new therapeutic target for ccRCC patients.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

ccRCC

clear cell renal cell carcinoma

PAQR5

progestin and adipoQ receptor family member 5

TKI

tyrosine kinase inhibitor

ICI

immune checkpoint inhibitor

JAK2

Janus kinase 2

STAT3

signal transducer and activator of transcription 3

NF-κB

nuclear factor-kappa B

EMT

epithelial-mesenchymal transition

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide

5-Aza

5-Aza-2’-deoxycytidine

GSEA

gene set enrichment analysis

FBS

fetal bovine serum

HR

hazard ratio

CI

confidence interval

KIRC

kidney renal clear cell carcinoma

Author Contribution

L. W, and Y.Y. Y performed the experiments. L. Z, M.X. J, and Y.Y. Y analyzed and interpreted the data. L. W and M.Z. Z wrote the manuscript. M.H. M, Y. L, and C. L provided critical suggestions. S. X, K. W, and X.Y. W revised the manuscript critically for important intellectual content. J.H. F and M.Z. Z designed and supervised the project. All authors discussed the results and commented on the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No: 81572520, 82103563). Key research and development plan in Shaanxi province (No. 2020SF-123 and 2020SF-195). Medical research program of department of science and technology of Xi’an, Shaanxi Province (No.2019115713 YX012SF048 (4)).

Data Availability

The datasets generated/analyzed during the current study are available.

Declarations

Ethics approval and consent to participate

This study was approved and supervised by the Ethical Committee of the First Affiliated Hospital of Medical College, Xi’an Jiaotong University, Xi’an, China. The study was conducted following the Declaration of Helsinki principles.

Competing interests

The authors have no conflicts of interest to declare.